Search Results

Search found 2400 results on 96 pages for 'some noob student'.

Page 78/96 | < Previous Page | 74 75 76 77 78 79 80 81 82 83 84 85  | Next Page >

  • rails use counts in diferent views

    - by Oluf Nielsen
    Hello i guess this is going to be pretty noob question.. But.. I have an scaffold called list, which has_many :wishes. And with that information in my model, I can in my list view use this code <%=h @list.wishes.count % well now I have made an controller called statusboard.. And in that' I have 3 functions.. Or how to say it.. but it is Index, loggedin, loggedout.. And .. In loggedin and in the file #app/views/statusboard/loggedin.html.erb i want to display this.. Howdy {Username}, you have made {count lists} lists, and {count wishes} wishes here is that i figured i should write in my file.. Howdy {Username}, you have made <%=h @user.list.count % lists, and <%=h @user.wishes.count % wishes my list model is like this = class List < ActiveRecord::Base   attr_accessible :user_id, :name, :description   belongs_to :users   has_many :wishes end and my wish model is like this = class Wish < ActiveRecord::Base   attr_accessible :list_id, :name, :price, :link, :rating, :comment   belongs_to :list end and last my user model is like this = class User < ActiveRecord::Base   # Include default devise modules. Others available are:   # :token_authenticatable, :lockable and :timeoutable   devise :database_authenticatable, :registerable,# :confirmable,              :recoverable, :rememberable, :trackable, :validatable   # Setup accessible (or protected) attributes for your model   attr_accessible :email, :password, :password_confirmation   has_many :lists end i hope someone can help me :-)! / Oluf Nielsen

    Read the article

  • Javascript Print Script Not Working in IE

    - by TY
    Greets! I'm a noob struggling to learn html and javascript - getting there slowly. I'm trying to print a DIV served up by SimpleModal. The page is at: www.planetsarsfield.com This "Print" function is in the recipe box at the bottom. Everything works great in FF, but it doesn't work at all in IE8. I must be doing something fundamentally wrong but I can't spot it. Any ideas? Cheers, TY ++++++++++++++++++++++++++++++++++++++++++++++++ <script type="text/javascript"> function PrintElem(elem) { Popup($(elem).html()); } function Popup(data) { var mywindow = window.open('', 'basic-modal-content', 'height=400,width=600'); mywindow.document.write('<html><head><title>on the grill... latest recipe</title>'); mywindow.document.write('<link href="PATH/print.css" rel="stylesheet" type="text/css" />') mywindow.document.write('</head><body >'); mywindow.document.write(data); mywindow.document.write('</body></html>'); mywindow.document.close(); mywindow.print(); return true; } </script>

    Read the article

  • Find Search Replace from landmark to landmark - including everything in between

    - by Erick Tronboll
    Appreciate some Jedi help... I have the following string: gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR repeating sporadically throughout my document and want to remove everything from: gi|37463 to the AAMGR sequence but, I want to keep the blocks where JQ250 appears: gi|374638936|gb|*JQ250*332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC and remove only the lines that have AEZ554 gi|374638939|gb|*AEZ554*52.1| myosin light chain 2, partial [Batrachoseps major] AAMGR ..................................... So, ideally the following block: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638935|gb|AEZ55450.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638937|gb|AEZ55451.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR Would be left as just: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC ................................many thanks as I help a struggling Grad Student

    Read the article

  • Add KO "data-bind" attribute on $(document).ready

    - by M.Babcock
    Preface I've rarely ever been a JS developer and this is my first attempt at doing something with Knockout.js. The question to follow likely illustrates both points. Backgound I have a fairly complex MVC3 application that I'm trying to get to work with KO (v2.0.0.0). My MVC app is designed to generically control which fields appear in the view (and how they are added to the view). It makes use of partial views to decide what to draw in the view based on the user's permissions (If the user is in group A then show control A, if the user in group B then show control B or possibly if the user is in group A don't include the control at all). Also, my model is very flat so I'm not sure the built-in ability to apply my ViewModel to a specific portion of the view will help. My solution to this problem is to provide an action in my controller that responds with an object in JSON format with that contains the JQuery selector and the content to assign to the "data-bind" attribute and bind the ViewModel to the View in the $(document).ready event using the values provided. Failed Proof-of-concept My first attempt at proving that this works doesn't actually seem to work, and by "doesn't work" I mean it just doesn't bind the values at all (as can be seen in this jsfiddle). I've tried it with the applyBindings inside of the ready event and not, but it doesn't seem to make any bit of difference. Question What am I doing wrong? Or is this just not something that can work with KO (though I've seen at least one example online doing the same thing and it supposedly works)? Like I said in the preface, I've only ever pretended to be a JS developer (though I've generally gotten it to work in the past) so I'm at a loss where to start trying to figure out what I'm doing wrong. Hopefully this isn't a real noob question.

    Read the article

  • Updating multiple related tables in SQLite

    - by PerryJ
    Just some background, sorry so long winded. I'm using the System.Data.SQLite ADO.net adapter to create a local sqlite database and this will be the only process hitting the database, so I don't need to worry about concurrency. I'm building the database from various sources and don't want to build this all in memory using datasets or dataadapters or anything like that. I want to do this using SQL (DdCommands). I'm not very good with SQL and complete noob in sqlite. I'm basically using sqlite as a local database / save file structure. The database has a lot of related tables and the data has nothing to do with People or Regions or Districts, but to use a simple analogy, imagine: Region table with auto increment RegionID, RegionName column and various optional columns. District table with auto increment DistrictID, DistrictName, RegionId, and various optional columns Person table with auto increment PersonID, PersonName, DistrictID, and various optional columns So I get some data representing RegionName, DistrictName,PersonName, and other Person related data. The Region, District and/or Person may or may not be created at this point. Once again, not being the greatest with this, my thoughts would be something like: Check to see if Region exists and if so get the RegionID else create it and get RegionID Check to see if District exists and if so get the DistrictID else create it adding in RegionID from above and get DistrictID Check to see if Person exists and if so get the PersonID else create it adding in DistrictID from above and get PersonID Update Person with rest of data. In MS SQL Server I would create a stored procedure to handle all this. Only way I can see to do this with sqlite is a lot of commands. So I'm sure I'm not getting this. I've spent hours looking around on various sites but just don't feel like I'm going down the right road. Any suggestions would be greatly appreciated.

    Read the article

  • iPhone sdk Cocoa Touch - Pass touches down from parent UIView to child UIScrollview

    - by Joe
    I have a UIView inside my xib in IB and inside that is a UIScrollview that is a small 80x80 square and dynamically loaded with 8 or so 80 x 80 thumbnail images. The UIScrollview is not clipping the images so that they extend out either side so you can swipe left and right to scroll a chosen image into the the centre, paging is on so they snap ti each image. I have researched and found this is the best and possibly only way to do this. The UIScrollview sits in a 'container' UIView for one reason, it is there to receive the touches/swipes and pass them down to it's child the UIScrollview as otherwise all touches would have to start in the small 80x80 UIScrollview area and I wan them to be anywhere along the row of images. I have seen some sample code somewhere for doing this but just can not implement it. Treat me as a noob, starting from beginning to end, how should the UIView and UIScrollview be set up in IB to allow any touches to be passed, and what code should I put into where? The UIView is set up as scroll_container and the child UIScrollview is char_scroll At the moment I have got it all working except for the touches being passed from the parent to the child, and at the moment the touches have to always start inside the UIScrollview (tiny 80x80 box in centre) when I want to be able to swipe left or right in the long 480X80 horizontal parent UIView and have this still scroll the child UIScrollview. Hope you can help and understand what I mean!

    Read the article

  • Question about MySQLdb, OS X 10.5, and authentication

    - by timpone
    I'm a noob at Python and have been having problems with MySQLdb and OS X Leopard 10.5. I have a php app that is doing db access just fine with pdo but also want to access with Python. When I use the same credentials with MySQLdb as php, I get the following error: File "build/bdist.macosx-10.5-i386/egg/MySQLdb/connections.py", line 188, in __init__ _mysql_exceptions.OperationalError: (1045, "Access denied for user 'arc_db'@'localhost' (using password: YES)") The authentication piece works fine on my ubuntu server (installed via apt-get) implying that it is something specific to my OS X MySQLdb install. Looking at some postings, I thought it would be my local build of MySQLdb which seems to be problematic with OS X. But I am able to import fine: Python 2.5.1 (r251:54863, Feb 6 2009, 19:02:12) [GCC 4.0.1 (Apple Inc. build 5465)] on darwin Type "help", "copyright", "credits" or "license" for more information. >>> import MySQLdb >>> Also, wanting to create a positive, I am able to access and return results from a database tilted test_something (which presumably bypasses the MySQL's authtentication - not sure exactly how though). Trying to figure out a little more what is going on, I turn on logging for mysql and get the following (added my own comments): 100609 19:09:45 3 Connect Access denied for user 'arc_db'@'localhost' (using password: YES) //not worked 100609 19:10:02 4 Connect arc_db@localhost on arc_development //did work I'm not really sure what the 3 or 4 means but presumably a sucess or failue. So, I guess what would be the next step? Am I doing some obvious stupid python mistake (very likely)? Is there a better way for me to prove that this should / can be working? Is there any way to determine what MySQLdb is sending exactly in its authentication message to MySQL? thanks

    Read the article

  • Javascript Error with DataTable jQuery plugin

    - by stevoyoung
    I am getting a JS error and what to know what it means and how to solve it. (JS noob here) Error: "tId is not defined" Line of JS with error: "if (s[i].sInstance = tId) { " More Information I am using the Data Table (http://datatables.net) jQuery plugin. I have a two tables with a class of "dataTable" loaded on a page (inside of jQuery UI tabs). The tables render as expected but I get the error above in Firebug. Attached is my Data Table config file... $(document).ready(function() { //Take from: http://datatables.net/forums/comments.php?DiscussionID=1507 // before creating a table, make sure it is not already created. // And if it is, then remove old version before new one is created var currTable = $(".dataTable"); if (currTable) { // contains the dataTables master records var s = $(document).dataTableSettings; if (s != 'undefined') { var len = s.length; for (var i=0; i < len; i++) { // if already exists, remove from the array if (s[i].sInstance = tId) { s.splice(i,1); } } } } oTable = $('.dataTable').dataTable({ "bJQueryUI": true, "sPaginationType": "full_numbers", "bFilter": false }); }); What does the error mean and how do I resolve it?

    Read the article

  • Javascript: Collision detection

    - by jack moore
    Hello, could someone please help me to understand how collision detection works in JS? I can't use jQuery or gameQuery - already using prototype - so, I'm looking for something very simple. Not asking for complete solution, just point me to the right direction. Let's say there's: <div id="ball"></div> and <div id="someobject0"></div> Now the ball is moving (any direction). "Someobject"(0-X) is already pre-defined and there's 20-60 of them randomly positioned like this: #someobject {position: absolute; top: RNDpx; left: RNDpx;} I can create an array with "someobject(X)" positions and test collision while the "ball" is moving... Something like: for(var c=0; c<objposArray.length; c++){ ........ and code to check ball's current position vs all objects one by one.... } But I guess this would be a "noob" solution and it looks pretty slow. Is there anything better?

    Read the article

  • WPF - How to properly reference a class from XAML

    - by Andy T
    OK, this is a super super noob question, one that I'm almost embarrassed to ask... I want to reference a class in my XAML file. It's a DataTemplateSelector for selecting the right edit template for a DataGrid column. Anyway, I've written the class into my code behind, added the local namespace to the top of top of the XAML, but when I try to reference the class from the XAML, it tells me the class does not exist in the local namespace. I must be missing something really really simple but I just can't understand it... Here's my code. XAML: <Window xmlns="http://schemas.microsoft.com/winfx/2006/xaml/presentation" xmlns:x="http://schemas.microsoft.com/winfx/2006/xaml" xmlns:tk="http://schemas.microsoft.com/wpf/2008/toolkit" xmlns:local="clr-namespace:CustomFields" xmlns:col="clr-namespace:System.Collections;assembly=mscorlib" xmlns:sys="clr-namespace:System;assembly=mscorlib" x:Class="CustomFields.MainWindow" x:Name="Window" Title="Define Custom Fields" Width="425" Height="400" MinWidth="425" MinHeight="400"> <Window.Resources> <ResourceDictionary> <local:RangeValuesEditTemplateSelector> blah blah blah... </local:RangeValuesEditTemplateSelector> </ResourceDictionary> </Window.Resources> C#: namespace CustomFields { /// /// Interaction logic for MainWindow.xaml /// public partial class MainWindow : Window { public MainWindow() { this.InitializeComponent(); // Insert code required on object creation below this point. } } public class RangeValuesEditTemplateSelector : DataTemplateSelector { public RangeValuesEditTemplateSelector(){ MessageBox.Show("hello"); } } } Any ideas what I'm doing wrong? I thought this should be simple as 1-2-3... Thanks! AT

    Read the article

  • Updating multiple related tables in SQLite with C#

    - by PerryJ
    Just some background, sorry so long winded. I'm using the System.Data.SQLite ADO.net adapter to create a local sqlite database and this will be the only process hitting the database, so I don't need to worry about concurrency. I'm building the database from various sources and don't want to build this all in memory using datasets or dataadapters or anything like that. I want to do this using SQL (DdCommands). I'm not very good with SQL and complete noob in sqlite. I'm basically using sqlite as a local database / save file structure. The database has a lot of related tables and the data has nothing to do with People or Regions or Districts, but to use a simple analogy, imagine: Region table with auto increment RegionID, RegionName column and various optional columns. District table with auto increment DistrictID, DistrictName, RegionId, and various optional columns Person table with auto increment PersonID, PersonName, DistrictID, and various optional columns So I get some data representing RegionName, DistrictName,PersonName, and other Person related data. The Region, District and/or Person may or may not be created at this point. Once again, not being the greatest with this, my thoughts would be something like: Check to see if Region exists and if so get the RegionID else create it and get RegionID Check to see if District exists and if so get the DistrictID else create it adding in RegionID from above and get DistrictID Check to see if Person exists and if so get the PersonID else create it adding in DistrictID from above and get PersonID Update Person with rest of data. In MS SQL Server I would create a stored procedure to handle all this. Only way I can see to do this with sqlite is a lot of commands. So I'm sure I'm not getting this. I've spent hours looking around on various sites but just don't feel like I'm going down the right road. Any suggestions would be greatly appreciated.

    Read the article

  • Comma Seperated Values and LIKE php/mysql Troubles

    - by Jay
    The Set up This is more or less a follow up question to something I had previously posted regarding comma separated values (explode,implode). Here's the scenario which has been stomping me the last few days as I'm a noob--sorry for the lengthy post. I'm passing a variable via the url (index.php?id=variable), I then check the database to find the rows containing that variable using SELECT * FROM table WHERE column LIKE '%$variable%' I'm using the wildcards because the results are a comma separated value with the variable appearing multiple times in the database. So if we were assigning-- say schools to popular tv shows..my database is set up so that the user can assign more than one school to the tv show. IE. South Park-- fsu, nyu ,mit Archer -- harvard, nyu Index.php?id=nyu would display Sourth Park & Archer. The Problem Because I am using Like '%variable%' If I have the following: South Park--uark Archer--ua index.php?=ua Instead of just Archer showing, Southpark would also show. Which makes sense due to the wildcards...but can anyone think of a way to do this achieving the results I want?..Is there any way achieve more precise results using a comma separated value?..I'm completely stomped and will appreciate any help.

    Read the article

  • Am I under risk of CSRF attacks in a POST form that doesn't require the user to be logged in?

    - by Monika Sulik
    I'm probably being a total noob here, but I'm still uncertain about what a CSRF (Cross-Site Request Forgery) attack is exactly. So lets look at three situations... 1) I have a POST form that I use to edit data on my site. I want this data to be edited only by users that are logged in. 2) I have a site, which can be used by both users who are logged in as well as guests. Parts of the site are for logged in users only, but there are also POST forms that can be used by all users - anonymous and not (for example a standard contact form). Should the contact form be safeguarded against CSRF attacks? 3) I have a site which doesn't have an authentication system at all (well, perhaps that's unrealistic, so lets say it has an admin site which is separate from the rest of it and the admin part is properly safeguarded). The main part of the site is only used by anonymous users. Do the POST forms on it need to be safeguarded? In the case of 1) the answer is clearly yes. But in the case of 2 and 3 I don't know (and is the difference between 2 and 3 even significant?).

    Read the article

  • Why wouldn't a flex remoteobject be able to work within a custom component?

    - by Gary
    Please enlighten this flex noob. I have a remoteobject within my main.mxml. I can call a function on the service from an init() function on my main.mxml, and my java debugger triggers a breakpoint. When I move the remoteobject declaration and function call into a custom component (that is declared within main.mxml), the remote function on java-side no longer gets called, no breakpoints triggered, no errors, silence. How could this be? No spelling errors, or anything like that. What can I do to figure it out? mxml code: < mx:RemoteObject id="myService" destination="remoteService" endpoint="$(Application.application.home}/messagebroker/amf" > < /mx:RemoteObject > function call is just 'myService.getlist();' when I move it to a custom component, I import mx.core.Application; so the compiler doesn't yell my child component: child.mxml <mx:Panel xmlns:mx="http://www.adobe.com/2006/mxml" creationComplete="init()" > <mx:Script> <![CDATA[ import mx.core.Application; public function init():void { helloWorld.sayHello(); } ]]> </mx:Script> <mx:RemoteObject id="helloWorld" destination="helloService" endpoint="$(Application.application.home}/messagebroker/amf" /> <mx:Label text="{helloWorld.sayHello.lastResult}" /> </mx:Panel> my main.mxml: <mx:Application xmlns:mx="http://www.adobe.com/2006/mxml" creationComplete="init()" xmlns:test="main.flex.*" > <mx:Script> <![CDATA[ [Bindable] public var home:String; [Bindable] public var uName:String; public function init():void { //passed in by wrapper html home = Application.application.parameters.appHome; uName = Application.application.parameters.uName; } ]]> </mx:Script> <test:child /> </mx:Application>

    Read the article

  • What are the attack vectors for passwords sent over http?

    - by KevinM
    I am trying to convince a customer to pay for SSL for a web site that requires login. I want to make sure I correctly understand the major scenarios in which someone can see the passwords that are being sent. My understanding is that at any of the hops along the way can use a packet analyzer to view what is being sent. This seems to require that any hacker (or their malware/botnet) be on the same subnet as any of the hops the packet takes to arrive at its destination. Is that right? Assuming some flavor of this subnet requirement holds true, do I need to worry about all the hops or just the first one? The first one I can obviously worry about if they're on a public Wifi network since anyone could be listening in. Should I be worried about what's going on in subnets that packets will travel across outside this? I don't know a ton about network traffic, but I would assume it's flowing through data centers of major carriers and there's not a lot of juicy attack vectors there, but please correct me if I am wrong. Are there other vectors to be worried about outside of someone listening with a packet analyzer? I am a networking and security noob, so please feel free to set me straight if I am using the wrong terminology in any of this.

    Read the article

  • Windows Server 2008 R2 RAS VPN: access server on internal interface ip

    - by Mathias
    short question: I'm usually a linux admin but need to setup a Win2k8 R2 server for a student project. The server is running as VM on a root server and has a public internet IP assigned. Additionally I need a VPN server to access some services running on the server. I managed to set up a working VPN gateway via the Routing and RAS service which assigns clients an IP in the private subnet 192.168.88.0/24 with the Interface "Internal" listening on 192.168.88.1. Additionally I set up the external interface as NAT interface. So I can connect to the VPN server, get an IP assigned and the server additionally does NAT and I can access the internet over the VPN connection. The only thing I additionally need, is that I can access the server itself over that internal IP (e.g. client 192.168.88.2, server 192.168.88.1) as I want to access some services which I don't like to expose to the internet and restrict them to connected VPN clients. Does anybody have a hint, which configuration I'm missing here to be able to access the server over the VPN connection? EDIT: VPN clients get assigned the IP from the private subnet with subnetmask 255.255.255.255, I guess that might be the reason I can't access the server on the private IP address although it's in the same network range. Any ideas how to change this? I defined a static address pool in the Routing and RAS service, but I can't change the netmask there. EDIT2: I can't access the server from the client, but I can fully access the client from the server (ping, HTTP). I guess it has to do with firewall configuration. Thanks in advance, Mathias

    Read the article

  • Where to put external archives to configure running in Eclipse?

    - by Buggieboy
    As a Java/Eclipse noob coming from a Visual Studio .NET background, I'm trying to understand how to set up my run/debug environment in the Eclipse IDE so I can start stepping through code. I have built my application with separate src and bin hierarchies for each library project, and each project has its own jar. For example, in a Windows environment, I have something like: c:\myapp\myapp_main\src\com\mycorp\myapp\main ...and a parallel "bin" tree like this: c:\myapp\myapp_main\bin\com\mycorp\myapp\main Other supporting projects are, similarly: **c:\myapp\myapp_util\src\com\mycorp\myapp\uti**l (and a parallel "bin" tree.) ... etc. So, I end up with, e.g., myapp_util.jar in the ...\myapp_util\bin... path and then add that as an external archive to my myapp_main project. I also use utilities like gluegen-rt.jar, which I add ad external dependencies to the projects requiring them. I have been able to run outside of the Eclipse environment, by copying all my project jars, gluegen-rt DLL, etc., into a "lib" subfolder of some directory and executing something like: java -Djava.library.path=lib -DfullScreen=false -cp lib/gluegen-rt.jar;lib/myapp_main.jar;lib/myapp_util.jar; com.mycorp.myapp.Main When I first pressed F11 to debug, however, I got a message about something like /com/sun/../glugen... not being found by the class loader. So, to debug, or even just run, in Ecplipse, I tried setting up my VM arguments in the Galileo Debug - (Run/Debug) Configurations to be the command line above, beginning at "-Djava.libary.path...". I've put a lib subdirectory - just like the above with all jars and the native gluegen DLL - in various places, such as beneath the folder that my main jar is built in and as a subfolder of my Ecplipse starting workspace folder, but now Eclipse can't find the main class: java.lang.NoClassDefFoundError: com.mycorp.myapp.Main Although the Classpath says that it is using the "default classpath", whatever that is. Bottom line, how do I assemble the constituent files of a multi-project application so that I can run or debug in Ecplipse?

    Read the article

  • Returning from dll (Asynchronous sockets)

    - by Juha
    I am trying to do a simple http-server in (c++) dll-file that I can use from managed (C#) application with P/Invoke. I was trying to do this with asynchronous functions (WSAAsyncSelect() and stuff), so that I could manage server by calling functions inside dll whenever needed and after that it would return to my main program. Now I'm not sure if that is even possible. It seems that "main function" in dll, the function that starts the server, has to include message loop or something and since it's a loop, it doesn't return from dll ever. Could I somehow do this message stuff in my managed application and call some function in dll when there is something to do? Or is it even possible to do this stuff in one thred? I would really like to avoid all concurrency stuff. The dll looks now basicly the same as here, main function is the one that I call from managed C# program and would like to return to there after calling the function. http://www.winsocketdotnetworkprogramming.com/winsock2programming/winsock2advancediomethod5b.html I'm quite noob in windows programming, and never even heard of this message-queue or message-loop.

    Read the article

  • Windows Server 2008 R2 RAS VPN: access server on internal interface ip

    - by Mathias
    Hey, short question: I'm usually a linux admin but need to setup a Win2k8 R2 server for a student project. The server is running as VM on a root server and has a public internet IP assigned. Additionally I need a VPN server to access some services running on the server. I managed to set up a working VPN gateway via the Routing and RAS service which assigns clients an IP in the private subnet 192.168.88.0/24 with the Interface "Internal" listening on 192.168.88.1. Additionally I set up the external interface as NAT interface. So I can connect to the VPN server, get an IP assigned and the server additionally does NAT and I can access the internet over the VPN connection. The only thing I additionally need, is that I can access the server itself over that internal IP (e.g. client 192.168.88.2, server 192.168.88.1) as I want to access some services which I don't like to expose to the internet and restrict them to connected VPN clients. Does anybody have a hint, which configuration I'm missing here to be able to access the server over the VPN connection? EDIT: VPN clients get assigned the IP from the private subnet with subnetmask 255.255.255.255, I guess that might be the reason I can't access the server on the private IP address although it's in the same network range. Any ideas how to change this? I defined a static address pool in the Routing and RAS service, but I can't change the netmask there. EDIT2: I can't access the server from the client, but I can fully access the client from the server (ping, HTTP). I guess it has to do with firewall configuration. Thanks in advance, Mathias

    Read the article

  • Apache / PHP Begins to Deny SQL Requests after about 2000

    - by Daniel Stern
    We have a web page on our server that we use to run administrative scripts. For example, we might run the script "unenrolStudents()" which runs 5,000 SQL SET commands one after another and sets 5000 student entries in an SQL database to unenrolled. However, we are finding that after running a few thousand queries (it is not totally consistent) we will be "locked out" by our server. SYMPTOMS OF LOCKING OUT: - unable to connect to server with winSCP - opening putty with that connection shows a blank screen (no login / pass) - clearing cookies / cache in chrome does NOT fix locking out - other computers in the office ALSO become locked out - locking out can be triggered with a high frequency of requests (10000 in 1 second) or by less over time (10000 in 500 seconds - this will still cause a lockout even though the frequency is much less) We believe this is a security feature of our own Apache. I know we are using Suhosin but I didn't configure it so I don't know. How can I disable this locking effect so that I can confidently run all my SQL requests and they will go through? Has anyone else dealt with this and found workarounds? Thanks DS

    Read the article

  • Get the parent id..

    - by tixrus
    I have a bunch of elements like the following: <div class="droppableP" id="s-NSW" style="width:78px; height:63px; position: absolute; top: 223px; left: 532px;"> </div> They all have class droppableP but different id's obviously and I would like to factor the code in this script I am hacking on. The original script just has a specific selector for each of one of these divs, but the code is all alike except for the id it does things to, which is either the id of the parent or another div with a name that's related to it. Here is the original code specifically for this div: $("#s-NSW > .sensible").droppable( { accept : "#i-NSW", tolerance : 'intersect', activeClass : 'droppable-active', hoverClass : 'droppable-hover', drop : function() { $('#s-NSW').addClass('s-NSW'); $('#s-NSW').addClass('encastrada'); //can't move any more.. $('#i-NSW').remove(); $('#s-NSW').animate( { opacity: 0.25 },200, 'linear'); checkWin(); } }); Here is how I would like to factor so the same code can do all of them and I will eventually do chaining as well and maybe get rid of the inline styles but here is my first go: $(".droppableP > .sensible").droppable( { accept : "#i" + $(this).parent().attr('id').substring(2), tolerance : 'intersect', activeClass : 'droppable-active', hoverClass : 'droppable-hover', drop : function() { $(this).parent().addClass($(this).parent().attr('id')); $(this).parent().addClass('encastrada'); $("#i" + ($this).parent().attr('id').substring(2)).remove(); $(this).parent().animate( { opacity: 0.25 },200, 'linear'); checkWin(); } }); The error I get is $(this).parent().attr("id") is undefined Many thanks. I have browsed related questions the one I understand that's closest to mine, turns out they didn't need parent function at all. I'm kind of a noob so please don't yell at me too hard if this is a stupid question.

    Read the article

  • PostgreSQL: BYTEA vs OID+Large Object?

    - by mlaverd
    I started an application with Hibernate 3.2 and PostgreSQL 8.4. I have some byte[] fields that were mapped as @Basic (= PG bytea) and others that got mapped as @Lob (=PG Large Object). Why the inconsistency? Because I was a Hibernate noob. Now, those fields are max 4 Kb (but average is 2-3 kb). The PostgreSQL documentation mentioned that the LOs are good when the fields are big, but I didn't see what 'big' meant. I have upgraded to PostgreSQL 9.0 with Hibernate 3.6 and I was stuck to change the annotation to @Type(type="org.hibernate.type.PrimitiveByteArrayBlobType"). This bug has brought forward a potential compatibility issue, and I eventually found out that Large Objects are a pain to deal with, compared to a normal field. So I am thinking of changing all of it to bytea. But I am concerned that bytea fields are encoded in Hex, so there is some overhead in encoding and decoding, and this would hurt the performance. Are there good benchmarks about the performance of both of these? Anybody has made the switch and saw a difference?

    Read the article

  • OAuth secrets in mobile apps

    - by Felixyz
    When using the OAuth protocol, you need a secret string obtained from the service you want to delegate to. If you are doing this in a web app, you can simply store the secret in your data base or on the file system, but what is the best way to handle it in a mobile app (or a desktop app for that matter)? Storing the string in the app is obviously not good, as someone could easily find it and abuse it. Another approach would be to store it on you server, and have the app fetch it on every run, never storing it on the phone. This is almost as bad, because you have to include the URL in the app. I don't believe using https is any help. The only workable solution I can come up with is to first obtain the Access Token as normal (preferably using a web view inside the app), and then route all further communication through our server, where a script would append the secret to the request data and communicates with the provider. Then again, I'm a security noob, so I'd really like to hear some knowledgeable peoples' opinions on this. It doesn't seem to me that most apps are going to these lengths to guarantee security (for example, Facebook Connect seems to assume that you put the secret into a string right in your app). Another thing: I don't believe the secret is involved in initially requesting the Access Token, so that could be done without involving our own server. Am I correct?

    Read the article

  • Internet Radio Station for University

    - by ryan
    I am trying to help my University Student Radio station rethink the setup of the way they stream music, but I have some questions regarding the use of Ubuntu to stream music. Currently, the radio station uses two windows machines: one of which is used to stream the radio station and serve the website, and the other is used by rotating djs to select songs and create playlists. The computer used by djs feeds mono into the sound card of the server and the server streams the feed online. -Ideally I would like to maintain a two-computer setup: One computer as server, and another that is used to select and play music by rotating djs. -I would like to use Ubuntu for the server. -I would like to use Windows for the other machine. -The server should be able to stream song information. First, is there a way to somehow get the song information from an analog feed? Second, what is the best streaming server for radio? I have encountered shoutcast, icecast, and darwin, but I don't know where to begin in attempting to gauge them. Finally, if anyone has any tips or pointers about small internet radio station management/ setup they would be appreciated as this is my first radio station, and I am eager to hear of past experiences.

    Read the article

  • objective C architecture question

    - by thekevinscott
    Hey folks, I'm currently teaching myself objective C. I've gone through the tutorials, but I find I learn best when slogging through a project of my own, so I've embarked on making a backgammon app. Now that I'm partway in, I'm realizing there's some overall architecture things I just don't understand. I've established a "player" class, a "piece" class, and a "board" class. A piece theoretically belongs to both a player and the board. For instance, a player has a color, and every turn makes a move; so the player owns his pieces. At the same time, when moving a piece, it has to check whether it's a valid move, whether there are pieces on the board, etc. From my reading it seems like it's frowned upon to reach across classes. For instance, when a player makes a move, where should the function live that moves the piece? Should it exist on board? This would be my instinct, as the board should decide whether a move is valid or not; but the piece needs to initialize that query, as its the one being moved, no? Any info to help a noob would be super appreciated. Thanks guys!

    Read the article

< Previous Page | 74 75 76 77 78 79 80 81 82 83 84 85  | Next Page >