Search Results

Search found 64995 results on 2600 pages for 'data import'.

Page 781/2600 | < Previous Page | 777 778 779 780 781 782 783 784 785 786 787 788  | Next Page >

  • Is this a good way to do a game loop for an iPhone game?

    - by Danny Tuppeny
    Hi all, I'm new to iPhone dev, but trying to build a 2D game. I was following a book, but the game loop it created basically said: function gameLoop update() render() sleep(1/30th second) gameLoop The reasoning was that this would run at 30fps. However, this seemed a little mental, because if my frame took 1/30th second, then it would run at 15fps (since it'll spend as much time sleeping as updating). So, I did some digging and found the CADisplayLink class which would sync calls to my gameLoop function to the refresh rate (or a fraction of it). I can't find many samples of it, so I'm posting here for a code review :-) It seems to work as expected, and it includes passing the elapsed (frame) time into the Update method so my logic can be framerate-independant (however I can't actually find in the docs what CADisplayLink would do if my frame took more than its allowed time to run - I'm hoping it just does its best to catch up, and doesn't crash!). // // GameAppDelegate.m // // Created by Danny Tuppeny on 10/03/2010. // Copyright Danny Tuppeny 2010. All rights reserved. // #import "GameAppDelegate.h" #import "GameViewController.h" #import "GameStates/gsSplash.h" @implementation GameAppDelegate @synthesize window; @synthesize viewController; - (void) applicationDidFinishLaunching:(UIApplication *)application { // Create an instance of the first GameState (Splash Screen) [self doStateChange:[gsSplash class]]; // Set up the game loop displayLink = [CADisplayLink displayLinkWithTarget:self selector:@selector(gameLoop)]; [displayLink setFrameInterval:2]; [displayLink addToRunLoop:[NSRunLoop currentRunLoop] forMode:NSDefaultRunLoopMode]; } - (void) gameLoop { // Calculate how long has passed since the previous frame CFTimeInterval currentFrameTime = [displayLink timestamp]; CFTimeInterval elapsed = 0; // For the first frame, we want to pass 0 (since we haven't elapsed any time), so only // calculate this in the case where we're not the first frame if (lastFrameTime != 0) { elapsed = currentFrameTime - lastFrameTime; } // Keep track of this frames time (so we can calculate this next time) lastFrameTime = currentFrameTime; NSLog([NSString stringWithFormat:@"%f", elapsed]); // Call update, passing the elapsed time in [((GameState*)viewController.view) Update:elapsed]; } - (void) doStateChange:(Class)state { // Remove the previous GameState if (viewController.view != nil) { [viewController.view removeFromSuperview]; [viewController.view release]; } // Create the new GameState viewController.view = [[state alloc] initWithFrame:CGRectMake(0, 0, IPHONE_WIDTH, IPHONE_HEIGHT) andManager:self]; // Now set as visible [window addSubview:viewController.view]; [window makeKeyAndVisible]; } - (void) dealloc { [viewController release]; [window release]; [super dealloc]; } @end Any feedback would be appreciated :-) PS. Bonus points if you can tell me why all the books use "viewController.view" but for everything else seem to use "[object name]" format. Why not [viewController view]?

    Read the article

  • String search and write into file in jython

    - by kdev
    hi Everyone , i wish to write a program that can read a file and if a particular str_to_find is found in a bigger string say AACATGCCACCTGAATTGGATGGAATTCATGCGGGACACGCGGATTACACCTATGAGCAGAAATACGGCCTGCGCGATTACCGTGGCGGTGGACGTTCTTCCGCGCGTGAAACCGCGATGCGCGTAGCGGCAGGGGCGATCGCCAAGAAATACCTGGCGGAAAAGTTCGGCATCGAAATCCGCGGCTGCCTGACCCAGATGGGCGACATTCCGCTGGAGATTAAAGACTGGCGTCAGGTTGAGCTTAATCCGTTTTC then write that line and the above line of it into the file and keep repeating it for all the match found. Please suggest i have written the program for printing that particular search line but i dont know how to write the above line. Thanks everyone for your help. import re import string file=open('C:/Users/Administrator/Desktop/input.txt','r') output=open('C:/Users/Administrator/Desktop/output.txt','w') count_record=file.readline() str_to_find='AACCATGC' while count_record: if string.find(list,str_to_find) ==0: output.write(count_record) file.close() output.close()

    Read the article

  • Convert NSData to primitive variable with ieee-754 or twos-complement ?

    - by William GILLARD
    Hi every one. I am new programmer in Obj-C and cocoa. Im a trying to write a framework which will be used to read a binary files (Flexible Image Transport System or FITS binary files, usually used by astronomers). The binary data, that I am interested to extract, can have various formats and I get its properties by reading the header of the FITS file. Up to now, I manage to create a class to store the content of the FITS file and to isolate the header into a NSString object and the binary data into a NSData object. I also manage to write method which allow me to extract the key values from the header that are very valuable to interpret the binary data. I am now trying to convert the NSData object into a primitive array (array of double, int, short ...). But, here, I get stuck and would appreciate any help. According to the documentation I have about the FITS file, I have 5 possibilities to interpret the binary data depending on the value of the BITPIX key: BITPIX value | Data represented 8 | Char or unsigned binary int 16 | 16-bit two's complement binary integer 32 | 32-bit two's complement binary integer 64 | 64-bit two's complement binary integer -32 | IEEE single precision floating-point -64 | IEEE double precision floating-point I already write the peace of code, shown bellow, to try to convert the NSData into a primitive array. // self reefer to my FITS class which contain a NSString object // with the content of the header and a NSData object with the binary data. -(void*) GetArray { switch (BITPIX) { case 8: return [self GetArrayOfUInt]; break; case 16: return [self GetArrayOfInt]; break; case 32: return [self GetArrayOfLongInt]; break; case 64: return [self GetArrayOfLongLong]; break; case -32: return [self GetArrayOfFloat]; break; case -64: return [self GetArrayOfDouble]; break; default: return NULL; } } // then I show you the method to convert the NSData into a primitive array. // I restrict my example to the case of 'double'. Code is similar for other methods // just change double by 'unsigned int' (BITPIX 8), 'short' (BITPIX 16) // 'int' (BITPIX 32) 'long lon' (BITPIX 64), 'float' (BITPIX -32). -(double*) GetArrayOfDouble { int Nelements=[self NPIXEL]; // Metod to extract, from the header // the number of element into the array NSLog(@"TOTAL NUMBER OF ELEMENTS [%i]\n",Nelements); //CREATE THE ARRAY double (*array)[Nelements]; // Get the total number of bits in the binary data int Nbit = abs(BITPIX)*GCOUNT*(PCOUNT + Nelements); // GCOUNT and PCOUNT are defined // into the header NSLog(@"TOTAL NUMBER OF BIT [%i]\n",Nbit); int i=0; //FILL THE ARRAY double Value; for(int bit=0; bit < Nbit; bit+=sizeof(double)) { [Img getBytes:&Value range:NSMakeRange(bit,sizeof(double))]; NSLog(@"[%i]:(%u)%.8G\n",i,bit,Value); (*array)[i]=Value; i++; } return (*array); } However, the value I print in the loop are very different from the expected values (compared using official FITS software). Therefore, I think that the Obj-C double does not use the IEEE-754 convention as well as the Obj-C int are not twos-complement. I am really not familiar with this two convention (IEEE and twos-complement) and would like to know how I can do this conversion with Obj-C. In advance many thanks for any help or information.

    Read the article

  • Using Entity Framework with an SQL Compact Private Installation

    - by David Veeneman
    I am using Entity Framework 4 in a desktop application with SQL Compact. I want to use a private installation of SQL Compact with my application, so that my installer can install SQL Compact without giving the user a second installation to do. It also avoids versioning hassles down the road. My development machine has SQL Compact 3.5 SP1 installed as a public installation, so my app runs fine there, as one would expect. But it's not running on my test machine, which does not have SQL Compact installed. I get this error: The specified store provider cannot be found in the configuration, or is not valid. I know some people have had difficulty with SQL Compact private installations, but I have used them for a while, and I really like them. Unfortunately, my regular private installation approach isn't working. I have checked the version numbers on my SQL CE files, and they are all 3.8.8078.0, which is the SP2 RC version. Here are the files I have included in my private installation: sqlcecompact35.dll sqlceer35EN.dll sqlceme35.dll sqlceqp35.dll sqlcese35.dll System.Data.SqlServerCe.dll System.Data.SqlServerCe.Entity.dll I have added a reference to System.Data.SqlServerCe to my project, and I have verified that all of the files listed above are being copied to the application folder on the installation machine. Here is the code I use to configure an EntityConnectionStringBuilder when I open a SQL Compact file: var sqlCompactConnectionString = string.Format("Data Source={0}", filePath); // Set Builder properties builder.Metadata = string.Format("res://*/{0}.csdl|res://*/{0}.ssdl|res://*/{0}.msl", edmName); builder.Provider = "System.Data.SqlServerCe.3.5"; builder.ProviderConnectionString = sqlCompactConnectionString; var edmConnectionString = builder.ToString(); Am I missing a file? Am I missing a configuration stepp needed to tell Entity Framework where to find my SQL Compact DLLs? Any other suggestions why EF isn't finding my SQL Compact DLLs on the installation machine? Thanks for your help.

    Read the article

  • FusionCharts Sharepoint And dataUrl param.

    - by oivoodoo
    Hi, everyone. I have problem with fusioncharts evaluation in the ASP .NET(Sharepoint Portal). I am customizing survey list for providing new view. I added to scheme.xml the next code. <View BaseViewID="4" Type="HTML" WebPartZoneID="Main" DefaultView="TRUE" DisplayName="Charts" SetupPath="pages\viewpage.aspx" ImageUrl="/_layouts/images/survey.png" Url="overview.aspx" FreeForm="TRUE" ReadOnly="TRUE"> <!-- _locID@DisplayName="camlidV1" _locComment=" " --> <Toolbar Type="Standard" /> <ViewFields> </ViewFields> <ViewEmpty> <SetVar Name="HandlerUrl">/_layouts/IEFS/SurveyHandler.aspx</SetVar> <HTML> <![CDATA[ <!-- START Code Block for Chart 'ChartName' --> <object classid="clsid:d27cdb6e-ae6d-11cf-96b8-444553540000" codebase="http://fpdownload.macromedia.com/pub/shockwave/cabs/flash/swflash.cab#version=8,0,0,0" width="350" height="350" name="SurveyChart"> <param name="allowScriptAccess" value="always" /> <param name="movie" value="/_layouts/IEFS/FusionCharts/MSCombi3D.swf"/> <param name="FlashVars" value="&chartWidth=350&chartHeight=350&debugMode=1&dataURL=]]> </HTML> <GetVar Name="HandlerUrl" /> <HTML> <![CDATA["/>]]> </HTML> <HTML> <![CDATA[ <param name="quality" value="high" /> <embed src="/_layouts/IEFS/FusionCharts/MSCombi3D.swf" FlashVars="&chartWidth=350&chartHeight=350&debugMode=1&dataURL=]]> </HTML> <GetVar Name="HandlerUrl" /> <HTML> <![CDATA[" quality="high" width="350" height="350" name="ChartName" allowScriptAccess="always" type="application/x-shockwave-flash" pluginspage="http://www.macromedia.com/go/getflashplayer" /> </object> <!-- END Code Block for Chart 'ChartName' --> ]]> </HTML> </ViewEmpty> As you can see I've just create standard object tag of fusioncharts control(I got it from examples). But when page is rendered I can see the next following error: And I have error: INFO: XML Data provided using dataURL method. dataURL provided: ./_layouts/IEFS/SurveyHandler.aspx dataURL invoked: ./_layouts/IEFS/SurveyHandler.aspx?FCTime=223 ERROR: An error occurred while loading data. Please check your dataURL, by clicking on the "dataURL invoked" link above, to see if it's returing valid XML data. Common causes for error are: No URL Encoding provided for querystrings in dataURL. If your dataURL contains querystrings as parameters, you'll need to URL Encode the same. e.g., Data.asp?id=101&subId=242 should be Data%2Easp%3Fid%3D101%26subId%3D242 Different sub-domain of chart .swf and dataURL. Both need to be same owing to sandbox security. Network error My data-page(handler) is rendered valid xml data. I read this link http://www.fusioncharts.com/docs?/Debug/Basic.html, but it doesn't help me. Have ever you seen same error before? With The Best Regards, Alexander.

    Read the article

  • Does jQuery ajaxSetup method not work with $.get or $.post?

    - by Justin Poliey
    Does the jQuery $.ajaxSetup method not respect the data field in the options hash when $.post or $.get is called? For example, I might have this code: $.ajaxSetup({ data: { persist: true } }); Then, to send a POST request, I would call this: $.post("/create/something", { name: "foo" }); I was expecting the actual POST data to look like this: { persist: true, name: "foo" } but the only data sent by $.post is { name: "foo" }. Is there any way to get the expected behavior? I'm using jQuery 1.4.1.

    Read the article

  • Rewriting URL's in codeigniter with url_title()?

    - by Craig Ward
    I am rewriting my website with codeigniter and have something I want to do but not sure it is possible. I have a gallery on my site powered by the Flickr API. Here is an example of the code I use to display the Landscape pictures: <?php foreach ($landscapes->photoset->photo as $l->photoset->photo) : ?> <a >photoset->photo->farm ?>/<?php echo $l->photoset->photo->server ?>/<?php echo $l->photoset->photo->id ?>/<?php echo $l->photoset->photo->secret ?>/<?php echo $l->photoset->photo->title ?>'> <img class='f_thumb'>photoset->photo->farm ?>.static.flickr.com/<?php echo $l->photoset->photo->server ?>/<?php echo $l->photoset->photo->id ?>_<?php echo $l->photoset->photo->secret ?>_s.jpg' title='<?php echo $l->photoset->photo->title ?>' alt='<?php echo $l->photoset->photo->title ?>' /></a> <?php endforeach; ?> As you can see when a user clicks on a picture I pass over the Farm, Server, ID, Secret and Title elements using URI segments and build the page in the controller using $data['farm'] = $this->uri->segment(3); $data['server'] = $this->uri->segment(4); $data['id'] = $this->uri->segment(5); $data['secret'] = $this->uri->segment(6); $data['title'] = $this->uri->segment(7); Everything works and is fine but the URL’s are a tad long, example “http://localhost:8888/wip/index.php/gallery/focus/3/2682/4368875046/e8f97f61d9/Old Mill House in Donegal” Is there a way to rewrite the URL so its more like “http://localhost:8888/wip/index.php/gallery/focus/Old_Mill_House_in_Donegal” I was looking at using: $url_title = $this->uri->segment(7); $url_title = url_title($url_title, 'underscore', TRUE); But I don’t seem to be able to get it to work. Any ideas?

    Read the article

  • Sequence reduction in R

    - by drknexus
    Assume you have a vector like so: v <- c(1,1,1,2,2,2,2,1,1,3,3,3,3) How can it be best reduced to a data.frame like this? v.df <- data.frame(value=c(1,2,1,3),repetitions=c(3,4,2,4)) In a procedural language I might just iterate through a loop and build the data.frame as I go, but with a large dataset in R such an approach is inefficient. Any advice?

    Read the article

  • $.getJson> $.each returns undefined

    - by Der Sep
    function getData(d){ Back = new Object(); $.getJSON('../do.php?', function(response){ if(response.type == 'success'){ Back = { "type" : "success", "content" : "" }; $.each(response.data, function(data){ Back.content +='<div class="article"><h5>'+data.title+'</h5>' Back.content +='<div class="article-content">'+data.content+'</div></div>'; }); } else{ Back = {"type" : "error" }; } return Back; }); } console.log(getData()); is returning undefined! why?

    Read the article

  • Parsing Json Feeds with google Gson

    - by mnml
    I would like to know how to parse a json feed by items, eg. url / title / description for each item. I have had a look to the doc / api but, it didn't help me. This is what I got so far import com.google.gson.Gson; import com.google.gson.JsonObject; public class ImportSources extends Job { public void doJob() throws IOException { String json = stringOfUrl("http://feed.test/all.json"); JsonObject jobj = new Gson().fromJson(json, JsonObject.class); Logger.info(jobj.get("responseData").toString()); } public static String stringOfUrl(String addr) throws IOException { ByteArrayOutputStream output = new ByteArrayOutputStream(); URL url = new URL(addr); IOUtils.copy(url.openStream(), output); return output.toString(); } }

    Read the article

  • How to stop a QDialog from executing while still in the __init__ statement(or immediatly after)?

    - by Jonathan
    I am wondering how I can go about stopping a dialog from opening if certain conditions are met in its __init__ statement. The following code tries to call the 'self.close()' function and it does, but (I'm assuming) since the dialog has not yet started its event loop, that it doesn't trigger the close event? So is there another way to close and/or stop the dialog from opening without triggering an event? Example code: from PyQt4 import QtCore, QtGui class dlg_closeInit(QtGui.QDialog): ''' Close the dialog if a certain condition is met in the __init__ statement ''' def __init__(self): QtGui.QDialog.__init__(self) self.txt_mytext = QtGui.QLineEdit('some text') self.btn_accept = QtGui.QPushButton('Accept') self.myLayout = QtGui.QVBoxLayout(self) self.myLayout.addWidget(self.txt_mytext) self.myLayout.addWidget(self.btn_accept) self.setLayout(self.myLayout) # Connect the button self.connect(self.btn_accept,QtCore.SIGNAL('clicked()'), self.on_accept) self.close() def on_accept(self): # Get the data... self.mydata = self.txt_mytext.text() self.accept() def get_data(self): return self.mydata def closeEvent(self, event): print 'Closing...' if __name__ == '__main__': import sys app = QtGui.QApplication(sys.argv) dialog = dlg_closeInit() if dialog.exec_(): print dialog.get_data() else: print "Failed"

    Read the article

  • Conversion failed when converting datetime from character string. Linq To SQL & OpenXML

    - by chobo2
    Hi I been following this tutorial on how to do a linq to sql batch insert. http://www.codeproject.com/KB/linq/BulkOperations_LinqToSQL.aspx However I have a datetime field in my database and I keep getting this error. System.Data.SqlClient.SqlException was unhandled Message="Conversion failed when converting datetime from character string." Source=".Net SqlClient Data Provider" ErrorCode=-2146232060 Class=16 LineNumber=7 Number=241 Procedure="spTEST_InsertXMLTEST_TEST" Server="" State=1 StackTrace: at System.Data.SqlClient.SqlConnection.OnError(SqlException exception, Boolean breakConnection) at System.Data.SqlClient.TdsParser.ThrowExceptionAndWarning(TdsParserStateObject stateObj) at System.Data.SqlClient.TdsParser.Run(RunBehavior runBehavior, SqlCommand cmdHandler, SqlDataReader dataStream, BulkCopySimpleResultSet bulkCopyHandler, TdsParserStateObject stateObj) I am not sure why when I just take the datetime in the generated xml file and manually copy it into sql server 2005 it has no problem with it and converts it just fine. This is my SP CREATE PROCEDURE [dbo].[spTEST_InsertXMLTEST_TEST](@UpdatedProdData nText) AS DECLARE @hDoc int exec sp_xml_preparedocument @hDoc OUTPUT,@UpdatedProdData INSERT INTO UserTable(CreateDate) SELECT XMLProdTable.CreateDate FROM OPENXML(@hDoc, 'ArrayOfUserTable/UserTable', 2) WITH ( CreateDate datetime ) XMLProdTable EXEC sp_xml_removedocument @hDoc C# code using (TestDataContext db = new TestDataContext()) { UserTable[] testRecords = new UserTable[1]; for (int count = 0; count < 1; count++) { UserTable testRecord = new UserTable() { CreateDate = DateTime.Now }; testRecords[count] = testRecord; } StringBuilder sBuilder = new StringBuilder(); System.IO.StringWriter sWriter = new System.IO.StringWriter(sBuilder); XmlSerializer serializer = new XmlSerializer(typeof(UserTable[])); serializer.Serialize(sWriter, testRecords); db.spTEST_InsertXMLTEST_TEST(sBuilder.ToString()); } Rendered XML Doc <?xml version="1.0" encoding="utf-16"?> <ArrayOfUserTable xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xmlns:xsd="http://www.w3.org/2001/XMLSchema"> <UserTable> <CreateDate>2010-05-19T19:35:54.9339251-07:00</CreateDate> </UserTable> </ArrayOfUserTable>

    Read the article

  • Uploading a file using post() method of QNetworkAccessManager

    - by user304361
    I'm having some trouble with a Qt application; specifically with the QNetworkAccessManager class. I'm attempting to perform a simple HTTP upload of a binary file using the post() method of the QNetworkAccessManager. The documentation states that I can give a pointer to a QIODevice to post(), and that the class will transmit the data found in the QIODevice. This suggests to me that I ought to be able to give post() a pointer to a QFile. For example: QFile compressedFile("temp"); compressedFile.open(QIODevice::ReadOnly); netManager.post(QNetworkRequest(QUrl("http://mywebsite.com/upload") ), &compressedFile); What seems to happen on the Windows system where I'm developing this is that my Qt application pushes the data from the QFile, but then doesn't complete the request; it seems to be sitting there waiting for more data to show up from the file. The post request isn't "closed" until I manually kill the application, at which point the whole file shows up at my server end. From some debugging and research, I think this is happening because the read() operation of QFile doesn't return -1 when you reach the end of the file. I think that QNetworkAccessManager is trying to read from the QIODevice until it gets a -1 from read(), at which point it assumes there is no more data and closes the request. If it keeps getting a return code of zero from read(), QNetworkAccessManager assumes that there might be more data coming, and so it keeps waiting for that hypothetical data. I've confirmed with some test code that the read() operation of QFile just returns zero after you've read to the end of the file. This seems to be incompatible with the way that the post() method of QNetworkAccessManager expects a QIODevice to behave. My questions are: Is this some sort of limitation with the way that QFile works under Windows? Is there some other way I should be using either QFile or QNetworkAccessManager to push a file via post()? Is this not going to work at all, and will I have to find some other way to upload my file? Any suggestions or hints would be appreciated. Thanks, Don

    Read the article

  • JavaScript/Dojo Module Pattern - how to debug?

    - by djna
    I'm working with Dojo and using the "Module Pattern" as described in Mastering Dojo. So far as I can see this pattern is a general, and widely used, JavaScript pattern. My question is: How do we debug our modules? So far I've not been able to persuade Firebug to show me the source of my module. Firebug seems to show only the dojo eval statement used to execute the factory method. Hence I'm not able to step through my module source. I've tried putting "debugger" statements in my module code, and Firebug seems to halt correctly, but does not show the source. Contrived example code below. This is just an example of sufficient complexity to make the need for debugging plausible, it's not intended to be useful code. The page <!-- Experiments with Debugging --> <!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.01//EN" "http://www.w3.org/TR/html4/strict.dtd"> <html> <head> <title>console me</title> <style type="text/css"> @import "../dojoroot/dojo/resources/dojo.css"; @import "../dojoroot/dijit/themes/tundra/tundra.css"; @import "edf.css"; </style> <script type="text/javascript" src="../dojoroot/dojo/dojo.js"> </script> <script type="text/javascript" > dojo.registerModulePath("mytest", "../../mytest"); dojo.require("mytest.example"); dojo.addOnLoad(function(){ mytest.example.greet(); }); </script> </head> <body class="tundra"> <div id="bulletin"> <p>Just Testing</p> </div> </body> </html> <!-- END: snip1 --> The java script I'd like to debug dojo.provide("mytest.example"); dojo.require("dijit.layout.ContentPane"); /** * define module */ (function(){ //define the main program functions... var example= mytest.example; example.greet= function(args) { var bulletin = dojo.byId("bulletin"); console.log("bulletin:" + bulletin); if ( bulletin) { var content = new dijit.layout.ContentPane({ id: "dummy", region: "center" }); content.setContent('Greetings!'); dojo._destroyElement(bulletin); dojo.place(content.domNode, dojo.body(), "first"); console.log("greeting done"); } else { console.error("no bulletin board"); } } })();

    Read the article

  • iTextSharp Set content of ListBox?

    - by Petoj
    Well im trying to set the content of a ListBox but even if it returns true nothing happens.. PdfStamper stamper = new PdfStamper(reader, context.Response.OutputStream); AcroFields fields = stamper.AcroFields; bool result = fields.SetListOption("listbox", data.ToArray(), data.ToArray()); So what am i doing wrong the data never gets to the pdf?

    Read the article

  • Django Managers

    - by owca
    I have the following models code : from django.db import models from categories.models import Category class MusicManager(models.Manager): def get_query_set(self): return super(MusicManager, self).get_query_set().filter(category='Music') def count_music(self): return self.all().count() class SportManager(models.Manager): def get_query_set(self): return super(MusicManager, self).get_query_set().filter(category='Sport') class Event(models.Model): title = models.CharField(max_length=120) category = models.ForeignKey(Category) objects = models.Manager() music = MusicManager() sport = SportManager() Now by registering MusicManager() and SportManager() I am able to call Event.music.all() and Event.sport.all() queries. But how can I create Event.music.count() ? Should I call self.all() in count_music() function of MusicManager to query only on elements with 'Music' category or do I still need to filter through them in search for category first ?

    Read the article

  • undefined symbol: PyUnicodeUCS2_Decode whilst trying to install psycopg2

    - by Marco Fucci
    I'm getting an error whilst trying to install psycopg2 on ubuntu 9.10 64 bit. The error is: >>> import psycopg2 Traceback (most recent call last): File "<stdin>", line 1, in <module> File "psycopg2/__init__.py", line 69, in <module> from _psycopg import BINARY, NUMBER, STRING, DATETIME, ROWID ImportError: psycopg2/_psycopg.so: undefined symbol: PyUnicodeUCS2_Decode I've tried downloading the package from http://initd.org/pub/software/psycopg/ and installing it. I've tried by using easy_install too. No error during the installation. It's quite weird as my python (2.6.2) has been compiled with UCS4 and so the installation should just work without problems. Any help would be appreciated. Cheers

    Read the article

  • Convert Wordpress.com Hosted Blog to BlogEngine.NET

    - by Chris Marisic
    I'm looking at what is needed to move from wordpress.com to a BlogEngine.NET or similar blog. I've seen a tool for replacing export.php so that it will export your wordpress site in BlogML format so it can easily be imported into BlogEngine.NET, however I'd really not want to have to setup php/wordpress just so I can import a back up from wordpress.com and then use the export from my local wordpress to have a BlogML file. Are there any tools that will convert the wordpress file? Is there a different blog that will natively import the wordpress file? Edit: For the question about other blog providers, I am open to them as long as they are .NET based, preferably C#.

    Read the article

  • Zlib compression in boost::iostreams not compatible with zlib.NET

    - by Johan
    Hello, I want to send compressed data between my C# to a C++ application in ZLIB format. In C++, I use the zlib_compressor/zlib_decompressor available in boost::iostreams. In C#, I am currently using the ZOutputStream available in the zlib.NET library. First of all, when I compress the same data using both libraries, the results look different: boost::iostreams::zlib_compressor: FF 13 49 48 00 00 01 00 01 00 00 00 63 61 60 60 F8 00 C4 C1 25 45 99 79 E9 23 87 04 00 zlib.NET (zlib.ZOutputStream): FF 13 49 48 00 00 01 00 01 00 00 00 78 9C 63 61 60 60 F8 00 C4 C1 25 45 99 79 E9 23 87 04 00 4F 31 63 8D (Note the 78 9C pattern that is present in zlib.NET, but not in boost). Furthermore, when I decompress data in boost that I compressed in zlib.NET, I am not able to read from the stream suggesting something is wrong. It does work when I try to decompress data compressed in boost. Does anybody know what is going wrong? Thank you, Johan

    Read the article

  • SQL Compact error: Unable to load DLL 'sqlceme35.dll'. The specified module could not be found

    - by Ciaran Bruen
    Hi - I'm developing a Winforms application using Visual Studio 2008 C# that uses a SQL compact 3.5 database on the client. The client will most likely be 32 bit XP or Vista machines. I'm using a standard Windows Installer project that creates an msi file and setup.exe to install the app on a client machine. I'm new to SQL compact so I haven't had to distribute a client database like this before now. When I run the setup.exe (on new Windows XP 32 bit with SP2 and IE 7) it installs fine but when I run the app I get the error below: Unable to load DLL 'sqlceme35.dll'. The specified module could not be found I spent a few hours searching this error already but all I can find are issues relating to installing on 64 bit Windows, none relating to normal 32 bit that I'm using. The install app copies the all the dependant files that it found into the specified install directory, including the System.Data.SqlServerCe.dll file (assembly version 3.5.1.0). The database file is in a directory called 'data' off the application directory, and the connection string for it is <add name="Tickets.ieOutlet.Properties.Settings.TicketsLocalConnectionString" connectionString="Data Source=|DataDirectory|\data\TicketsLocal.sdf" providerName="Microsoft.SqlServerCe.Client.3.5" /> Some questions I have: should the app be able to find the dll if it's in the same directory i.e. local to the app, or do I need to install it in the GAC? (If so cam I use the Windows Installer to install a dll in the GAC?) is there anything else I need to distribute with the app in order to use a Sql Compact database? there are other dlls also such as MS interop for exporting data to Excel on the client. Do these need to be installed in the GAC or will locating them in the application directory suffice? TIA, Ciaran.

    Read the article

  • SLES 9 vs. SLES 10

    - by Michael Covelli
    Are there any important change in how SLES 10 implements Tcp sockets vs. SLES 9? I have several apps written in C# (.NET 3.5) that run on Windows XP and Windows Server 2003. They've been running fine for over a year, getting market data from a SLES 9 machine using a socket connection. The machine was upgraded today to SLES 10 and its causing some strange behavior. The socket normally returns a few hundred or thousand bytes every second. But occasionally, I stop receiving data. Ten or more seconds will go by with no data and then Receive returns with a 10k+ bytes. And some buffer is causing data loss because the bytes I receive on the socket no longer make a correct packet. The only thing changed was the SLES 9 to 10 upgrade. And rolling back fixes this immediately. Any ideas?

    Read the article

  • Python Ephem calculation

    - by dassouki
    the output should process the first date as "day" and second as "night". I've been playing with this for a few hours now and can't figure out what I'm doing wrong. Any ideas? Output: $ python time_of_day.py * should be day: event date: 2010/4/6 16:00:59 prev rising: 2010/4/6 09:24:24 prev setting: 2010/4/5 23:33:03 next rise: 2010/4/7 09:22:27 next set: 2010/4/6 23:34:27 day * should be night: event date: 2010/4/6 00:01:00 prev rising: 2010/4/5 09:26:22 prev setting: 2010/4/5 23:33:03 next rise: 2010/4/6 09:24:24 next set: 2010/4/6 23:34:27 day time_of_day.py import datetime import ephem # install from http://pypi.python.org/pypi/pyephem/ #event_time is just a date time corresponding to an sql timestamp def type_of_light(latitude, longitude, event_time, utc_time, horizon): o = ephem.Observer() o.lat, o.long, o.date, o.horizon = latitude, longitude, event_time, horizon print "event date ", o.date print "prev rising: ", o.previous_rising(ephem.Sun()) print "prev setting: ", o.previous_setting(ephem.Sun()) print "next rise: ", o.next_rising(ephem.Sun()) print "next set: ", o.next_setting(ephem.Sun()) if o.previous_rising(ephem.Sun()) <= o.date <= o.next_setting(ephem.Sun()): return "day" elif o.previous_setting(ephem.Sun()) <= o.date <= o.next_rising(ephem.Sun()): return "night" else: return "error" print "should be day: ", type_of_light('45.959','-66.6405','2010/4/6 16:01','-4', '-6') print "should be night: ", type_of_light('45.959','-66.6405','2010/4/6 00:01','-4', '-6')

    Read the article

  • Examples of when to use PageAsyncTask (Asynchronous asp.net pages)

    - by Tony_Henrich
    From my understanding from reading about ASP.NET asynchronous pages, the method which executes when the asynchronous task begins ALWAYS EXECUTES between the prerender and the pre-render Complete events. So because the page's controls' events run between the page's load and prerender events, is it true that whatever the begin task handler (handler for BeginAsync below) produces, it can't be used in the controls' events? So for example, if the handler gets data from a database, the data can't be used in any of the controls' postback events? Would you bind data to a data control after prerender? PageAsyncTask pat = new PageAsyncTask(BeginAsync, EndAsync, null, null, true); this.RegisterAsyncTask(pat);

    Read the article

  • python urllib post question

    - by paul
    hello ALL im making some simple python post script but it not working well. there is 2 part to have to login. first login is using 'http://mybuddy.buddybuddy.co.kr/userinfo/UserInfo.asp' this one. and second login is using 'http://user.buddybuddy.co.kr/usercheck/UserCheckPWExec.asp' i can login first login page, but i couldn't login second page website. and return some error 'illegal access' such like . i heard this is related with some cooke but i don't know how to implement to resolve this problem. if anyone can help me much appreciated!! Thanks! import re,sys,os,mechanize,urllib,time import datetime,socket params = urllib.urlencode({'ID':'ph896011', 'PWD':'pk1089' }) rq = mechanize.Request("http://mybuddy.buddybuddy.co.kr/userinfo/UserInfo.asp", params) rs = mechanize.urlopen(rq) data = rs.read() logged_fail = r';history.back();</script>' in data if not logged_fail: print 'login success' try: params = urllib.urlencode({'PASSWORD':'pk1089'}) rq = mechanize.Request("http://user.buddybuddy.co.kr/usercheck/UserCheckPWExec.asp", params ) rs = mechanize.urlopen(rq) data = rs.read() print data except: print 'error'

    Read the article

< Previous Page | 777 778 779 780 781 782 783 784 785 786 787 788  | Next Page >