Search Results

Search found 20890 results on 836 pages for 'self reference'.

Page 784/836 | < Previous Page | 780 781 782 783 784 785 786 787 788 789 790 791  | Next Page >

• Do You Really Know Your Programming Languages?

  - by Kristopher Johnson

  I am often amazed at how little some of my colleagues know or care about their craft. Something that constantly frustrates me is that people don't want to learn any more than they need to about the programming languages they use every day. Many programmers seem content to learn some pidgin sub-dialect, and stick with that. If they see a keyword or construct that they aren't familiar with, they'll complain that the code is "tricky." What would you think of a civil engineer who shied away from calculus because it had "all those tricky math symbols?" I'm not suggesting that we all need to become "language lawyers." But if you make your living as a programmer, and claim to be a competent user of language X, then I think at a minimum you should know the following: Do you know the keywords of the language and what they do? What are the valid syntactic forms? How are memory, files, and other operating system resources managed? Where is the official language specification and library reference for the language? The last one is the one that really gets me. Many programmers seem to have no idea that there is a "specification" or "standard" for any particular language. I still talk to people who think that Microsoft invented C++, and that if a program doesn't compile under VC6, it's not a valid C++ program. Programmers these days have it easy when it comes to obtaining specs. Newer languages like C#, Java, Python, Ruby, etc. all have their documentation available for free from the vendors' web sites. Older languages and platforms often have standards controlled by standards bodies that demand payment for specs, but even that shouldn't be a deterrent: the C++ standard is available from ISO for $30 (and why am I the only person I know who has a copy?). Programming is hard enough even when you do know the language. If you don't, I don't see how you have a chance. What do the rest of you think? Am I right, or should we all be content with the typical level of programming language expertise? Update: Several great comments here. Thanks. A couple of people hit on something that I didn't think about: What really irks me is not the lack of knowledge, but the lack of curiosity and willingness to learn. It seems some people don't have any time to hone their craft, but they have plenty of time to write lots of bad code. And I don't expect people to be able to recite a list of keywords or EBNF expressions, but I do expect that when they see some code, they should have some inkling of what it does. Few people have complete knowledge of every dark corner of their language or platform, but everyone should at least know enough that when they see something unfamiliar, they will know how to get whatever additional information they need to understand it.

  Read the article

• Few doubts regarding Bitmaps , Images & `using` blocks

  - by imageWorker

  I caught up in this problem. http://stackoverflow.com/questions/2559826/garbage-collector-not-doing-its-job-memory-consumption-1-5gb-outofmemory-exc I feel that there is something wrong in my understanding. Please clarify these things. Destructor & IDisposable.Dispose are two methods for freeing resources that are not not under the control of .NET. Which means, everything except memory. right? using blocks are just better way of calling IDisposable.Dispose() method of an object. This is the main code I'm referring to. class someclass { static someMethod(Bitmap img) { Bitmap bmp = new Bitmap(img); //statement1 // some code here and return } } here is class I'm using for testing: class someotherClass { public static voide Main() { foreach (string imagePath in imagePathsArray) { using (Bitmap img1 = new Bitmap(imagePath)) { someclass.someMethod(img1); // does some more processing on `img1` } } } } Is there any memory leak with statement1? Question1: If each image size is say 10MB. Then does this bmp object occupy atleast 10MB? What I mean is, will it make completely new copy of entire image? or just refer to it? Question2:should I or should I not put the statement1 in using block? My Argument: We should not. Because using is not for freeing memory but for freeing the resources (file handle in this case). If I use it in using block. It closes file handle here encapsulated by this bmp object. It means we are also closing filehandle for the caller's img1 object. Which is not correct? As of the memory leak. No there is no scope of memory leak here. Because reference bmp is destroyed when this method is returned. Which leaves memory it refered without any pointer. So, its garbage collected. Am I right? Edit: class someclass { static Bitmap someMethod(Bitmap img) { Bitmap bmp = new Bitmap(img); //can I use `using` block on this enclosing `return bmp`; ??? // do some processing on bmp here return bmp; } }

  Read the article

• Converting OpenGL co-ordinates to lower UIView (and UIImagePickerController)

  - by John Qualis

  Hi, I am new to OpenGL over iPhone. I am developing an iPhone app similar to a barcode reader but with an extra OpenGL layer. The bottommost layer is UIImagePickerController, then I use UIView on top and draw a rectangle at certain co-ordinates on the iphone screen. So far everything is OK. Then I am trying to draw an OpenGL 3-D model in that rectangle. I am able to load a 3-D model in the iPhone based on this code here - http://iphonedevelopment.blogspot.com/2008/12/start-of-wavefront-obj-file-loader.html I am not able to transform the co-ordinates of the rectangle into OpenGL co-ordinates. Appreciate any help. Do I need to use a matrix to translate the currentPosition of the 3-D model so it is drawn within myRect? The code is given below.. Appreciate any help/pointers in this regards. John -(void)setupView:(GLView*)view { const GLfloat zNear = 0.01, zFar = 1000.0, fieldOfView = 45.0; GLfloat size; glEnable(GL_DEPTH_TEST); glMatrixMode(GL_PROJECTION); size = zNear * tanf(DEGREES_TO_RADIANS(fieldOfView) / 2.0); CGRect rect = view.bounds; glFrustumf(-size, size, -size / (rect.size.width / rect.size.height), size / (rect.size.width / rect.size.height), zNear, zFar); glViewport(0, 0, rect.size.width, rect.size.height); glMatrixMode(GL_MODELVIEW); glLoadIdentity(); glClearColor(0.0f, 0.0f, 0.0f, 0.0f); NSString *path = [[NSBundle mainBundle] pathForResource:@"plane" ofType:@"obj"]; OpenGLWaveFrontObject *theObject = [[OpenGLWaveFrontObject alloc] initWithPath:path]; Vertex3D position; position.z = -8.0; position.y = 3.0; position.x = 2.0; theObject.currentPosition = position; self.plane = theObject; [theObject release]; } (void)drawView:(GLView*)view; { static GLfloat rotation = 0.0; glClear(GL_COLOR_BUFFER_BIT | GL_DEPTH_BUFFER_BIT); glLoadIdentity(); glColor4f(0.0, 0.5, 1.0, 1.0); // the coordinates of the rectangle are // myRect.x, myRect.y, myRect.width, myRect.height // Do I need to use a matrix to translate the currentPosition of the // 3-D model so it is drawn within myRect? //glOrthof(-160.0f, 160.0f, -240.0f, 240.0f, -1.0f, 1.0f); [plane drawSelf]; }

  Read the article

• Can't access font resource in Silverlight class library

  - by Matt

  I have a reasonably large Silveright 3.0 project on the go, and I'm having issues accessing a couple of custom font resources from within one of the assemblies. I've got a working test solution where I have added a custom font as a resource, and can access it fine from XAML using: <TextBlock Text="Test" FontFamily="FontName.ttf#Font Name" /> The test solution consists of the TestProject.Application and the TestProject.Application.Web projects, with all the fun and games obviously in the TestProject.Application project However, when I try this in my main solution, the fonts refuse to show in the correct type face (instead showing in the default font). There's no difference in the way the font has been added to project between the test solution and the main solution, and the XAML is identical. However, there is a solution layout difference. In the main solution, as well as having a MainApp.Application and MainApp.Application.Web project, I also have a MainApp.Application.ViewModel project and a MainApp.Application.Views project, and the problem piece of XAML is the in the MainApp.Application.Views project (not the .Application project like the test solution). I've tried putting the font into either the .Application or .Application.Views project, tried changing the Build Action to Content, Embedded Resource etc, all to no avail. So, is there an issue accessing font resources from a child assembly that I don't know about, or has anyone successfully done this? My long term need will be to have the valid custom fonts being stored as resources in a separate .Application.FontLibrary assembly that will be on-demand downloaded and cached, and the XAML controls in the .Application.Views project will need to reference this FontLibrary assembly to get the valid fonts. I've also tried xcreating this separate font library assembly, and I can't seem to get the fonts from the second assembly. As some additional information, I've also tried the following font referencing approaches: <TextBlock Text="Test" FontFamily="/FontName.ttf#Font Name" /> <TextBlock Text="Test" FontFamily="pack:application,,,/FontName.ttf#Font Name" /> <TextBlock Text="Test" FontFamily="pack:application,,,/MainApp.Application.Views;/FontName.ttf#Font Name" /> <TextBlock Text="Test" FontFamily="pack:application,,,/MainApp.Application.Views;component/FontName.ttf#Font Name" /> And a few similar variants with different assembly references/sub directories/random semi colons. And so far nothing works... anyone struck this (and preferably solved it)?

  Read the article

• how to send parameters to a web Services via SOAP?

  - by Alejandra Meraz

  Before I start: I'm programming for Iphone, using objective C. I have already implemented a call to a web service function using NSURLRequest and NSURLConnection and SOAP. The function then returns a XML with the info I need. The code is as follows: NSString *soapMessage = [NSString stringWithFormat: @"<?xml version=\"1.0\" encoding=\"utf-8\"?>\n" "<soap:Envelope xmlns:xsi=\"http://www.w3.org/2001/XMLSchema-instance\" xmlns:xsd=\"http://www.w3.org/2001/XMLSchema\" xmlns:soap=\"http://schemas.xmlsoap.org/soap/envelope/\">\n" "<soap:Body>\n" "<function xmlns=\"http://tempuri.org/\" />\n" "</soap:Body>\n" "</soap:Envelope>\n"]; NSURL *url = [NSURL URLWithString:@"http://myHost.com/myWebService/service.asmx"]; //the url to the WSDL NsMutableURLRequest theRequest = [[NSMutableURLRequest alloc] initWithURL:url]; NSString *msgLength = [NSString stringWithFormat:@"%d",[soapMessage length]]; [theRequest addValue:@"text/xml; charset=utf-8" forHTTPHeaderField:@"Content-Type"]; [theRequest addValue:msgLength forHTTPHeaderField:@"Content-Lenght"]; [theRequest setHTTPMethod:@"POST"]; [theRequest addValue:@"myhost.com" forHTTPHeaderField:@"Host"]; [theRequest addValue:@"http://tempuri.org/function" forHTTPHeaderField:@"SOAPAction"]; [theRequest setHTTPBody:[soapMessage dataUsingEncoding:NSUTF8StringEncoding]]; theConnection = [[NSURLConnection alloc] initWithRequest:theRequest delegate:self]; I basically copy and modified the soap request the web service gave as an example. i also implemented the methods didRecieveResponse didRecieveAuthenticationChallenge didRecievedData didFailWithError connectionDidFinishLoading. And it works perfectly. Now I need to send 2 parameters to the function: "location" and "module". I tried modifying the soapMessage like this: NSString *soapMessage = [NSString stringWithFormat: @"<?xml version=\"1.0\" encoding=\"utf-8\"?>\n" "<soap:Envelope xmlns:xsi=\"http://www.w3.org/2001/XMLSchema-instance\" xmlns:xsd=\"http://www.w3.org/2001/XMLSchema\" xmlns:soap=\"http://schemas.xmlsoap.org/soap/envelope/\">\n" "<soap:Body xmlns=\"http://tempuri.org/\" />\n" "<m:GetMonitorList>\n" "<m:location>USA</m:location>\n" "<m:module>DEVELOPMENT</m:module>\n" "</m:GetMonitorList>\n" "</soap:Body>\n" "</soap:Envelope>\n"]; But is not working...any thoughts how should I modify it? Extra info: it seems to be working... kind of. But the webservice return nothing. During the connection, the method didReceiveResponse execute once and the didFinishLoading method executes as well. But not even once the method didReceiveData. I wonder if, even though there is no USA locations, it will still send at least something? is there a way to know which are the parameters the function is waiting for? I don't have access to the source of the webservice but i can access the WSDL.

  Read the article

• Marshalling non-Blittable Structs from C# to C++

  - by Greggo

  I'm in the process of rewriting an overengineered and unmaintainable chunk of my company's library code that interfaces between C# and C++. I've started looking into P/Invoke, but it seems like there's not much in the way of accessible help. We're passing a struct that contains various parameters and settings down to unmanaged codes, so we're defining identical structs. We don't need to change any of those parameters on the C++ side, but we do need to access them after the P/Invoked function has returned. My questions are: What is the best way to pass strings? Some are short (device id's which can be set by us), and some are file paths (which may contain Asian characters) Should I pass an IntPtr to the C# struct or should I just let the Marshaller take care of it by putting the struct type in the function signature? Should I be worried about any non-pointer datatypes like bools or enums (in other, related structs)? We have the treat warnings as errors flag set in C++ so we can't use the Microsoft extension for enums to force a datatype. Is P/Invoke actually the way to go? There was some Microsoft documentation about Implicit P/Invoke that said it was more type-safe and performant. For reference, here is one of the pairs of structs I've written so far: C++ /** Struct used for marshalling Scan parameters from managed to unmanaged code. */ struct ScanParameters { LPSTR deviceID; LPSTR spdClock; LPSTR spdStartTrigger; double spinRpm; double startRadius; double endRadius; double trackSpacing; UINT64 numTracks; UINT32 nominalSampleCount; double gainLimit; double sampleRate; double scanHeight; LPWSTR qmoPath; //includes filename LPWSTR qzpPath; //includes filename }; C# /// <summary> /// Struct used for marshalling scan parameters between managed and unmanaged code. /// </summary> [StructLayout(LayoutKind.Sequential)] public struct ScanParameters { [MarshalAs(UnmanagedType.LPStr)] public string deviceID; [MarshalAs(UnmanagedType.LPStr)] public string spdClock; [MarshalAs(UnmanagedType.LPStr)] public string spdStartTrigger; public Double spinRpm; public Double startRadius; public Double endRadius; public Double trackSpacing; public UInt64 numTracks; public UInt32 nominalSampleCount; public Double gainLimit; public Double sampleRate; public Double scanHeight; [MarshalAs(UnmanagedType.LPWStr)] public string qmoPath; [MarshalAs(UnmanagedType.LPWStr)] public string qzpPath; }

  Read the article

• Java - is this an idiom or pattern, behavior classes with no state

  - by Berlin Brown

  I am trying to incorporate more functional programming idioms into my java development. One pattern that I like the most and avoids side effects is building classes that have behavior but they don't necessarily have any state. The behavior is locked into the methods but they only act on the parameters passed in. The code below is code I am trying to avoid: public class BadObject { private Map<String, String> data = new HashMap<String, String>(); public BadObject() { data.put("data", "data"); } /** * Act on the data class. But this is bad because we can't * rely on the integrity of the object's state. */ public void execute() { data.get("data").toString(); } } The code below is nothing special but I am acting on the parameters and state is contained within that class. We still may run into issues with this class but that is an issue with the method and the state of the data, we can address issues in the routine as opposed to not trusting the entire object. Is this some form of idiom? Is this similar to any pattern that you use? public class SemiStatefulOOP { /** * Private class implies that I can access the members of the <code>Data</code> class * within the <code>SemiStatefulOOP</code> class and I can also access * the getData method from some other class. * * @see Test1 * */ class Data { protected int counter = 0; public int getData() { return counter; } public String toString() { return Integer.toString(counter); } } /** * Act on the data class. */ public void execute(final Data data) { data.counter++; } /** * Act on the data class. */ public void updateStateWithCallToService(final Data data) { data.counter++; } /** * Similar to CLOS (Common Lisp Object System) make instance. */ public Data makeInstance() { return new Data(); } } // End of Class // Issues with the code above: I wanted to declare the Data class private, but then I can't really reference it outside of the class: I can't override the SemiStateful class and access the private members. Usage: final SemiStatefulOOP someObject = new SemiStatefulOOP(); final SemiStatefulOOP.Data data = someObject.makeInstance(); someObject.execute(data); someObject.updateStateWithCallToService(data);

  Read the article

• Assembly Load and loading the "sub-modules" dependencies - "cannot fild the file specified"

  - by Ted

  There are several questions out there that ask the same question. However the answers they received I cannot understand, so here goes: Similar questions: http://stackoverflow.com/questions/1874277/dynamically-load-assembly-and-manually-force-path-to-get-referenced-assemblies ; http://stackoverflow.com/questions/22012/loading-assemblies-and-its-dependencies-closed The question in short: I need to figure out how dependencies, ie References in my modules can be loaded dynamically. Right now I am getting "The system cannot find the file specified" on Assemblies referenced in my so called modules. I cannot really get how to use the AssemblyResolve event... The longer version I have one application, MODULECONTROLLER, that loads separate modules. These "separate modules" are located in well-known subdirectories, like appBinDir\Modules\Module1 appBinDir\Modules\Module2 Each directory contains all the DLLs that exists in the bin-directory of those projects after a build. So the MODULECONTROLLER loads all the DLLs contained in those folders using this code: byte[] bytes = File.ReadAllBytes(dllFileFullPath); Assembly assembly = null; assembly = Assembly.Load(bytes); I am, as you can see, loading the byte[]-array (so I dont lock the DLL-files). Now, in for example MODULE1, I have a static reference called MyGreatXmlProtocol. The MyGreatXmlProtocol.dll then also exists in the directory appBinDir\Modules\Module1 and is loaded using the above code When code in the MODULE1 tries to use this MyGreatXmlProtocol, I get: Could not load file or assembly 'MyGreatXmlProtocol, Version=1.0.3797.26527, Culture=neutral, PublicKeyToken=null' or one of its dependencies. The system cannot find the file specified. So, in a post (like this one) they say that To my understanding reflection will load the main assembly and then search the GAC for the referenced assemblies, if it cannot find it there, you can then incorparate an assemblyResolve event: First; is it really needed to use the AssemblyResolve-event to make this work? Shouldnt my different MODULEs themself load their DLLs, as they are statically referenced? Second; if AssemblyResolve is the way to go - how do I use it? I have attached a handler to the Event but I never get anything on MyGreatXmlProctol... === EDIT === CODE regarding the AssemblyResolve-event handler: public GUI() { InitializeComponent(); AppDomain.CurrentDomain.AssemblyResolve += new ResolveEventHandler(CurrentDomain_AssemblyResolve); ... } // Assembly CurrentDomain_AssemblyResolve(object sender, ResolveEventArgs args) { Console.WriteLine(args.Name); return null; } Hope I wasnt too fuzzy =) Thx

  Read the article

• Objective-C Basic class related question, retaining the value of a specific object using a class fil

  - by von steiner

  Members, scholars, code gurus. My background is far from any computer programming thus my question may seems basic and somewhat trivial to you. Nevertheless it seems that I can't put my head around it. I have googled and searched for the answer, just to get myself confused even more. With that, I would kindly ask for a simple explanation suitable for a non technical person such as myself and for other alike arriving to this thread. I have left a comment with the text "Here is the issue" below, referring to my question. // character.h #import <Foundation/Foundation.h> @interface character : NSObject { NSString *name; int hitPoints; int armorClass; } @property (nonatomic,retain) NSString *name; @property int hitPoints,armorClass; -(void)giveCharacterInfo; @end // character.m #import "character.h" @implementation character @synthesize name,hitPoints,armorClass; -(void)giveCharacterInfo{ NSLog(@"name:%@ HP:%i AC:%i",name,hitPoints,armorClass); } @end // ClassAtLastViewController.h #import <UIKit/UIKit.h> @interface ClassAtLastViewController : UIViewController { } -(void)callAgain; @end // ClassAtLastViewController.m #import "ClassAtLastViewController.h" #import "character.h" @implementation ClassAtLastViewController - (void)viewDidLoad { //[super viewDidLoad]; character *player = [[character alloc]init]; player.name = @"Minsc"; player.hitPoints = 140; player.armorClass = 10; [player giveCharacterInfo]; [player release]; // Up until here, All peachy! [self performSelector:@selector(callAgain) withObject:nil afterDelay:2.0]; } -(void)callAgain{ // Here is the issue, I assume that since I init the player again I loss everything // Q1. I loss all the data I set above, where is it than? // Q2. What is the proper way to implement this character *player = [[character alloc]init]; [player giveCharacterInfo]; } Many thanks in advance, Kindly remember that my background is more related to Salmons breeding than to computer code, try and lower your answer to my level if it's all the same to you.

  Read the article

• Which network protocol to use for lightweight notification of remote apps?

  - by Chris Thornton

  I have this situation.... Client-initiated SOAP 1.1 communication between one server and let's say, tens of thousands of clients. Clients are external, coming in through our firewall, authenticated by certificate, https, etc.. They can be anywhere, and usually have their own firewalls, NAT routers, etc... They're truely external, not just remote corporate offices. They could be in a corporate/campus network, DSL/Cable, even Dialup. Client uses Delphi (2005 + SOAP fixes from 2007), and the server is C#, but from an architecture/design standpoint, that shouldn't matter. Currently, clients push new data to the server and pull new data from the server on 15-minute polling loop. The server currently does not push data - the client hits the "messagecount" method, to see if there is new data to pull. If 0, it sleeps for another 15 min and checks again. We're trying to get that down to 7 seconds. If this were an internal app, with one or just a few dozen clients, we'd write a cilent "listener" soap service, and would push data to it. But since they're external, sit behind their own firewalls, and sometimes private networks behind NAT routers, this is not practical. So we're left with polling on a much quicker loop. 10K clients, each checking their messagecount every 10 seconds, is going to be 1000/sec messages that will mostly just waste bandwidth, server, firewall, and authenticator resources. So I'm trying to design something better than what would amount to a self-inflicted DoS attack. I don't think it's practical to have the server send soap messages to the client (push) as this would require too much configuration at the client end. But I think there are alternatives that I don't know about. Such as: 1) Is there a way for the client to make a request for GetMessageCount() via Soap 1.1, and get the response, and then perhaps, "stay on the line" for perhaps 5-10 minutes to get additional responses in case new data arrives? i.e the server says "0", then a minute later in response to some SQL trigger (the server is C# on Sql Server, btw), knows that this client is still "on the line" and sends the updated message count of "5"? 2) Is there some other protocol that we could use to "ping" the client, using information gathered from their last GetMessageCount() request? 3) I don't even know. I guess I'm looking for some magic protocol where the client can send a GetMessageCount() request, which would include info for "oh by the way, in case the answer changes in the next hour, ping me at this address...". Also, I'm assuming that any of these "keep the line open" schemes would seriously impact the server sizing, as it would need to keep many thousands of connections open, simultaneously. That would likely impact the firewalls too, I think. Is there anything out there like that? Or am I pretty much stuck with polling? TIA, Chris

  Read the article

• Rails 3 Atom Feed

  - by scud bomb

  Trying to create an atom feed in Rails 3. When i refresh my browser i see basic XML, not the Atom feed im looking for. class PostsController < ApplicationController # GET /posts # GET /posts.xml def index @posts = Post.all respond_to do |format| format.html # index.html.erb format.xml { render :xml => @posts } format.atom end end index.atom.builder atom_feed do |feed| feed.title "twoconsortium feed" @posts.each do |post| feed.entry(post) do |entry| entry.title post.title entry.content post.text end end end localhost:3000/posts.atom looks like this: <?xml version="1.0" encoding="UTF-8"?> <feed xml:lang="en-US" xmlns="http://www.w3.org/2005/Atom"> <id>tag:localhost,2005:/posts</id> <link rel="alternate" type="text/html" href="http://localhost:3000"/> <link rel="self" type="application/atom+xml" href="http://localhost:3000/posts.atom"/> <title>my feed</title> <entry> <id>tag:localhost,2005:Post/1</id> <published>2012-03-27T18:26:13Z</published> <updated>2012-03-27T18:26:13Z</updated> <link rel="alternate" type="text/html" href="http://localhost:3000/posts/1"/> <title>First post</title> <content>good stuff</content> </entry> <entry> <id>tag:localhost,2005:Post/2</id> <published>2012-03-27T19:51:18Z</published> <updated>2012-03-27T19:51:18Z</updated> <link rel="alternate" type="text/html" href="http://localhost:3000/posts/2"/> <title>Second post</title> <content>its that second post type stuff</content> </entry> </feed>

  Read the article

• Flex/Air/AS3 Selecting and Populating a unFocused tab.

  - by Deyon

  I'm having a problem displaying data from a function to text box within a tab. If you run the code and click "Select Tab 2 and Fill..." I get an error; "TypeError: Error #1009: Cannot access a property or method of a null object reference." I'm guessing this is because "Tab 2" is/was not rendered yet. Now if I run the code, select "Tab 2" then select "Tab 1" and click "Select Tab 2 and Fill..." it works the way I would like. Dose any one know a way around this problem. ----Full Flex 4/Flash Builder Code just copy paste---- <?xml version="1.0" encoding="utf-8"?> <s:WindowedApplication xmlns:fx="http://ns.adobe.com/mxml/2009" xmlns:s="library://ns.adobe.com/flex/spark" xmlns:mx="library://ns.adobe.com/flex/halo" creationComplete=" "> <fx:Script> <![CDATA[ public function showtab2():void { mytextbox.text="I made it!"; tn.selectedIndex=1; } ]]> </fx:Script> <fx:Declarations> <!-- Place non-visual elements (e.g., services, value objects) here --> </fx:Declarations> <mx:Panel title="TabNavigator Container Example" height="90%" width="90%" paddingTop="10" paddingLeft="10" paddingRight="10" paddingBottom="10"> <mx:Label width="100%" color="blue" text="Select the tabs to change the panel."/> <mx:TabNavigator id="tn" width="100%" height="100%"> <!-- Define each panel using a VBox container. --> <mx:VBox label="Panel 1"> <mx:Label text="TabNavigator container panel 1"/> <mx:Button label="Select Tab 2 and Fill with Text" click="showtab2()"/> </mx:VBox> <mx:VBox label="Panel 2"> <mx:Label text="TabNavigator container panel 2"/> <s:TextInput id="mytextbox" /> </mx:VBox> </mx:TabNavigator> <mx:HBox> </mx:HBox> </mx:Panel> </s:WindowedApplication>

  Read the article

• What is GC holes?

  - by tianyi

  I wrote a long TCP connection socket server in C#. Spike in memory in my server happens. I used dotNet Memory Profiler(a tool) to detect where the memory leaks. Memory Profiler indicates the private heap is huge, and the memory is something like below(the number is not real,what I want to show is the GC0 and GC2's Holes are very very huge, the data size is normal): Managed heaps - 1,500,000KB Normal heap - 1400,000KB Generation #0 - 600,000KB Data - 100,000KB "Holes" - 500,000KB Generation #1 - xxKB Data - 0KB "Holes" - xKB Generation #2 - xxxxxxxxxxxxxKB Data - 100,000KB "Holes" - 700,000KB Large heap - 131072KB Large heap - 83KB Overhead/unused - 130989KB Overhead - 0KB Howerver, what is GC hole? I read an article about the hole: http://kaushalp.blogspot.com/2007/04/what-is-gc-hole-and-how-to-create-gc.html The author said : The code snippet below is the simplest way to introduce a GC hole into the system. //OBJECTREF is a typedef for Object*. { PointerTable *pTBL = o_pObjectClass->GetPointerTable(); OBJECTREF aObj = AllocateObjectMemory(pTBL); OBJECTREF bObj = AllocateObjectMemory(pTBL); //WRONG!!! “aObj” may point to garbage if the second //“AllocateObjectMemory” triggered a GC. DoSomething (aOb, bObj); } All it does is allocate two managed objects, and then does something with them both. This code compiles fine, and if you run simple pre-checkin tests, it will probably “work.” But this code will crash eventually. Why? If the second call to “AllocateObjectMemory” triggers a GC, that GC discards the object instance you just assigned to “aObj”. This code, like all C++ code inside the CLR, is compiled by a non-managed compiler and the GC cannot know that “aObj” holds a root reference to an object you want kept live. ======================================================================== I can't understand what he explained. Does the sample mean aObj becomes a wild pointer after GC? Is it mean { aObj = (*aObj)malloc(sizeof(object)); free(aObj); function(aObj);? } ? I hope somebody can explain it.

  Read the article

• Need Google Map InfoWindow Hyperlink to Open Content in Overlay (Fusion Table Usage)

  - by McKev

  I have the following code established to render the map in my site. When the map is clicked, the info window pops up with a bunch of content including a hyperlink to open up a website with a form in it. I would like to utilize a function like fancybox to open up this link "form" in an overlay. I have read that fancybox doesn't support calling the function from within an iframe, and was wondering if there was a way to pass the link data to the DOM and trigger the fancybox (or another overlay option) in another way? Maybe a callback trick - any tips would be much appreciated! <style> #map-canvas { width:850px; height:600px; } </style> <script type="text/javascript" src="http://maps.google.com/maps/api/js?sensor=true"></script> <script src="http://gmaps-utility-gis.googlecode.com/svn/trunk/fusiontips/src/fusiontips.js" type="text/javascript"></script> <script type="text/javascript"> var map; var tableid = "1nDFsxuYxr54viD_fuH7fGm1QRZRdcxFKbSwwRjk"; var layer; var initialLocation; var browserSupportFlag = new Boolean(); var uscenter = new google.maps.LatLng(37.6970, -91.8096); function initialize() { map = new google.maps.Map(document.getElementById('map-canvas'), { zoom: 4, mapTypeId: google.maps.MapTypeId.ROADMAP }); layer = new google.maps.FusionTablesLayer({ query: { select: "'Geometry'", from: tableid }, map: map }); //http://gmaps-utility-gis.googlecode.com/svn/trunk/fusiontips/docs/reference.html layer.enableMapTips({ select: "'Contact Name','Contact Title','Contact Location','Contact Phone'", from: tableid, geometryColumn: 'Geometry', suppressMapTips: false, delay: 500, tolerance: 8 }); ; // Try W3C Geolocation (Preferred) if(navigator.geolocation) { browserSupportFlag = true; navigator.geolocation.getCurrentPosition(function(position) { initialLocation = new google.maps.LatLng(position.coords.latitude,position.coords.longitude); map.setCenter(initialLocation); //Custom Marker var pinColor = "A83C0A"; var pinImage = new google.maps.MarkerImage("http://chart.apis.google.com/chart?chst=d_map_pin_letter&chld=%E2%80%A2|" + pinColor, new google.maps.Size(21, 34), new google.maps.Point(0,0), new google.maps.Point(10, 34)); var pinShadow = new google.maps.MarkerImage("http://chart.apis.google.com/chart?chst=d_map_pin_shadow", new google.maps.Size(40, 37), new google.maps.Point(0, 0), new google.maps.Point(12, 35)); new google.maps.Marker({ position: initialLocation, map: map, icon: pinImage, shadow: pinShadow }); }, function() { handleNoGeolocation(browserSupportFlag); }); } // Browser doesn't support Geolocation else { browserSupportFlag = false; handleNoGeolocation(browserSupportFlag); } function handleNoGeolocation(errorFlag) { if (errorFlag == true) { //Geolocation service failed initialLocation = uscenter; } else { //Browser doesn't support geolocation initialLocation = uscenter; } map.setCenter(initialLocation); } } google.maps.event.addDomListener(window, 'load', initialize); </script>

  Read the article

• How do I pass the value of the previous form element into an "onchange" javascript function?

  - by Jen

  Hello, I want to make some UI improvements to a page I am developing. Specifically, I need to add another drop down menu to allow the user to filter results. This is my current code: HTML file: <select name="test_id" onchange="showGrid(this.name, this.value, 'gettestgrid')"> <option selected>Select a test--></option> <option value=1>Test 1</option> <option value=2>Test 2</option> <option value=3>Test 3</option> </select> This is pseudo code for what I want to happen: <select name="test_id"> <option selected>Select a test--></option> <option value=1>Test 1</option> <option value=2>Test 2</option> <option value=3>Test 3</option> </select> <select name="statistics" onchange="showGrid(PREVIOUS.name, PREVIOUS.VALUE, THIS.value)"> <option selected>Select a data display --></option> <option value='gettestgrid'>Show averages by student</option> <option value='gethomeroomgrid'>Show averages by homeroom</option> <option value='getschoolgrid'>Show averages by school</option> </select> How do I access the previous field's name and value? Any help much appreciated, thx! Also, JS function for reference: function showGrid(name, value, phpfile) { xmlhttp=GetXmlHttpObject(); if (xmlhttp==null) { alert ("Browser does not support HTTP Request"); return; } var url=phpfile+".php"; url=url+"?"+name+"="+value; url=url+"&sid="+Math.random(); xmlhttp.onreadystatechange=stateChanged; xmlhttp.open("GET",url,true); xmlhttp.send(null); }

  Read the article

• Efficient file buffering & scanning methods for large files in python

  - by eblume

  The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

  Read the article

• Loading images to UIScrollview crashes

  - by Icky

  Hello All. I have a Navigationcontroller pushing a UIViewController with a scrollview inside. Within the scrollview I download a certain number of images around 20 (sometimes more) each sized around 150 KB. All these images are added to the scrollview so that their origin is x +imageSize and the following is sorted right to the one before. All in all I think its a lot of data (3-4 MB). On an I pod Touch this sometimes crashes, the IPhone can handle it once, if it has to load the data again (some other images) , it crashes too. I guess its a memory issue but within my code, I download the image, save it to a file on the phone as NSData, read it again from file and add it to a UIImageview which I release. So I have freed the memory I allocated, nevertheless it still crashes. Can anyone help me out? Since Im new to this, I dont know the best way to handle the Images in a scrollview. Besides I create the controller at start from nib, which means I dont have to release it, since I dont use alloc - right? Code: In my rootviewcontroller I do: -(void) showImages { [[self naviController] pushViewController:imagesViewController animated:YES]; [imagesViewController viewWillAppear:YES]; } Then in my Controller handling the scroll View, this is the method to load the images: - (void) loadOldImageData { for (int i = 0; i < 40 ; i++) { NSArray *paths = NSSearchPathForDirectoriesInDomains(NSDocumentDirectory, NSUserDomainMask, YES); NSString *documentsDirectory = [paths objectAtIndex:0]; NSString *filePath = [documentsDirectory stringByAppendingPathComponent:[NSString stringWithFormat:@"img%d.jpg", i]]; NSData *myImg = [NSData dataWithContentsOfFile:filePath]; UIImage *im = [UIImage imageWithData:myImg]; if([im isKindOfClass:[UIImage class]]) { NSLog(@"IM EXISTS"); UIImageView *imgView = [[UIImageView alloc] initWithImage:im]; CGRect frame = CGRectMake(i*320, 0, 320, 416); imgView.frame = frame; [myScrollView addSubview:imgView]; [imgView release]; //NSLog(@"Adding img %d", i); numberImages = i; NSLog(@"setting numberofimages to %d", numberImages); //NSLog(@"scroll subviews %d", [myScrollView.subviews count]); } } myScrollView.contentSize = CGSizeMake(320 * (numberImages + 1), 416); }

  Read the article

• Backbone.js (model instanceof Model) via Chrome Extension

  - by Leoncelot

  Hey guys, This is my first time ever posting on this site and the problem I'm about to pose is difficult to articulate due to the set of variables required to arrive at it. Let me just quickly explain the framework I'm working with. I'm building a Chrome Extension using jQuery, jQuery-ui, and Backbone The entire JS suite for the extension is written in CoffeeScript and I'm utilizing Rails and the asset pipeline to manage it all. This means that when I want to deploy my extension code I run rake assets:precompile and copy the resulting compressed JS to my extensions Directory. The nice thing about this approach is that I can actually run the extension js from inside my Rails app by including the library. This is basically the same as my extensions background.js file which injects the js as a content script. Anyway, the problem I've recently encountered was when I tried testing my extension on my buddy's site, whiskeynotes.com. What I was noticing is that my backbone models were being mangled upon adding them to their respective collections. So something like this.collection.add(new SomeModel) created some nonsense version of my model. This code eventually runs into Backbone's prepareModel code _prepareModel: function(model, options) { options || (options = {}); if (!(model instanceof Model)) { var attrs = model; options.collection = this; model = new this.model(attrs, options); if (!model._validate(model.attributes, options)) model = false; } else if (!model.collection) { model.collection = this; } return model; }, Now, in most of the sites on which I've tested the extension, the result is normal, however on my buddy's site the !(model instance Model) evaluates to true even though it is actually an instance of the correct class. The consequence is a super messed up version of the model where the model's attributes is a reference to the models collection (strange right?). Needless to say, all kinds of crazy things were happening afterward. Why this is occurring is beyond me. However changing this line (!(model instanceof Model)) to (!(model instanceof Backbone.Model)) seems to fix the problem. I thought maybe it had something to do with the Flot library (jQuery graph library) creating their own version of 'Model' but looking through the source yielded no instances of it. I'm just curious as to why this would happen. And does it make sense to add this little change to the Backbone source? Update: I just realized that the "fix" doesn't actually work. I can also add that my backbone Models are namespaced in a wrapping object so that declaration looks something like class SomeNamespace.SomeModel extends Backbone.Model

  Read the article

• Releasing the keyboard stops shake events. Why?

  - by Moshe

  1) How do I make a UITextField resign the keyboard and hide it? The keyboard is in a dynamically created subview whose superview looks for shake events. Resigning first responder seems to break the shake event handler. 2) how do you make the view holding the keyboard transparent, like see through glass? I have seen this done before. This part has been taken care of thanks guys. As always, code samples are appreciated. I've added my own to help explain the problem. EDIT: Basically, - (void)motionBegan:(UIEventSubtype)motion withEvent:(UIEvent *)event; gets called in my main view controller to handle shaking. When a user taps on the "edit" icon (a pen, in the bottom of the screen - not the traditional UINavigationBar edit button), the main view adds a subview to itself and animates it on to the screen using a custom animation. This subview contains a UINavigationController which holds a UITableView. The UITableView, when a cell is tapped on, loads a subview into itself. This second subview is the culprit. For some reason, a UITextField in this second subview is causing problems. When a user taps on the view, the main view will not respond to shakes unless the UITextField is active (in editing mode?). Additional info: My Motion Event Handler: - (void)motionBegan:(UIEventSubtype)motion withEvent:(UIEvent *)event { NSLog(@"%@", [event description]); SystemSoundID SoundID; NSString *soundFile = [[NSBundle mainBundle] pathForResource:@"shake" ofType:@"aif"]; AudioServicesCreateSystemSoundID((CFURLRef)[NSURL fileURLWithPath:soundFile], &SoundID); AudioServicesPlayAlertSound(SoundID); [self genRandom:TRUE]; } The genRandom: Method: /* Generate random label and apply it */ -(void)genRandom:(BOOL)deviceWasShaken{ if(deviceWasShaken == TRUE){ decisionText.text = [NSString stringWithFormat: (@"%@", [shakeReplies objectAtIndex:(arc4random() % [shakeReplies count])])]; }else{ SystemSoundID SoundID; NSString *soundFile = [[NSBundle mainBundle] pathForResource:@"string" ofType:@"aif"]; AudioServicesCreateSystemSoundID((CFURLRef)[NSURL fileURLWithPath:soundFile], &SoundID); AudioServicesPlayAlertSound(SoundID); decisionText.text = [NSString stringWithFormat: (@"%@", [pokeReplies objectAtIndex:(arc4random() % [pokeReplies count])])]; } } shakeReplies and pokeReplies are both NSArrays of strings. One is used for when a certain part of the screen is poked and one is for when the device is shaken. The app will randomly choose a string from the NSArray and display onscreen. For those of you who work graphically, here is a diagram of the view hierarchy: Root View -> UINavigationController -> UITableView -> Edit View -> Problem UITextfield

  Read the article

• How do I check for the existence of an external file with XSL?

  - by LOlliffe

  I've found a lot of examples that reference Java and C for this, but how do I, or can I, check for the existence of an external file with XSL. First, I realize that this is only a snippet, but it's part of a huge stylesheet, so I'm hoping it's enough to show my issue. <!-- Use this template for Received SMSs --> <xsl:template name="ReceivedSMS"> <!-- Set/Declare "SMSname" variable (local, evaluates per instance) --> <xsl:variable name="SMSname"> <xsl:value-of select=" following-sibling::Name"/> </xsl:variable> <fo:table font-family="Arial Unicode MS" font-size="8pt" text-align="start"> <fo:table-column column-width=".75in"/> <fo:table-column column-width="6.75in"/> <fo:table-body> <fo:table-row> <!-- Cell contains "speakers" icon --> <fo:table-cell display-align="after"> <fo:block text-align="start"> <fo:external-graphic src="../images/{$SMSname}.jpg" content-height="0.6in"/> What I'd like to do, is put in an "if" statement, surronding the {$SMSname}.jpg line. That is: <fo:block text-align="start"> <xsl:if test="exists( the external file {$SMSname}.jpg)"> <fo:external-graphic src="../images/{$SMSname}.jpg" content-height="0.6in"/> </xsl:if> <xsl:if test="not(exists( the external file {$SMSname}.jpg))"> <fo:external-graphic src="../images/unknown.jpg" content-height="0.6in"/> </xsl:if> </fo:block> Because of "grouping", etc., I'm using XSLT 2.0. I hope that this is something that can be done. I hope even more that it's something simple. As always, thanks in advance for any help. LO

  Read the article

• CodeIgniter Third party class not loading

  - by Jatin Soni

  I am trying to implement Dashboard widget class (found here: http://harpanet.com/programming/php/codeigniter/dashboard/index#installation) but it is giving me error Unable to load the requested class I have tried to add this class in autoload as well as menually to my controller $this->load->library('dash') but this also giving the same error. I have checked dash.php and found below method private function __example__() but can't understand what the developer is saying in comment. class Dash { private function __example__() { /* * This function is purely to show an example of a dashboard method to place * within your own controller. */ // load third_party hArpanet dashboard library $this->load->add_package_path(APPPATH.'third_party/hArpanet/hDash/'); $dash =& $this->load->library('dash'); $this->load->remove_package_path(APPPATH.'third_party/hArpanet/hDash/'); // configure dashboard widgets - format: type, src, title, cols, alt (for images) $dash->widgets = array( array('type'=>'oop', 'src'=>'test_dash', 'title'=>'Test OOP Widget', 'cols'=>3), // if 'title' is set to FALSE, the title block is omitted entirely // note: this is an 'html' widget but is being fed content from a local method array('type'=>'html', 'src'=>self::test_method(), 'title'=>false, 'cols'=>3), array('type'=>'file', 'src'=>'saf_inv.htm', 'title'=>'Safety Investigation'), // multi-content widget - set widget title in outer array (also note use of CI anchor to create a link) array('title'=>anchor('tz', 'TARGET ZERO'), // sub-content follows same array format as single content widget // 'img' content can also have an 'alt' text array('type'=>'img', 'src'=>'saf_tzout.gif', 'alt'=>'Action Completed'), array('type'=>'file', 'src'=>'saf_tz.htm'), array('type'=>'file', 'src'=>'ave_close.htm', 'title'=>'Average Time to Close') ), array('type'=>'file', 'src'=>'saf_meet.htm', 'title'=>'Safety Meeting'), array('type'=>'file', 'src'=>'saf_acc.htm', 'title'=>'Accident Investigation'), array('type'=>'file', 'src'=>'saf_hazmat.htm', 'title'=>anchor('hazmat', 'HAZMAT')), array('type'=>'file', 'src'=>'saf_cont.htm', 'title'=>'Loss of Containment'), array('type'=>'file', 'src'=>'saf_worksinfo.htm', 'title'=>'Works Information'), // an action widget - 'clear' will generate a blank widget with a style of clear:both array('type'=>'clear'), // multi-content widget - width can be set using the 'cols' param in outer array array('title'=>'RAG Report', 'cols' => 2, array('type'=>'file', 'src'=>'saf_rag.htm'), array('type'=>'img', 'src'=>'ProcSaf.gif')), array('type'=>'file', 'src'=>'saf_chrom.htm', 'title'=>'Chrome checks'), ); // populate the view variable $widgets = $dash->build('safety'); // render the dashboard $this->load->view('layout_default', $widgets); } ................... } // end of Dash class Installation path is root/application/third_party/hArpanet/hDash/libraries/dash.php How can I load this class to my system and use widgets?

  Read the article

• Searching in Ruby on Rails - How do I search on each word entered and not the exact string?

  - by bgadoci

  I have built a blog application w/ ruby on rails and I am trying to implement a search feature. The blog application allows for users to tag posts. The tags are created in their own table and belong_to :post. When a tag is created, so is a record in the tag table where the name of the tag is tag_name and associated by post_id. Tags are strings. I am trying to allow a user to search for any word tag_name in any order. Here is what I mean. Lets say a particular post has a tag that is 'ruby code controller'. In my current search feature, that tag will be found if the user searches for 'ruby', 'ruby code', or 'ruby code controller'. It will not be found if the user types in 'ruby controller'. Essentially what I am saying is that I would like each word entered in the search to be searched for, not necessarily the 'string' that is entered into the search. I have been experimenting with providing multiple textfields to allow the user to type in multiple words, and also have been playing around with the code below, but can't seem to accomplish the above. I am new to ruby and rails so sorry if this is an obvious question and prior to installing a gem or plugin I thought I would check to see if there was a simple fix. Here is my code: View: /views/tags/index.html.erb <% form_tag tags_path, :method => 'get' do %> <p> <%= text_field_tag :search, params[:search], :class => "textfield-search" %> <%= submit_tag "Search", :name => nil, :class => "search-button" %> </p> <% end %> TagsController def index @tags = Tag.search(params[:search]).paginate :page => params[:page], :per_page => 5 @tagsearch = Tag.search(params[:search]) @tag_counts = Tag.count(:group => :tag_name, :order => 'count_all DESC', :limit => 100) respond_to do |format| format.html # index.html.erb format.xml { render :xml => @tags } end end Tag Model class Tag < ActiveRecord::Base belongs_to :post validates_length_of :tag_name, :maximum=>42 validates_presence_of :tag_name def self.search(search) if search find(:all, :order => "created_at DESC", :conditions => ['tag_name LIKE ?', "%#{search}%"]) else find(:all, :order => "created_at DESC") end end end

  Read the article

• How to implement a caching model without violating MVC pattern?

  - by RPM1984

  Hi Guys, I have an ASP.NET MVC 3 (Razor) Web Application, with a particular page which is highly database intensive, and user experience is of the upmost priority. Thus, i am introducing caching on this particular page. I'm trying to figure out a way to implement this caching pattern whilst keeping my controller thin, like it currently is without caching: public PartialViewResult GetLocationStuff(SearchPreferences searchPreferences) { var results = _locationService.FindStuffByCriteria(searchPreferences); return PartialView("SearchResults", results); } As you can see, the controller is very thin, as it should be. It doesn't care about how/where it is getting it's info from - that is the job of the service. A couple of notes on the flow of control: Controllers get DI'ed a particular Service, depending on it's area. In this example, this controller get's a LocationService Services call through to an IQueryable<T> Repository and materialize results into T or ICollection<T>. How i want to implement caching: I can't use Output Caching - for a few reasons. First of all, this action method is invoked from the client-side (jQuery/AJAX), via [HttpPost], which according to HTTP standards should not be cached as a request. Secondly, i don't want to cache purely based on the HTTP request arguments - the cache logic is a lot more complicated than that - there is actually two-level caching going on. As i hint to above, i need to use regular data-caching, e.g Cache["somekey"] = someObj;. I don't want to implement a generic caching mechanism where all calls via the service go through the cache first - i only want caching on this particular action method. First thought's would tell me to create another service (which inherits LocationService), and provide the caching workflow there (check cache first, if not there call db, add to cache, return result). That has two problems: The services are basic Class Libraries - no references to anything extra. I would need to add a reference to System.Web here. I would have to access the HTTP Context outside of the web application, which is considered bad practice, not only for testability, but in general - right? I also thought about using the Models folder in the Web Application (which i currently use only for ViewModels), but having a cache service in a models folder just doesn't sound right. So - any ideas? Is there a MVC-specific thing (like Action Filter's, for example) i can use here? General advice/tips would be greatly appreciated.

  Read the article

• SQL Native Client 10 Performance miserable (due to server-side cursors)

  - by namezero

  we have an application that uses ODBC via CDatabase/CRecordset in MFC (VS2010). We have two backends implemented. MSSQL and MySQL. Now, when we use MSSQL (with the Native Client 10.0), retrieving records with SELECT is dramatically slow via slow links (VPN, for example). The MySQL ODBC driver does not exhibit this nasty behavior. For example: CRecordset r(&m_db); r.Open(CRecordset::snapshot, L"SELECT a.something, b.sthelse FROM TableA AS a LEFT JOIN TableB AS b ON a.ID=b.Ref"); r.MoveFirst(); while(!r.IsEOF()) { // Retrieve CString strData; crs.GetFieldValue(L"a.something", strData); crs.MoveNext(); } Now, with the MySQL driver, everything runs as it should. The query is returned, and everything is lightning fast. However, with the MSSQL Native Client, things slow down, because on every MoveNext(), the driver communicates with the server. I think it is due to server-side cursors, but I didn't find a way to disable them. I have tried using: ::SQLSetConnectAttr(m_db.m_hdbc, SQL_ATTR_ODBC_CURSORS, SQL_CUR_USE_ODBC, SQL_IS_INTEGER); But this didn't help either. There are still long-running exec's to sp_cursorfetch() et al in SQL Profiler. I have also tried a small reference project with SQLAPI and bulk fetch, but that hangs in FetchNext() for a long time, too (even if there is only one record in the resultset). This however only happens on queries with LEFT JOINS, table-valued functions, etc. Note that the query doesn't take that long - executing the same SQL via SQL Studio over the same connection returns in a reasonable time. Question1: Is is possible to somehow get the native client to "cache" all results locally use local cursors in a similar fashion as the MySQL driver seems to do it? Maybe this is the wrong approach altogether, but I'm not sure how else to do this. All we want is to retrieve all data at once from a SELECT, then never talk the server again until the next query. We don't care about recordset updates, deletes, etc or any of that nonsense. We only want to retrieve data. We take that recordset, get all the data, and delete it. Question2: Is there a more efficient way to just retrieve data in MFC with ODBC?

  Read the article

• How do I create a thread-safe write-once read-many value in Java?

  - by Software Monkey

  This is a problem I encounter frequently in working with more complex systems and which I have never figured out a good way to solve. It usually involves variations on the theme of a shared object whose construction and initialization are necessarily two distinct steps. This is generally because of architectural requirements, similar to applets, so answers that suggest I consolidate construction and initialization are not useful. By way of example, let's say I have a class that is structured to fit into an application framework like so: public class MyClass { private /*ideally-final*/ SomeObject someObject; MyClass() { someObject=null; } public void startup() { someObject=new SomeObject(...arguments from environment which are not available until startup is called...); } public void shutdown() { someObject=null; // this is not necessary, I am just expressing the intended scope of someObject explicitly } } I can't make someObject final since it can't be set until startup() is invoked. But I would really like it to reflect it's write-once semantics and be able to directly access it from multiple threads, preferably avoiding synchronization. The idea being to express and enforce a degree of finalness, I conjecture that I could create a generic container, like so: public class WoRmObject<T> { private T object; WoRmObject() { object=null; } public WoRmObject set(T val) { object=val; return this; } public T get() { return object; } } and then in MyClass, above, do: private final WoRmObject<SomeObject> someObject; MyClass() { someObject=new WoRmObject<SomeObject>(); } public void startup() { someObject.set(SomeObject(...arguments from environment which are not available until startup is called...)); } Which raises some questions for me: Is there a better way, or existing Java object (would have to be available in Java 4)? Is this thread-safe provided that no other thread accesses someObject.get() until after it's set() has been called. The other threads will only invoke methods on MyClass between startup() and shutdown() - the framework guarantees this. Given the completely unsynchronized WoRmObject container, it is ever possible under either JMM to see a value of object which is neither null nor a reference to a SomeObject? In other words, does has the JMM always guaranteed that no thread can observe the memory of an object to be whatever values happened to be on the heap when the object was allocated.

  Read the article

< Previous Page | 780 781 782 783 784 785 786 787 788 789 790 791  | Next Page >