Search Results

Search found 34513 results on 1381 pages for 'end task'.

Page 793/1381 | < Previous Page | 789 790 791 792 793 794 795 796 797 798 799 800  | Next Page >

  • Update table using SSIS

    - by thursdaysgeek
    I am trying to update a field in a table with data from another table, based on a common key. If it were in straight SQL, it would be something like: Update EHSIT set e.IDMSObjID = s.IDMSObjID from EHSIT e, EHSIDMS s where e.SITENUM = s.SITE_CODE However, the two tables are not in the same database, so I'm trying to use SSIS to do the update. Oh, and the sitenum/site_code are varchar in one and nvarchar in the other, so I'll have to do a data conversion so they'll match. How do I do it? I have a data flow object, with the source as EHSIDMS and the destination as EHSIT. I have a data conversion to convert the unicode to non-unicode. But how do I update based on the match? I've tried with the destination, using a SQL Command as the Data Access mode, but it doesn't appear to have the source table. If I just map the field to be updated, how does it limit it based on fields matching? I'm about to export my source table to Excel or something, and then try inputting from there, although it seems that all that would get me would be to remove the data conversion step. Shouldn't there be an update data task or something? Is it one of those Data Flow transformation tasks, and I'm just not figuring out which it is?

    Read the article

  • What is the correct approach to using GWT with persistent objects?

    - by dankilman
    Hi, I am currently working on a simple web application through Google App engine using GWT. It should be noted that this is my first attempt at such a task. I have run into to following problem/dilema: I have a simple Class (getters/setters and nothing more. For the sake of clarity I will refer to this Class as DataHolder) and I want to make it persistent. To do so I have used JDO which required me to add some annotations and more specifically add a Key field to be used as the primary key. The problem is that using the Key class requires me to import com.google.appengine.api.datastore.Key which is ok on the server side, but then I can't use DataHolder on the client side, because GWT doesn't allow it (as far as I know). So I have created a sister Class ClientDataHolder which is almost identical, though it doesn't have all the JDO annotations nor the Key field. Now this actually works but It feels like I'm doing something wrong. Using this approach would require maintaining to separate classes for each entity I wish to have. So my question is: Is there a better way of doing this? Thank you.

    Read the article

  • measure the response time of a link

    - by Ahoura Ghotbi
    I am trying to create a simple load balance script and I was wondering if it is possible to find the response time of a server live? By that I mean is it possible to measure how long it takes for a server to respond after the request has been sent out? What I am trying to do is fairly simple, I want to send a request to a link/server and do a count down, if the server took more than 5 seconds to reply, I would like to fall on the backup server. Note that it doesnt have to be in pure php, I wouldnt mind using other languages such as javascript, C/C++, asp, but I prefer to do it in PHP. if it is possible to do the task, could you just point me to the right direction so I can read up on it. Clarification What I want to do is not to download a file and see how long it took, my servers have high load and it takes a while for them to respond when you click on a file to download, what I want to do is to measure the time it takes the server to respond (in this situation, its the time it takes the server to respond and allow the user to download the file), and if it takes longer than x seconds, it should fall back on a backup server.

    Read the article

  • Functioning Socket read no longer works when called in AsyncTask

    - by bibismcbryde
    I'm making an app that sends a string to a server over a socket and then reads the output after the server has processed that data. It worked perfectly when it was my foreground task, but I have since used AsyncTask to show a process dialog while the socket communication runs in the background, and things start breaking after I read the output from the server and then try to close the socket. private class Progressor extends AsyncTask<String, Void, Void> { ProgressDialog dialog; protected void onPreExecute() { dialog = ProgressDialog.show(ClearTalkInputActivity.this, "Loading..", "Analyzing Text", true, false); } protected Void doInBackground(String... strings) { String language = strings[0].toLowerCase(); String the_text = strings[1]; Socket socket = null; DataOutputStream dos = null; DataInputStream dis = null; try { socket = new Socket(my_ip, port); dos = new DataOutputStream(socket.getOutputStream()); dis = new DataInputStream(socket.getInputStream()); dos.writeUTF(language+"****"+the_text); String in = ""; while (in.indexOf("</content>") < 0) { in += dis.readUTF(); } socket.close(); save_str(OUTPUT_KEY, in); } catch (UnknownHostException e) { e.printStackTrace(); } catch (IOException e) { e.printStackTrace(); } finally { if (socket != null) { try { socket.close(); } catch (IOException e) { e.printStackTrace(); } } } if (dos != null) { try { dos.close(); } catch (IOException e) { e.printStackTrace(); } } if (dis != null) { try { dis.close(); } catch (IOException e) { e.printStackTrace(); } } return null; } protected void onPostExecute() { if (dialog.isShowing()) dialog.dismiss(); startActivity(new Intent (output_intent)); } }

    Read the article

  • Advice: Python Framework Server/Worker Queue management (not Website)

    - by Muppet Geoff
    I am looking for some advice/opinions of which Python Framework to use in an implementation of multiple 'Worker' PCs co-ordinated from a central Queue Manager. For completeness, the 'Worker' PCs will be running Audio Conversion routines (which I do not need advice on, and have standalone code that works). The Audio conversion takes a long time, and I need to co-ordinate an arbitrary number of the 'Workers' from a central location, handing them conversion tasks (such as where to get the source files, or where to ask for the job configuration) with them reporting back some additional info, such as the runtime of the converted audio etc. At present, I have a script that makes a webservice call to get the 'configuration' for a conversion task, based on source files located on the worker already (we manually copy the source files to the worker, and that triggers a conversion routine). I want to change this, so that we can distribute conversion tasks ("Oy you, process this: xxx") based on availability, and in an ideal world, based on pending tasks too. There is a chance that Workers can go offline mid-conversion (but this is not likely). All the workers are Windows based, the co-ordinator can be WIndows or Linux. I have (in my initial searches) come across the following - and I know that some are cross-dependent: Celery (with RabbitMQ) Twisted Django Using a framework, rather than home-brewing, seems to make more sense to me right now. I have a limited timeframe in which to develop this functional extension. An additional consideration would be using a Framework that is compatible with PyQT/PySide so that I can write a simple UI to display Queue status etc. I appreciate that the specifics above are a little vague, and I hope that someone can offer me a pointer or two. Again: I am looking for general advice on which Python framework to investigate further, for developing a Server/Worker 'Queue management' solution, for non-web activities (this is why DJango didn't seem the right fit).

    Read the article

  • What Test Environment Setup do Top Project Committers Use in the Ruby Community?

    - by viatropos
    Today I am going to get as far as I can setting up my testing environment and workflow. I'm looking for practical advice on how to setup the test environment from you guys who are very passionate and versed in Ruby Testing. By the end of the day (6am PST?) I would like to be able to: Type one 1-command to run test suites for ANY project I find on Github. Run autotest for ANY Github project so I can fork and make TESTABLE contributions. Build gems from the ground up with Autotest and Shoulda. For one reason or another, I hardly ever run tests for projects I clone from Github. The major reason is because unless they're using RSpec and have a Rake task to run the tests, I don't see the common pattern behind it all. I have built 3 or 4 gems writing tests with RSpec, and while I find the DSL fun, it's less than ideal because it just adds another layer/language of methods I have to learn and remember. So I'm going with Shoulda. But this isn't a question about which testing framework to choose. So the questions are: What is your, the SO reader and Github project committer, test environment setup using autotest so that whenever you git clone a gem, you can run the tests and autotest-develop them if desired? What are the guys who are writing the Paperclip Tests and Authlogic Tests doing? What is their setup? Thanks for the insight. Looking for answers that will make me a more effective tester.

    Read the article

  • is it possible to write a program which prints its own source code utilizing a "sequence-generating-

    - by guest
    is it possible to write a program which prints its own source code utilizing a "sequence-generating-function"? what i call a sequence-generating-function is simply a function which returns a value out of a specific interval (i.e. printable ascii-charecters (32-126)). the point now is, that this generated sequence should be the programs own source-code. as you see, implementing a function which returns an arbitrary sequence is really trivial, but since the returned sequence must contain the implementation of the function itself it is a highly non-trivial task. this is how such a program (and its corresponding output) could look like #include <stdio.h> int fun(int x) { ins1; ins2; ins3; . . . return y; } int main(void) { int i; for ( i=0; i<size of the program; i++ ) { printf("%c", fun(i)); } return 0; } i personally think it is not possible, but since i don't know very much about the underlying matter i posted my thoughts here. i'm really looking forward to hear some opinions!

    Read the article

  • How to understand existing projects

    - by John
    Hi. I am a trainee developer and have been writing .NET applications for about a year now. Most of the work I have done has involved building new applications (mainly web apps) from scratch and I have been given more or less full control over the software design. This has been a great experience however, as a trainee developer my confidence about whether the approaches I have taken are the best is minimal. Ideally I would love to collaborate with more experienced developers (I find this the best was I learn) however in the company I work for developers tend to work in isolation (a great shame for me). Recently I decided that a good way to learn more about how experienced developers approach their design might be to explore some open source projects. I found myself a little overwhelmed by the projects I looked at. With my level of experience it was hard to understand the body of code I faced. My question is slight fuzzy one. How do developers approach the task of understanding a new medium to large scale project. I found myself pouring over lots of code and struggling to see the wood for the trees. At any one time I felt that I could understand a small portion of the system but not see how its all fits together. Do others get this same feeling? If so what approaches do you take to understanding the project? Do you have any other advice about how to learn design best practices? Any advice will be very much appreciated. Thank you.

    Read the article

  • Is there a design pattern to cut down on code duplication when subclassing Activities in Android?

    - by Daniel Lew
    I've got a common task that I do with some Activities - downloading data then displaying it. I've got the downloading part down pat; it is, of course, a little tricky due to the possibility of the user changing the orientation or cancelling the Activity before the download is complete, but the code is there. There is enough code handling these cases such that I don't want to have to copy/paste it to each Activity I have, so I thought to create an abstract subclass Activity itself such that it handles a single background download which then launches a method which fills the page with data. This all works. The issue is that, due to single inheritance, I am forced to recreate the exact same class for any other type of Activity - for example, I use Activity, ListActivity and MapActivity. To use the same technique for all three requires three duplicate classes, except each extends a different Activity. Is there a design pattern that can cut down on the code duplication? As it stands, I have saved much duplication already, but it pains me to see the exact same code in three classes just so that they each subclass a different type of Activity.

    Read the article

  • PendingIntent in Widget + TaskKiller

    - by YaW
    Hi, I've developed an Application (called Instant Buttons) and the app has a widget feature. This widget uses PendingIntent for the onClick of the widget. My PendingIntent code is something like this: Intent active = new Intent(context, InstantWidget.class); active.setAction(String.valueOf(appWidgetId)); active.putExtra("blabla", blabla); //Some data PendingIntent actionPendingIntent = PendingIntent.getBroadcast(context, 0, active, 0); actionPendingIntent.cancel(); actionPendingIntent = PendingIntent.getBroadcast(context, 0, active, 0); remoteViews.setOnClickPendingIntent(R.id.button, actionPendingIntent); The onReceive gets the intent and do some stuff with the MediaPlayer class to reproduce a sound. I have reports from some users that the widgets stop working after a while and with some research i've discovered is because the Task Killers. It seems that when you kill the app in the TaskKiller, the PendingIntent is erased from memory, so when you click the widget, it doesn't know what to do. Is there any solution for this? Is my code wrong or something or it's the default behavior of the PendingIntent? Is there something I can use to avoid the TaskKiller to stop my widgets from working?? Greetings.

    Read the article

  • [C#] how to do Exception Handling & Tracing

    - by shrimpy
    Hi all, i am reading some C# books, and got some exercise don't know how to do, or not sure what does the question mean. Problem: After working for a company for some time, your skills as a knowledgeable developer are recognized, and you are given the task of “policing” the implementation of exception handling and tracing in the source code (C#) for an enterprise application that is under constant incremental development. The two goals set by the product architect are: 100% of methods in the entire application must have at least a standard exception handler, using try/catch/finally blocks; more complex methods must also have additional exception handling for specific exceptions All control flow code can optionally write “tracing” information to assist in debugging and instrumentation of the application at run-time in situations where traditional debuggers are not available (eg. on staging and production servers). (i am not quite understand these criterias, i came from the java world, java has two kind of exception, check and unchecked exception. Developer must handle checked exception, and do logging. about unchecked exception, still do logging maybe, but most of the time we just throw it. however here comes to C#, what should i do????) Question for Problem: List rules you would create for the development team to follow, and the ways in which you would enforce rules, to achieve these goals. How would you go about ensuring that all existing code complies with the rules specified by the product architect; in particular, what considerations would impact your planning for the work to ensure all existing code complies?

    Read the article

  • On counting pairs of words that differ by one letter

    - by Quintofron
    Let us consider n words, each of length k. Those words consist of letters over an alphabet (whose cardinality is n) with defined order. The task is to derive an O(nk) algorithm to count the number of pairs of words that differ by one position (no matter which one exactly, as long as it's only a single position). For instance, in the following set of words (n = 5, k = 4): abcd, abdd, adcb, adcd, aecd there are 5 such pairs: (abcd, abdd), (abcd, adcd), (abcd, aecd), (adcb, adcd), (adcd, aecd). So far I've managed to find an algorithm that solves a slightly easier problem: counting the number of pairs of words that differ by one GIVEN position (i-th). In order to do this I swap the letter at the ith position with the last letter within each word, perform a Radix sort (ignoring the last position in each word - formerly the ith position), linearly detect words whose letters at the first 1 to k-1 positions are the same, eventually count the number of occurrences of each letter at the last (originally ith) position within each set of duplicates and calculate the desired pairs (the last part is simple). However, the algorithm above doesn't seem to be applicable to the main problem (under the O(nk) constraint) - at least not without some modifications. Any idea how to solve this?

    Read the article

  • Using custom Qt subclasses in Python

    - by kwatford
    First off: I'm new to both Qt and SWIG. Currently reading documentation for both of these, but this is a time consuming task, so I'm looking for some spoilers. It's good to know up-front whether something just won't work. I'm attempting to formulate a modular architecture for some in-house software. The core components are in C++ and exposed via SWIG to Python for experimentation and rapid prototyping of new components. Qt seems like it has some classes I could use to avoid re-inventing the wheel too much here, but I'm concerned about how some of the bits will fit together. Specifically, if I create some C++ classes, I'll need to expose them via SWIG. Some of these classes likely subclass Qt classes or otherwise have Qt stuff exposed in their public interfaces. This seems like it could raise some complications. There are already two interfaces for Qt in Python, PyQt and PySide. Will probably use PySide for licensing reasons. About how painful should I expect it to be to get a SWIG-wrapped custom subclass of a Qt class to play nice with either of these? What complications should I know about upfront?

    Read the article

  • First Time Architecturing?

    - by cam
    I was recently given the task of rebuilding an existing RIA. The new RIA that I've designed is based on Silverlight, with a WCF service to connect to MS SQL Server. This is my first time doing something like this, so I'm not sure how to design the entire thing. Basically, the client can look through graphs of "stocks" (allowing the client to choose different time periods, settings, etc). I've written the whole application essentially, but I'm not sure how to put it together. The graphs are supposed to be directly based on the database, and to create the datapoints on the graph, some calculations need to be done (not very expensive ones). The problem I'm having is to decide where to put the calculations (client or serverside? Or half and half?) What factors should I look for to help me decide where the calculations should be done? And how can I go about optimizing this (caching, etc)? Obviously this is a very broad subject, so I'm not expecting an immediate answer, but any help/pointing in the right direction/resources would be appreciated.

    Read the article

  • Any Alternate way for writing to a file other than ofstream

    - by Aditya
    Hi All, I am performing file operations (writeToFile) which fetches the data from a xml and writes into a output file(a1.txt). I am using MS Visual C++ 2008 and in windows XP. currently i am using this method of writing to output file.. 01.ofstreamhdr OutputFile; 02./* few other stmts / 03.hdrOutputFile.open(fileName, std::ios::out); 04. 05.hdrOutputFile << "#include \"commondata.h\""<< endl ; 06.hdrOutputFile << "#include \"Commonconfig.h\"" << endl ; 07.hdrOutputFile << "#include \"commontable.h\"" << endl << endl ; 08. hdrOutputFile << "#pragma pack(push,1)" << endl ; 09.hdrOutputFile << "typedef struct \n {" << endl ; 10./ simliar hdrOutputFiles statements... */.. I have around 250 lines to write.. Is any better way to perform this task. I want to reduce this hdrOutputFile and use a buffer to do this. Please guide me how to do that action. I mean, buff = "#include \"commontable.h\"" + "typedef struct \n {" + ....... hdrOutputFile << buff. is this way possible? Thanks Ramm

    Read the article

  • What's the correct place to share application logic in CakePHP?

    - by Pichan
    I guess simple answer to the question would be a component. Although I agree, I feel weird having to write a component for something so specific. For example, let's say I have a table of users. When a user is created, it should form a chain reaction of events, initiating different kinds of data related to the user all around the database. I figured it would be best to avoid directly manipulating the database from different controllers and instead pack all that neatly in a method. However since some logic needs to be accesed separately, I really can't have the whole package in a single method. Instead I thought it would be logical to break it up to smaller pieces(like $userModelOrController->createNew() and $candyStorageModelOrController->createNew()) that only interact with their respective database table. Now, if the logic is put to the model, it works great until I need to use other models. Of course it's possible, but when compared to loading models in a controller, it's not that simple. It's like a Cake developer telling me "Sure, it's possible if you want to do it that way but that's not how I would do it". Then, if the logic is put to the controller, I can access other models really easy through $this->loadModel(), but that brings me back to the previously explained situation since I need to be able to continue the chain reaction indefinitely. Accessing other controllers from a controller is possible, but again there doesn't seem to be any direct way of doing so, so I'm guessing I'm still not doing it right. By using a component this problem could be solved easily, since components are available to every controller I want. But like I wrote at the beginning, it feels awkward to create a component specifically for this one task. To me, components seem more like packages of extra functionality(like the core components) and not something to share controller-specific logic. Since I'm new to this whole MVC thing, I could've completely misunderstood the concept. Once again, I would be thankful if someone pointed me to the right direction :)

    Read the article

  • Mono Text Based Web Browser

    - by powerbox
    Hi guys, is there any public text based web browser implementation for C# or on mono base api that I can use to fill up web forms automatically? I'll be using it to automate some web task that does not require any image authentication. I'm currently using a web browser control available on .Net Framework and waits for the event WebBrowserDocumentCompletedEventHandler to fire after a page is successfully loaded and invoke some actions like Submit or simulating a mouse click on some links. It actually does the job but I can't process bulk transactions since I needed to wait for the whole page to be loaded together with the images and other stuff. It is easy to use HttpWebRequest to fill up some forms , provide some data and then submit. But on some occasions I only need to simulate a mouse click to a certain link which I don't know how to do with HttpWebRequest. By the way using HttpWebRequest will still download all the images of a web page that I see pointless since I only need to provide correct data back to the server. I hope someone can pinpoint me the correct way of doing this kind of automation and thanks in advance!

    Read the article

  • Deployment a web-site on IIS from another program

    - by slo2ols
    Hi, I developed a web-site on ASP.NET 3.5 SP1 platform. And additional I have 2 win services. My task is to build install package. I decided that Visual Studio install projects are not met my requirements. I design my own installer for this project, because I need to resolve many question and problem in install process. My problem: I need to deploy web-site into IIS, but I don't know how to do it easy. I found Microsoft tool as Web Deployment Tool, but I didn't find any documentation. And must I include this tool into my installer for deployment at destination customer? Another side I found SDC Tasks Library and it looks like a solution for me. But I saw many topics where people had problems and because the project was dead anybody couldn't help them. I know it is a long story... My question: how can I deploy the web-site from another program (I know that IIS versions have some differences and it is another headache), set a virtual directory, application pool (very important), a type of authentification and so forth ??? Thanks.

    Read the article

  • How does PHP interface with Apache?

    - by Sbm007
    Hi, I've almost finished writing a HTTP/1.0 compliant web server under Java (no commercial usage as such, this is just for fun) and basically I want to include PHP support. I realize that this is no easy task at all, but I think it'll be a nice accomplishment. So I want to know how PHP exactly interfaces with the Apache web server (or any other web server really), so I can learn from it and write my own PHP wrapper. It doesn't necessarily have to be mod_php, I don't mind writing a FastCGI wrapper - which to my knowledge is capable of running PHP as well. I would've thought that all that PHP needs is the output that goes to client (so it can interpret the PHP parts), the full HTTP request from client (so it can extract POST variables and such) and the client's host name. And then you simply take the parsed PHP code and write that to the output stream. There will probably be more things, but in essence that's how I would have thought it works. From what I've gathered so far, apache2handler provides an API which PHP makes use of to 'connect' to Apache. I guess it's an idea to look at the source code for apache2handler and php5apache2.dll or so, but before I do that I thought I'd ask SO first. If anyone has more information, experience, or some sort of specification that is relevant to this then please let me know. Thanks in advance!

    Read the article

  • Application process never terminates on each run

    - by rockyurock
    I am seeing an application always remains live even after closing the application using my Perl script below. Also, for the subsequent runs, it always says that "The process cannot access the file because it is being used by another process. iperf.exe -u -s -p 5001 successful. Output was:" So every time I have to change the file name $file used in script or I have to kill the iperf.exe process in the Task Manager. Could anybody please let me know the way to get rid of it? Here is the code I am using ... my @command_output; eval { my $file = "abc6.txt"; $command = "iperf.exe -u -s -p 5001"; alarm 10; system("$command > $file"); alarm 0; close $file; }; if ($@) { warn "$command timed out.\n"; } else { print "$command successful. Output was:\n", $file; } unlink $file;

    Read the article

  • Avoiding repeated subqueries when 'WITH' is unavailable

    - by EloquentGeek
    MySQL v5.0.58. Tables, with foreign key constraints etc and other non-relevant details omitted for brevity: CREATE TABLE `fixture` ( `id` int(11) NOT NULL auto_increment, `competition_id` int(11) NOT NULL, `name` varchar(50) NOT NULL, `scheduled` datetime default NULL, `played` datetime default NULL, PRIMARY KEY (`id`) ); CREATE TABLE `result` ( `id` int(11) NOT NULL auto_increment, `fixture_id` int(11) NOT NULL, `team_id` int(11) NOT NULL, `score` int(11) NOT NULL, `place` int(11) NOT NULL, PRIMARY KEY (`id`) ); CREATE TABLE `team` ( `id` int(11) NOT NULL auto_increment, `name` varchar(50) NOT NULL, PRIMARY KEY (`id`) ); Where: A draw will set result.place to 0 result.place will otherwise contain an integer representing first place, second place, and so on The task is to return a string describing the most recently played result in a given competition for a given team. The format should be "def Team X,Team Y" if the given team was victorious, "lost to Team X" if the given team lost, and "drew with Team X" if there was a draw. And yes, in theory there could be more than two teams per fixture (though 1 v 1 will be the most common case). This works, but feels really inefficient: SELECT CONCAT( (SELECT CASE `result`.`place` WHEN 0 THEN "drew with" WHEN 1 THEN "def" ELSE "lost to" END FROM `result` WHERE `result`.`fixture_id` = (SELECT `fixture`.`id` FROM `fixture` LEFT JOIN `result` ON `result`.`fixture_id` = `fixture`.`id` WHERE `fixture`.`competition_id` = 2 AND `result`.`team_id` = 1 ORDER BY `fixture`.`played` DESC LIMIT 1) AND `result`.`team_id` = 1), ' ', (SELECT GROUP_CONCAT(`team`.`name`) FROM `fixture` LEFT JOIN `result` ON `result`.`fixture_id` = `fixture`.`id` LEFT JOIN `team` ON `result`.`team_id` = `team`.`id` WHERE `fixture`.`id` = (SELECT `fixture`.`id` FROM `fixture` LEFT JOIN `result` ON `result`.`fixture_id` = `fixture`.`id` WHERE `fixture`.`competition_id` = 2 AND `result`.`team_id` = 1 ORDER BY `fixture`.`played` DESC LIMIT 1) AND `team`.`id` != 1) ) Have I missed something really obvious, or should I simply not try to do this in one query? Or does the current difficulty reflect a poor table design?

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • File size monitoring in C#

    - by manemawanna
    Hello, I work in the Systems & admin team and have been given the task of creating a quota management application to try and encourage users to better manage there resources as we currently have issues with disc space and don't enforce hard quotas. At the moment I'm using the code below to go through all the files in a users homespace to retrieve the overall amount of space they are using. As from what I've seen else where theres no other way to do this in C#, the issue with it is theirs quite a high overhead while it retireves the size of each file then creates a total. try { long dirSize = 0; FileInfo[] FI = new DirectoryInfo("I:\\").GetFiles("*.*", SearchOption.AllDirectories); foreach (FileInfo F1 in FI) { dirSize += F1.Length; } return dirSize; } So I'm looking for a quicker way to do this or a quick way to monitor changes in the size of files while using the options avaliable through FileSystemWatcher. At the moment the only thing I can think of is creating a hashtable containing the file location and size of each file, so when a size changed event occurs I can compare the old size against the new one and update the total. Any suggestions would be greatly appreciated.

    Read the article

  • C++ AMP, for loops to parallel_for_each loop

    - by user1430335
    I'm converting an algorithm to make use of the massive acceleration that C++ AMP provides. The stage I'm at is putting the for loops into the known parallel_for_each loop. Normally this should be a straightforward task to do but it appears more complex then I first thought. It's a nested loop which I increment using steps of 4 per iterations: for(int j = 0; j < height; j += 4, data += width * 4 * 4) { for(int i = 0; i < width; i += 4) { The trouble I'm having is the use of the index. I can't seem to find a way to properly fit this into the parallel_for_each loop. Using an index of rank 2 is the way to go but manipulating it via branching will do harm to the performance gain. I found a similar post: Controlling the index variables in C++ AMP. It also deals about index manipulation but the increment aspect doesn't cover my issue. With kind regards, Forcecast

    Read the article

  • crash when using stl vector at instead of operator[]

    - by Jamie Cook
    I have a method as follows (from a class than implements TBB task interface - not currently multithreading though) My problem is that two ways of accessing a vector are causing quite different behaviour - one works and the other causes the entire program to bomb out quite spectacularly (this is a plugin and normally a crash will be caught by the host - but this one takes out the host program as well! As I said quite spectacular) void PtBranchAndBoundIterationOriginRunner::runOrigin(int origin, int time) const // NOTE: const method { BOOST_FOREACH(int accessMode, m_props->GetAccessModes()) { // get a const reference to appropriate vector from member variable // map<int, vector<double>> m_rowTotalsByAccessMode; const vector<double>& rowTotalsForAccessMode = m_rowTotalsByAccessMode.find(accessMode)->second; if (origin != 129) continue; // Additional debug constrain: I know that the vector only has one non-zero element at index 129 m_job->Write("size: " + ToString(rowTotalsForAccessMode.size())); try { // check for early return... i.e. nothing to do for this origin if (!rowTotalsForAccessMode[origin]) continue; // <- this works if (!rowTotalsForAccessMode.at(origin)) continue; // <- this crashes } catch (...) { m_job->Write("Caught an exception"); // but its not an exception } // do some other stuff } } I hate not putting in well defined questions but at the moment my best phrasing is : "WTF?" I'm compiling this with Intel C++ 11.0.074 [IA-32] using Microsoft (R) Visual Studio Version 9.0.21022.8 and my implementation of vector has const_reference operator[](size_type _Pos) const { // subscript nonmutable sequence #if _HAS_ITERATOR_DEBUGGING if (size() <= _Pos) { _DEBUG_ERROR("vector subscript out of range"); _SCL_SECURE_OUT_OF_RANGE; } #endif /* _HAS_ITERATOR_DEBUGGING */ _SCL_SECURE_VALIDATE_RANGE(_Pos < size()); return (*(_Myfirst + _Pos)); } (Iterator debugging is off - I'm pretty sure) and const_reference at(size_type _Pos) const { // subscript nonmutable sequence with checking if (size() <= _Pos) _Xran(); return (*(begin() + _Pos)); } So the only difference I can see is that at calls begin instead of simply using _Myfirst - but how could that possibly be causing such a huge difference in behaviour?

    Read the article

< Previous Page | 789 790 791 792 793 794 795 796 797 798 799 800  | Next Page >