Search Results

Search found 26977 results on 1080 pages for 'input device'.

Page 798/1080 | < Previous Page | 794 795 796 797 798 799 800 801 802 803 804 805  | Next Page >

  • Extending Code Igniter Model functions to external PHP Scripts

    - by Fábio Antunes
    Hello everybody. I'm doing a small web app, which uses CKeditor for user input, and CKfinder for file management (images/flash). Those who know CKFinder, also know that the config file for CKFinder as a function named CheckAuthentication() that returns false or true, giving or not permissions to use CKFinder. This is were a Custom PHP Code checks if the user as authorization to access CKFinder or not. Well for my app I'm using Code Igniter, and of course I've created a model were i handle everything about User Permissions, Loggin, Session Cookies, etc. And i also have a function witch its propose is just to check if the user is Logged in. So I would like to know if someone knows a way that i can call the function isLoggedIn() inside the model security from inside the function CheckAuthentication() in CKFinder config file. Thanks in advance.

    Read the article

  • WPF Keyboard Remapping

    - by m1dst
    Hello, I am trying to remap the input of a textbox. For example. If a user enters a N then I would like to change it to a 9. I thought it might be best to try and catch it in the PreviewKeyDown event although I will also need to process paste attempts (I can solve that bit I think). Is PreviewKeyDown a good place to start? If so, how do I send the replacement key. I know that e.Handled = true will stop the original key being processed. Thanks.

    Read the article

  • Performing both client side and server side validation using jQuery and CodeIgniter

    - by Vasu
    What is the right way of doing both client side and server side validation using jQuery and CodeIgniter? I am using the jQuery form plugin for form submit. I would like to use jQuery validation plugin (http://docs.jquery.com/Plugins/Validation) for client side validation and CodeIgniter form validation on the server side. However the two don't seem to gel together (or I am unable to get my head around it). Can someone help please? Whether its a client side validation or server side validation, the user should see consistent UI displaying error messages next to the input fields.

    Read the article

  • No-Model Formtastic Form

    - by Kevin Sylvestre
    I am looking to reproduce the following with Formtastic: <% form_tag '/search', :method => 'get' do %> <%= text_field_tag :q, params[:q] %> <% end %> So far I have: <% semantic_form_for :search, :html => { :method => :get } do |form| %> <% form.inputs do %> <%= form.input :q %> <% end %> <% end %> However, this requires access to the parameter hash using: params[:search][:q] Instead of my required: params[:q] I'd like to use Formtastic for all forms in the application I am working on, and so far I have only had problems with this one. Any ideas?

    Read the article

  • C# Pragma to suppress break on thrown error

    - by Courtney de Lautour
    First off I run my applications with exceptions thrown on any error (handled or not). Second I am using a TypeConverter to convert from a user input string to the actual object. Third TypeConverter offers no TryConvert method so I'm stuck using exceptions for validation, using this rather ugly bit of code here: try { this._newValue = null; #pragma Magic_SuppressBreakErrorThrown System.Exception this._newValue = this.Converter.ConvertFromString(this._textBox.Text); #pragma Magic_ResumeBreakErrorThrown System.Exception this.HideInvalidNotification(); } catch (Exception exception) { if (exception.InnerException is FormatException) { this.ShowInvalidNotification(this._textBox.Text); } else { throw; } } I'm finding it rather distracting to have VS break execution every-time I type the - of -1, or some other invalid character. I could use something similar to this but not all the types I'm converting to have a TryParse method either. I'm hoping there may be some way to disable breaking for the section of code within the try without changing my exception settings.

    Read the article

  • ASP.NET MVC ajax - data transfer

    - by Grienders
    How can I get result from action? I need to show the commentID on the page (aspx) after successes comment insert. controller [AcceptVerbs(HttpVerbs.Post )] public ActionResult ShowArticleByAjax(Guid id, string commentBody) { Guid commentID = Comment.InsertComment(id, commentBody); //How can I tranfer commentID to the aspx page ??? return PartialView("CommentDetails",Article.GetArticleByID(id)); } ascx <%using (Ajax.BeginForm("ShowArticleByAjax", new { id = Model.ID }, new AjaxOptions { HttpMethod = "Post", UpdateTargetId = "divCommentDetails", OnSuccess = "successAddComment", OnFailure = "failureAddComment", OnBegin = "beginAddComment" })) { %> <p> <%=Html.TextArea("commentBody", new { cols = "100%", rows = "10" })%> </p> <p> <input name="submit" type="image" src="../../Content/Images/Design/button_s.gif" id="submit" /> </p> <%} %> aspx doesn't matter

    Read the article

  • Django and floatformat tag

    - by Hellnar
    Hello, I want to modify / change the way the floatformat works. By default it changes the input decimal as such: {{ 1.00|floatformat }} -> 1 {{ 1.50|floatformat }} -> 1.5 {{ 1.53|floatformat }} -> 1.53 I want to change this abit as such: If there is a floating part, it should keep the first 2 floating digits. If no floating (which means .00) it should simply cut out the floating part. IE: {{ 1.00|floatformat }} -> 1 {{ 1.50|floatformat }} -> 1.50 {{ 1.53|floatformat }} -> 1.53

    Read the article

  • InvokeMember("click") webBrowser help

    - by Tom
    I am trying to automate a web page via the weBrowser and the button that i'm trying to click has no ID only a value. here's the html code for it: Accept I can't useGetElementById as the button has no ID. If I do HtmlElement goButton = this.webBrowser1.Document.All["Accept"]; goButton.InvokeMember("click"); My script stops showing a nullreference error highlighting the "goButton.InvokeMember("click");" If I do var inputControls = (from HtmlElement element in webBrowser1.Document.GetElementsByTagName("input") select element).ToList(); HtmlElement submitButton = inputControls.First(x = x.Name == "Accept"); My script give me an "Sequence contains no matching element" error at the "HtmlElement submitButton" line and sometimes the page has more than one of these Accept buttons, so I would need to be able to tell the difference between each one as well or at least be able to click on one without the script breaking Any help with this will be greatly appreciated

    Read the article

  • POJO's versus Cursors in Android

    - by Kilnr
    I usually tend to define the model layer of my apps using POJO's, such as Article, Comment, etc. I was about to implement an AlphabetIndexer in the adapter of one of my ListViews. Right now this adapter accepts a Collection of Articles, which I normally get from my wrapper around an SQLiteDatabase. The signature of the AlphabetIndexer constructer is as follows: public AlphabetIndexer (Cursor cursor, int sortedColumnIndex, CharSequence alphabet) Since this doesn't accept a Collection or something similar, just a Cursor, it got me wondering: maybe I shouldn't be creating objects for my model, and just use the Cursors returned from the database? So the question is, I guess: what should I do, represent data with Collections of POJO's, or just work with Cursors throughout my app? Any input?

    Read the article

  • Button inside text box

    - by user542719
    My code shows a button inside a textbox, but when the input value changes, the size of the text box also changes. That I don't like. Is there any solution such that the textbox size remains fixed? Or any other idea on how to create a button inside textbox? The following is my code: JPanel panel = new JPanel(); panel.setLayout( new FlowLayout(FlowLayout.CENTER, 0, 0) ); panel.add(textField); panel.add(button); panel.setBackground( textField.getBackground() ); panel.setBorder( textField.getBorder() ); textField.setBorder(null);

    Read the article

  • WF4 - Display workflow design in asp.net and highlight an activity

    - by jikan_the_useless
    i need to display current status of a document approval workflow task in asp.net web page with a specific activity highlighted. i have seen the visual workflow tracker example (in wf&wcf samples) but i have two issues, 1-i have to render workflow in asp.net not in a wpf app. 2-i don't need to display current status with workflow running, all activities that need to highlighted are the one that require user input. e.g. "waiting for approval from department head" etc. if i could just convert the workflow xaml to jpg after highlighting a specific activity by activity id that created a bookmark and waiting to resume the bookmark it would do the work.

    Read the article

  • Using chunked encoding in a POST request to an asmx web service on IIS 6 generates a 404

    - by user175869
    Hi, I'm using a CXF client to communicate with a .net web service running on IIS 6. This request (anonymised): POST /EngineWebService_v1/EngineWebService_v1.asmx HTTP/1.1 Content-Type: text/xml; charset=UTF-8 SOAPAction: "http://.../Report" Accept: */* User-Agent: Apache CXF 2.2.5 Cache-Control: no-cache Pragma: no-cache Host: uat9.gtios.net Connection: keep-alive Transfer-Encoding: chunked followed by 7 chunks of 4089 bytes and one of 369 bytes, generates the following output after the first chunk has been sent: HTTP/1.1 404 Not Found Content-Length: 103 Date: Wed, 10 Feb 2010 13:00:08 GMT Connection: Keep-Alive Content-Type: text/html Anyone know how to get IIS to accept chunked input for a POST? Thanks

    Read the article

  • ASP .NET: SQL Server Money Type and .NET Currency Type

    - by Rudi Ramey
    MS SQL Server's Money Data Type seems to accept a well formatted currency value with no problem (example: $52,334.50) From my research MS SQL Sever just ignores the "$" and "," characters. ASP .NET has a parameter object that has a Type/DbType property and Currency is an available option to set as a value. However, when I set the parameter Type or DbType to currency it will not accept a value like $52,334.50. I receive an error "Input string was not in a correct format." when I try to Update/Insert. If I don't include the "$" or "," characters it seems to work fine. Also, if I don't specify the Type or DbType for the parameter it seems to work fine also. Is this just standard behavior that the parameter object with its Type set to currency will still reject "$" and "," characters in ASP .NET? Here's an example of the parameter declaration (in the .aspx page): <asp:Parameter Name="ImplementCost" DbType="Currency" />

    Read the article

  • Codeigniter and Paypal: How it works

    - by Abs
    Hello all, Two random question as I try to integerate Paypal IPN into my Codeigniter based web app. 1) Are these two lines the same? $data['pp_info'] = $this->input->post(); $data['pp_info'] = $_POST; 2) A user agrees to pay a monthly recurring fee to use your service using paypal - first payment you are aware they have paid as you get data returned from paypal. But how do you keep track if users has paid for the following months? How do you know the user has not cancelled from their paypal account? Thanks all for any help

    Read the article

  • DualLayout for SharePoint 2010 WCM Quick Start

    - by svdoever
    DualLayout for SharePoint 2010 WCM is a solution to provide you with complete HTML freedom in your SharePoint Server 2010 publishing pages. In this post I provide a quick start guide to get you up and running quickly so you can try it out for yourself. This quick start creates a simple HTML5 site with a page to show-case the basics and the power of DualLayout. We will create the site in its own web application. Normally there are many things you have to do to create a clean start point for your SharePoint 2010 WCM site. All those steps will be provided in later posts. For now we want to give you the minimal set of steps to take to get DualLayout working on your machine. Create an authenticated web application with hostheader cms.html5demo.local on port 80 for the cms side of the site. Click the Create Site Collection link on the Application Created dialog box and create a Site Collection based on the Publishing Portal site template. Before we can click the site link in the Top-Level Site Successfully Created dialog we need to add the new host header cms.html5demo.local to the hosts file. Add the following line to the hosts file: 127.0.0.1        cms.html5demo.local Navigate to the site at http://cms.html5demo.local to see the out-of-the-box example Adventure Works publishing site. Download and add the DualLayout solution package designfactory.duallayout.sps2010.trial.1.2.0.0.wsp to the farm’s solution store: On the Start menu, click All Programs. Click Microsoft SharePoint 2010 Products. Click SharePoint 2010 Management Shell. At the Windows PowerShell command prompt, type the following command:Add-SPSolution -LiteralPath designfactory.duallayout.sps2010.trial.1.2.0.0.wsp In SharePoint 2010 Central Administration deploy the solution to the web application http://cms.html5demo.local. Navigate to the site at http://cms.html5demo.local, and in the Site Settings screen select Site Collection Administration > Site collection features and activate the following feature: Open the site http://cms.html5demo.local in SharePoint Designer 2010. Create a view-mode masterpage html5simple.master with the following code: html5simple.master <%@ Master language="C#" %> <%@ Register Tagprefix="SharePointWebControls" Namespace="Microsoft.SharePoint.WebControls" Assembly="Microsoft.SharePoint, Version=14.0.0.0, Culture=neutral, PublicKeyToken=71e9bce111e9429c" %> <%@ Register TagPrefix="sdl" Namespace="DesignFactory.DualLayout" Assembly="DesignFactory.DualLayout, Version=1.2.0.0, Culture=neutral, PublicKeyToken=077f92bbf864a536" %>   <!DOCTYPE html> <html class="no-js">       <head>         <meta charset="utf-8" />         <meta http-equiv="X-UA-Compatible" content="IE=Edge" />         <title><SharePointWebControls:FieldValue FieldName="Title" runat="server"/></title>           <script type="text/javascript">             document.createElement('header');             document.createElement('nav');             document.createElement('article');             document.createElement('hgroup');             document.createElement('aside');             document.createElement('section');             document.createElement('footer');             document.createElement('figure');             document.createElement('time');         </script>           <asp:ContentPlaceHolder id="PlaceHolderAdditionalPageHead" runat="server"/>     </head>          <body>                  <header>             <div class="logo">Logo</div>             <h1>SiteTitle</h1>             <nav>                 <a href="#">SiteMenu 1</a>                 <a href="#">SiteMenu 2</a>                 <a href="#">SiteMenu 3</a>                 <a href="#">SiteMenu 4</a>                 <a href="#">SiteMenu 5</a>                 <sdl:SwitchToWcmModeLinkButton runat="server" Text="…"/>             </nav>             <div class="tagline">Tagline</div>             <form>                 <label>Zoek</label>                 <input type="text" placeholder="Voer een zoekterm in...">                 <button>Zoek</button>                             </form>           </header>                  <div class="content">             <div class="pageContent">                 <asp:ContentPlaceHolder id="PlaceHolderMain" runat="server" />             </div>         </div>              <footer>             <nav>                 <ul>                     <li><a href="#">FooterMenu 1</a></li>                     <li><a href="#">FooterMenu 2</a></li>                     <li><a href="#">FooterMenu 3</a></li>                     <li><a href="#">FooterMenu 4</a></li>                     <li><a href="#">FooterMenu 5</a></li>                 </ul>             </nav>             <small>Copyright &copy; 2011 Macaw</small>         </footer>     </body> </html> Note that if no specific WCM-mode master page is specified (html5simple-wcm.master), the default v4.master master page will be used in WCM-mode. Create a WCM-mode page layout html5simplePage-wcm.aspx with the following code: html5simplePage-wcm.aspx <%@ Page language="C#"     Inherits="DesignFactory.DualLayout.WcmModeLayoutPage, DesignFactory.DualLayout, Version=1.2.0.0, Culture=neutral, PublicKeyToken=077f92bbf864a536" %> <%@ Register Tagprefix="SharePointWebControls"              Namespace="Microsoft.SharePoint.WebControls"              Assembly="Microsoft.SharePoint, Version=14.0.0.0, Culture=neutral, PublicKeyToken=71e9bce111e9429c" %> <%@ Register Tagprefix="WebPartPages"              Namespace="Microsoft.SharePoint.WebPartPages"              Assembly="Microsoft.SharePoint, Version=14.0.0.0, Culture=neutral, PublicKeyToken=71e9bce111e9429c" %> <%@ Register Tagprefix="PublishingWebControls"              Namespace="Microsoft.SharePoint.Publishing.WebControls"              Assembly="Microsoft.SharePoint.Publishing, Version=14.0.0.0, Culture=neutral, PublicKeyToken=71e9bce111e9429c" %> <%@ Register Tagprefix="PublishingNavigation" Namespace="Microsoft.SharePoint.Publishing.Navigation"              Assembly="Microsoft.SharePoint.Publishing, Version=14.0.0.0, Culture=neutral, PublicKeyToken=71e9bce111e9429c" %> <asp:Content ContentPlaceholderID="PlaceHolderPageTitle" runat="server">     <SharePointWebControls:FieldValue id="PageTitle" FieldName="Title" runat="server"/> </asp:Content> <asp:Content ContentPlaceholderID="PlaceHolderMain" runat="server"> </asp:Content> Notice the Inherits at line two. Instead of inheriting from Microsoft.SharePoint.Publishing.PublishingLayoutPage we need to inherit from DesignFactory.DualLayout.WcmModeLayoutPage. Create a view-mode page layout html5simplePage.aspx with the following code: html5simplePage.aspx html5simplePage.aspx <%@ Page language="C#"          Inherits="DesignFactory.DualLayout.ViewModeLayoutPage, DesignFactory.DualLayout,                     Version=1.2.0.0, Culture=neutral, PublicKeyToken=077f92bbf864a536" %> <%@ Register Tagprefix="SharePointWebControls"              Namespace="Microsoft.SharePoint.WebControls"              Assembly="Microsoft.SharePoint, Version=14.0.0.0, Culture=neutral, PublicKeyToken=71e9bce111e9429c" %> <%@ Register Tagprefix="WebPartPages"              Namespace="Microsoft.SharePoint.WebPartPages"              Assembly="Microsoft.SharePoint, Version=14.0.0.0, Culture=neutral, PublicKeyToken=71e9bce111e9429c" %> <%@ Register Tagprefix="PublishingWebControls"              Namespace="Microsoft.SharePoint.Publishing.WebControls"              Assembly="Microsoft.SharePoint.Publishing, Version=14.0.0.0, Culture=neutral, PublicKeyToken=71e9bce111e9429c" %> <%@ Register Tagprefix="PublishingNavigation" Namespace="Microsoft.SharePoint.Publishing.Navigation"              Assembly="Microsoft.SharePoint.Publishing, Version=14.0.0.0, Culture=neutral, PublicKeyToken=71e9bce111e9429c" %> <asp:Content ContentPlaceholderID="PlaceHolderAdditionalPageHead" runat="server" /> <asp:Content ContentPlaceholderID="PlaceHolderMain" runat="server">     The title of the page is: <SharePointWebControls:FieldValue id="PageTitleInContent" FieldName="Title" runat="server"/> </asp:Content> Notice the Inherits at line two. Instead of inheriting from Microsoft.SharePoint.Publishing.PublishingLayoutPage we need to inherit from DesignFactory.DualLayout.ViewModeLayoutPage. Set the html5simple.master master page as the Site Master Page Set the allowed page layouts to the Html5 Simple Page page layout and set the New Page Default Settings also to Html5 Simple Page so new created pages are also of this page layout. Note that the Html5 Simple Page page layout is initially not selectable for New Page Default Settings. Save this configuration page first after selecting the allowed page layouts, then open again and select the default new page. Under Site Actions select the New Page action. Create a page Home.aspx of the default page layout type Html5 Simple Page. Set the new created Home.aspx page as Welcome Page. Navigate to the site http://csm.html5demo.local and see the home page in the WCM display and edit mode. Select Switch to View Mode under Site Actions to see the resulting page in view-mode. Select the three dots (…) at the right side of the menu to switch back to WCM-mode. Have a look at the source view of the resulting web page and admire the clean HTML. No SharePoint specific markup or CSS files! Clean HTML in page <!DOCTYPE html> <html class="no-js">     <head>         <meta charset="utf-8" />         <meta http-equiv="X-UA-Compatible" content="IE=Edge" />         <title>Home</title>         <script type="text/javascript">             document.createElement('header');             document.createElement('nav');             document.createElement('article');             document.createElement('hgroup');             document.createElement('aside');             document.createElement('section');             document.createElement('footer');             document.createElement('figure');             document.createElement('time');         </script>              </head>          <body>                  <header>             <div class="logo">Logo</div>             <h1>SiteTitle</h1>             <nav>                 <a href="#">SiteMenu 1</a>                 <a href="#">SiteMenu 2</a>                 <a href="#">SiteMenu 3</a>                 <a href="#">SiteMenu 4</a>                 <a href="#">SiteMenu 5</a>                 <a href="/Pages/Home.aspx?DualLayout_ShowInWcmMode=true">…</a>             </nav>             <div class="tagline">Tagline</div>             <form>                 <label>Zoek</label>                 <input type="text" placeholder="Voer een zoekterm in...">                 <button>Zoek</button>                             </form>         </header>                  <div class="content">             <div class="pageContent">                      The title of the page is: Home             </div>         </div>              <footer>             <nav>                 <ul>                     <li><a href="#">FooterMenu 1</a></li>                     <li><a href="#">FooterMenu 2</a></li>                     <li><a href="#">FooterMenu 3</a></li>                     <li><a href="#">FooterMenu 4</a></li>                     <li><a href="#">FooterMenu 5</a></li>                 </ul>             </nav>             <small>Copyright &copy; 2011 Macaw</small>         </footer>     </body> </html> <!-- Macaw DesignFactory DualLayout for SharePoint 2010 Trial version --> Note the link at line 37, this link will only be rendered for authenticated users and is our way to switch back to WCM-mode. This concludes our quick start to get DualLayout up an running in a matter of minutes. And what is the result: You can have the full SharePoint 2010 WCM publishing page editing experience to manage the content in your pages. You don’t have to delve into large SharePoint specific master pages and page layouts with a lot of knowledge of the does and don'ts with respect to SharePoint controls, scripts and stylesheets. The end-user gets a clean and light HTML page. Get your fully functional, non-timebombed trial copy of DualLayout and start creating!

    Read the article

  • ASPX ajax form post help

    - by StealthRT
    Hey all, i have this peice of code that allows a user to select a jpg image, resize it and uploads it to the server driectory. The problem being is that it reloads the aspx page when it saves the image. My question is-is there any way to do this same thing but with ajax so that it doesn't leave the page after submitting it? I've done this pleanty of times with classic asp pages but never with a aspx page. Here is the code for the ASPX page: <%@ Page Trace="False" Language="vb" aspcompat="false" debug="true" validateRequest="false"%> <%@ Import Namespace=System.Drawing %> <%@ Import Namespace=System.Drawing.Imaging %> <%@ Import Namespace=System.Drawing.Text %> <%@ Import Namespace=System %> <%@ Import Namespace=System.IO %> <%@ Import Namespace=System.Web %> <%@ Import Namespace=System.ServiceProcess %> <%@ Import Namespace=Microsoft.Data.Odbc %> <%@ Import Namespace=System.Data.Odbc %> <%@ Import Namespace=MySql.Data.MySqlClient %> <%@ Import Namespace=MySql.Data %> <%@ Import Namespace=System.Drawing.Drawing2D %> <%@ Import Namespace="System.Data" %> <%@ Import Namespace="System.Data.ADO" %> <%@ Import Namespace=ADODB %> <SCRIPT LANGUAGE="VBScript" runat="server"> const Lx = 200 const Ly = 60 const upload_dir = "/img/avatar/" const upload_original = "tmpAvatar" const upload_thumb = "thumb" const upload_max_size = 256 dim fileExt dim newWidth, newHeight as integer dim l2 dim fileFld as HTTPPostedFile Dim originalimg As System.Drawing.Image dim msg dim upload_ok as boolean </script> <% Dim theID, theEmail, maleOrFemale theID = Request.QueryString("ID") theEmail = Request.QueryString("eMail") maleOrFemale = Request.QueryString("MF") randomize() upload_ok = false if lcase(Request.ServerVariables("REQUEST_METHOD"))="post" then fileFld = request.files(0) if fileFld.ContentLength > upload_max_size * 1024 then msg = "Sorry, the image must be less than " & upload_max_size & "Kb" else try fileExt = System.IO.Path.GetExtension(fileFld.FileName).ToLower() if fileExt = ".jpg" then originalImg = System.Drawing.Image.FromStream(fileFld.InputStream) if originalImg.Height > Ly then newWidth = Ly * (originalImg.Width / originalImg.Height) newHeight = Ly end if Dim thumb As New Bitmap(newWidth, newHeight) Dim gr_dest As Graphics = Graphics.FromImage(thumb) dim sb = new SolidBrush(System.Drawing.Color.White) gr_dest.SmoothingMode = System.Drawing.Drawing2D.SmoothingMode.HighQuality gr_dest.CompositingQuality = System.Drawing.Drawing2D.CompositingQuality.HighQuality gr_dest.FillRectangle(sb, 0, 0, thumb.Width, thumb.Height) gr_dest.DrawImage(originalImg, 0, 0, thumb.Width, thumb.Height) try originalImg.save(Server.MapPath(upload_dir & upload_original & fileExt), originalImg.rawformat) thumb.save(Server.MapPath(upload_dir & theID & fileExt), originalImg.rawformat) msg = "Uploaded " & fileFld.FileName & " to " & Server.MapPath(upload_dir & upload_original & fileExt) upload_ok = true File.Delete(Server.MapPath(upload_dir & upload_original & fileExt)) catch msg = "Sorry, there was a problem saving your avatar. Please try again." end try if not thumb is nothing then thumb.Dispose() thumb = nothing end if else msg = "That image does not seem to be a JPG. Upload only JPG images." end if catch msg = "That image does not seem to be a JPG." end try end if if not originalImg is nothing then originalImg.Dispose() originalImg = nothing end if end if %><head> <meta http-equiv="pragma" content="no-cache" /> </head> <html> <script type="text/javascript" src="js/jquery-1.3.min.js"></script> <form enctype="multipart/form-data" method="post" runat="server" id="sendImg"> <input type="file" name="upload_file" id="upload_file" style="-moz-opacity: 0; opacity:0; filter: alpha(opacity=0); margin-top: 5px; float:left; cursor:pointer;" onChange="$('#sendImg').submit();" > <input type="submit" value="Upload" style="visibility:hidden; display:none;"> </form> </body> </html> Any help would be great! :o) David

    Read the article

  • Recompile a x86 code with LLVM to some faster one x86

    - by osgx
    Hello Is it possible to run LLVM compiler with input of x86 32bit code? There is a huge algorithm which I have no source code and I want to make it run faster on the same hardware. Can I translate it from x86 back to x86 with optimizations. This Code runs a long time, so I want to do static recompilation of it. Also, I can do a runtime profile of it and give to LLVM hints, which branches are more probable. The original Code is written for x86, and uses no SSE/MMX/SSE2. After recompilation It has a chances to use x86_64 and/or SSE3. Also, The code will be regenerated in more optimal way to hardware decoder. Thanks.

    Read the article

  • jQuery datepicker getMinDate '+1d'

    - by Adrian Adkison
    Once I have set the minDate property of a datepicker with the convenient string syntax $(elem).datepicker('option','minDate','+1d +3m'); how can I get the date object of the minDate? To help illustrate, there is a method $(elem).datepicker('getDate'); which returns the date that is entered in the input in the format of a date object. I would like the same thing but for datepicker('getMinDate'). There is an option like this $(elem).datepicker('option','minDate'); but this returns '+1d +3m' which is not helpful. I need the actual date object to compare with another date object. Any ideas?

    Read the article

  • String search and write into file in jython

    - by kdev
    hi Everyone , i wish to write a program that can read a file and if a particular str_to_find is found in a bigger string say AACATGCCACCTGAATTGGATGGAATTCATGCGGGACACGCGGATTACACCTATGAGCAGAAATACGGCCTGCGCGATTACCGTGGCGGTGGACGTTCTTCCGCGCGTGAAACCGCGATGCGCGTAGCGGCAGGGGCGATCGCCAAGAAATACCTGGCGGAAAAGTTCGGCATCGAAATCCGCGGCTGCCTGACCCAGATGGGCGACATTCCGCTGGAGATTAAAGACTGGCGTCAGGTTGAGCTTAATCCGTTTTC then write that line and the above line of it into the file and keep repeating it for all the match found. Please suggest i have written the program for printing that particular search line but i dont know how to write the above line. Thanks everyone for your help. import re import string file=open('C:/Users/Administrator/Desktop/input.txt','r') output=open('C:/Users/Administrator/Desktop/output.txt','w') count_record=file.readline() str_to_find='AACCATGC' while count_record: if string.find(list,str_to_find) ==0: output.write(count_record) file.close() output.close()

    Read the article

  • JQuery dirtyForm not working on text boxes in ajaxToolkit:TabPanel

    - by dustinson
    I'm a newb to jQ so please forgive my ignorance. I'm using Asa Wilson's plugin jquery.dirtyform.js to prompt a user of unsaved changes before they nav away from a page (ASP.Net C# 3.5). It basically loops through all controls and appends a class and handler to each input. Controls w/i an ajaxToolkit:TabPanel are ignored, unfortunately. I'd appreciate if anyone knows of this type of error and how to resolve it short of manually manipulating each control (as I have this logic in the master page). Thank you.

    Read the article

  • Dynamically generate PDF and email it using django

    - by Shane
    I have a django app that dynamically generates a PDF (using reportlab + pypdf) from user input on an HTML form, and returns the HTTP response with an application/pdf MIMEType. I want to have the option between doing the above, or emailing the generated pdf, but I cannot figure out how to use the EmailMessage class's attach(filename=None, content=None, mimetype=None) method. The documentation doesn't give much of a description of what kind of object content is supposed to be. I've tried a file object and the above application/pdf HTTP response. I currently have a workaround where my view saves a pdf to disk, and then I attach the resulting file to an outgoing email using the attach_file() method. This seems wrong to me, and I'm pretty sure there is a better way.

    Read the article

  • Simplex Noise Help

    - by Alex Larsen
    Im Making A Minecraft Like Gae In XNA C# And I Need To Generate Land With Caves This Is The Code For Simplex I Have /// <summary> /// 1D simplex noise /// </summary> /// <param name="x"></param> /// <returns></returns> public static float Generate(float x) { int i0 = FastFloor(x); int i1 = i0 + 1; float x0 = x - i0; float x1 = x0 - 1.0f; float n0, n1; float t0 = 1.0f - x0 * x0; t0 *= t0; n0 = t0 * t0 * grad(perm[i0 & 0xff], x0); float t1 = 1.0f - x1 * x1; t1 *= t1; n1 = t1 * t1 * grad(perm[i1 & 0xff], x1); // The maximum value of this noise is 8*(3/4)^4 = 2.53125 // A factor of 0.395 scales to fit exactly within [-1,1] return 0.395f * (n0 + n1); } /// <summary> /// 2D simplex noise /// </summary> /// <param name="x"></param> /// <param name="y"></param> /// <returns></returns> public static float Generate(float x, float y) { const float F2 = 0.366025403f; // F2 = 0.5*(sqrt(3.0)-1.0) const float G2 = 0.211324865f; // G2 = (3.0-Math.sqrt(3.0))/6.0 float n0, n1, n2; // Noise contributions from the three corners // Skew the input space to determine which simplex cell we're in float s = (x + y) * F2; // Hairy factor for 2D float xs = x + s; float ys = y + s; int i = FastFloor(xs); int j = FastFloor(ys); float t = (float)(i + j) * G2; float X0 = i - t; // Unskew the cell origin back to (x,y) space float Y0 = j - t; float x0 = x - X0; // The x,y distances from the cell origin float y0 = y - Y0; // For the 2D case, the simplex shape is an equilateral triangle. // Determine which simplex we are in. int i1, j1; // Offsets for second (middle) corner of simplex in (i,j) coords if (x0 > y0) { i1 = 1; j1 = 0; } // lower triangle, XY order: (0,0)->(1,0)->(1,1) else { i1 = 0; j1 = 1; } // upper triangle, YX order: (0,0)->(0,1)->(1,1) // A step of (1,0) in (i,j) means a step of (1-c,-c) in (x,y), and // a step of (0,1) in (i,j) means a step of (-c,1-c) in (x,y), where // c = (3-sqrt(3))/6 float x1 = x0 - i1 + G2; // Offsets for middle corner in (x,y) unskewed coords float y1 = y0 - j1 + G2; float x2 = x0 - 1.0f + 2.0f * G2; // Offsets for last corner in (x,y) unskewed coords float y2 = y0 - 1.0f + 2.0f * G2; // Wrap the integer indices at 256, to avoid indexing perm[] out of bounds int ii = i % 256; int jj = j % 256; // Calculate the contribution from the three corners float t0 = 0.5f - x0 * x0 - y0 * y0; if (t0 < 0.0f) n0 = 0.0f; else { t0 *= t0; n0 = t0 * t0 * grad(perm[ii + perm[jj]], x0, y0); } float t1 = 0.5f - x1 * x1 - y1 * y1; if (t1 < 0.0f) n1 = 0.0f; else { t1 *= t1; n1 = t1 * t1 * grad(perm[ii + i1 + perm[jj + j1]], x1, y1); } float t2 = 0.5f - x2 * x2 - y2 * y2; if (t2 < 0.0f) n2 = 0.0f; else { t2 *= t2; n2 = t2 * t2 * grad(perm[ii + 1 + perm[jj + 1]], x2, y2); } // Add contributions from each corner to get the final noise value. // The result is scaled to return values in the interval [-1,1]. return 40.0f * (n0 + n1 + n2); // TODO: The scale factor is preliminary! } public static float Generate(float x, float y, float z) { // Simple skewing factors for the 3D case const float F3 = 0.333333333f; const float G3 = 0.166666667f; float n0, n1, n2, n3; // Noise contributions from the four corners // Skew the input space to determine which simplex cell we're in float s = (x + y + z) * F3; // Very nice and simple skew factor for 3D float xs = x + s; float ys = y + s; float zs = z + s; int i = FastFloor(xs); int j = FastFloor(ys); int k = FastFloor(zs); float t = (float)(i + j + k) * G3; float X0 = i - t; // Unskew the cell origin back to (x,y,z) space float Y0 = j - t; float Z0 = k - t; float x0 = x - X0; // The x,y,z distances from the cell origin float y0 = y - Y0; float z0 = z - Z0; // For the 3D case, the simplex shape is a slightly irregular tetrahedron. // Determine which simplex we are in. int i1, j1, k1; // Offsets for second corner of simplex in (i,j,k) coords int i2, j2, k2; // Offsets for third corner of simplex in (i,j,k) coords /* This code would benefit from a backport from the GLSL version! */ if (x0 >= y0) { if (y0 >= z0) { i1 = 1; j1 = 0; k1 = 0; i2 = 1; j2 = 1; k2 = 0; } // X Y Z order else if (x0 >= z0) { i1 = 1; j1 = 0; k1 = 0; i2 = 1; j2 = 0; k2 = 1; } // X Z Y order else { i1 = 0; j1 = 0; k1 = 1; i2 = 1; j2 = 0; k2 = 1; } // Z X Y order } else { // x0<y0 if (y0 < z0) { i1 = 0; j1 = 0; k1 = 1; i2 = 0; j2 = 1; k2 = 1; } // Z Y X order else if (x0 < z0) { i1 = 0; j1 = 1; k1 = 0; i2 = 0; j2 = 1; k2 = 1; } // Y Z X order else { i1 = 0; j1 = 1; k1 = 0; i2 = 1; j2 = 1; k2 = 0; } // Y X Z order } // A step of (1,0,0) in (i,j,k) means a step of (1-c,-c,-c) in (x,y,z), // a step of (0,1,0) in (i,j,k) means a step of (-c,1-c,-c) in (x,y,z), and // a step of (0,0,1) in (i,j,k) means a step of (-c,-c,1-c) in (x,y,z), where // c = 1/6. float x1 = x0 - i1 + G3; // Offsets for second corner in (x,y,z) coords float y1 = y0 - j1 + G3; float z1 = z0 - k1 + G3; float x2 = x0 - i2 + 2.0f * G3; // Offsets for third corner in (x,y,z) coords float y2 = y0 - j2 + 2.0f * G3; float z2 = z0 - k2 + 2.0f * G3; float x3 = x0 - 1.0f + 3.0f * G3; // Offsets for last corner in (x,y,z) coords float y3 = y0 - 1.0f + 3.0f * G3; float z3 = z0 - 1.0f + 3.0f * G3; // Wrap the integer indices at 256, to avoid indexing perm[] out of bounds int ii = i % 256; int jj = j % 256; int kk = k % 256; // Calculate the contribution from the four corners float t0 = 0.6f - x0 * x0 - y0 * y0 - z0 * z0; if (t0 < 0.0f) n0 = 0.0f; else { t0 *= t0; n0 = t0 * t0 * grad(perm[ii + perm[jj + perm[kk]]], x0, y0, z0); } float t1 = 0.6f - x1 * x1 - y1 * y1 - z1 * z1; if (t1 < 0.0f) n1 = 0.0f; else { t1 *= t1; n1 = t1 * t1 * grad(perm[ii + i1 + perm[jj + j1 + perm[kk + k1]]], x1, y1, z1); } float t2 = 0.6f - x2 * x2 - y2 * y2 - z2 * z2; if (t2 < 0.0f) n2 = 0.0f; else { t2 *= t2; n2 = t2 * t2 * grad(perm[ii + i2 + perm[jj + j2 + perm[kk + k2]]], x2, y2, z2); } float t3 = 0.6f - x3 * x3 - y3 * y3 - z3 * z3; if (t3 < 0.0f) n3 = 0.0f; else { t3 *= t3; n3 = t3 * t3 * grad(perm[ii + 1 + perm[jj + 1 + perm[kk + 1]]], x3, y3, z3); } // Add contributions from each corner to get the final noise value. // The result is scaled to stay just inside [-1,1] return 32.0f * (n0 + n1 + n2 + n3); // TODO: The scale factor is preliminary! } private static byte[] perm = new byte[512] { 151,160,137,91,90,15, 131,13,201,95,96,53,194,233,7,225,140,36,103,30,69,142,8,99,37,240,21,10,23, 190, 6,148,247,120,234,75,0,26,197,62,94,252,219,203,117,35,11,32,57,177,33, 88,237,149,56,87,174,20,125,136,171,168, 68,175,74,165,71,134,139,48,27,166, 77,146,158,231,83,111,229,122,60,211,133,230,220,105,92,41,55,46,245,40,244, 102,143,54, 65,25,63,161, 1,216,80,73,209,76,132,187,208, 89,18,169,200,196, 135,130,116,188,159,86,164,100,109,198,173,186, 3,64,52,217,226,250,124,123, 5,202,38,147,118,126,255,82,85,212,207,206,59,227,47,16,58,17,182,189,28,42, 223,183,170,213,119,248,152, 2,44,154,163, 70,221,153,101,155,167, 43,172,9, 129,22,39,253, 19,98,108,110,79,113,224,232,178,185, 112,104,218,246,97,228, 251,34,242,193,238,210,144,12,191,179,162,241, 81,51,145,235,249,14,239,107, 49,192,214, 31,181,199,106,157,184, 84,204,176,115,121,50,45,127, 4,150,254, 138,236,205,93,222,114,67,29,24,72,243,141,128,195,78,66,215,61,156,180, 151,160,137,91,90,15, 131,13,201,95,96,53,194,233,7,225,140,36,103,30,69,142,8,99,37,240,21,10,23, 190, 6,148,247,120,234,75,0,26,197,62,94,252,219,203,117,35,11,32,57,177,33, 88,237,149,56,87,174,20,125,136,171,168, 68,175,74,165,71,134,139,48,27,166, 77,146,158,231,83,111,229,122,60,211,133,230,220,105,92,41,55,46,245,40,244, 102,143,54, 65,25,63,161, 1,216,80,73,209,76,132,187,208, 89,18,169,200,196, 135,130,116,188,159,86,164,100,109,198,173,186, 3,64,52,217,226,250,124,123, 5,202,38,147,118,126,255,82,85,212,207,206,59,227,47,16,58,17,182,189,28,42, 223,183,170,213,119,248,152, 2,44,154,163, 70,221,153,101,155,167, 43,172,9, 129,22,39,253, 19,98,108,110,79,113,224,232,178,185, 112,104,218,246,97,228, 251,34,242,193,238,210,144,12,191,179,162,241, 81,51,145,235,249,14,239,107, 49,192,214, 31,181,199,106,157,184, 84,204,176,115,121,50,45,127, 4,150,254, 138,236,205,93,222,114,67,29,24,72,243,141,128,195,78,66,215,61,156,180 }; private static int FastFloor(float x) { return (x > 0) ? ((int)x) : (((int)x) - 1); } private static float grad(int hash, float x) { int h = hash & 15; float grad = 1.0f + (h & 7); // Gradient value 1.0, 2.0, ..., 8.0 if ((h & 8) != 0) grad = -grad; // Set a random sign for the gradient return (grad * x); // Multiply the gradient with the distance } private static float grad(int hash, float x, float y) { int h = hash & 7; // Convert low 3 bits of hash code float u = h < 4 ? x : y; // into 8 simple gradient directions, float v = h < 4 ? y : x; // and compute the dot product with (x,y). return ((h & 1) != 0 ? -u : u) + ((h & 2) != 0 ? -2.0f * v : 2.0f * v); } private static float grad(int hash, float x, float y, float z) { int h = hash & 15; // Convert low 4 bits of hash code into 12 simple float u = h < 8 ? x : y; // gradient directions, and compute dot product. float v = h < 4 ? y : h == 12 || h == 14 ? x : z; // Fix repeats at h = 12 to 15 return ((h & 1) != 0 ? -u : u) + ((h & 2) != 0 ? -v : v); } private static float grad(int hash, float x, float y, float z, float t) { int h = hash & 31; // Convert low 5 bits of hash code into 32 simple float u = h < 24 ? x : y; // gradient directions, and compute dot product. float v = h < 16 ? y : z; float w = h < 8 ? z : t; return ((h & 1) != 0 ? -u : u) + ((h & 2) != 0 ? -v : v) + ((h & 4) != 0 ? -w : w); } This Is My World Generation Code Block[,] BlocksInMap = new Block[1024, 256]; public bool IsWorldGenerated = false; Random r = new Random(); private void RunThread() { for (int BH = 0; BH <= 256; BH++) { for (int BW = 0; BW <= 1024; BW++) { Block b = new Block(); if (BH >= 192) { } BlocksInMap[BW, BH] = b; } } IsWorldGenerated = true; } public void GenWorld() { new Thread(new ThreadStart(RunThread)).Start(); } And This Is A Example Of How I Set Blocks Block b = new Block(); b.BlockType = = Block.BlockTypes.Air; This Is A Example Of How I Set Models foreach (Block b in MyWorld) { switch(b.BlockType) { case Block.BlockTypes.Dirt: b.Model = DirtModel; break; ect. } } How Would I Use These To Generate To World (The Block Array) And If Possible Thread It More? btw It's 1024 Wide And 256 Tall

    Read the article

  • Sign Up form text shows white with a white background

    - by Rob
    I have a signup form on a website that I am developing using dreamweaver. The input text and background text are both showing as white (or not showing!) even though the page text is set at #0000CC. See it here: www.betterlifecoaching.co.uk (it is still work in progress) How can I overcome this? The sign up script is: .link, SignUp .signupframe { color: #0033CC; font-family: Arial, Helvetica, sans-serif; } .link { text-decoration: none; } #SignUp .signupframe { border: 1px solid #282FFF; background: #ABB4BA; } Email Marketing You Can Trust many thanks Rob

    Read the article

  • Regex for circular replacement

    - by polygenelubricants
    How would you use regex to write functions to do the following: Replace lowercase 'a' with uppercase and vice versa Where words are separated by whitespaces and > and < are special markers, replace >word with word< and vice versa Replace postincrement (i++;) with preincrement (++i;) and vice versa. Variable names are [a-z]+. Input is just a bunch of these statements. Bonus: also do decrement. Also interested in solutions in other flavors. Note: this is NOT a homework question. See also my previous explorations of regex: Regex split into overlapping strings (Alan Moore's answer is especially instructive) Can you use zero-width matching regex in String split? (my solution exploits a known Java regex bug with regards to non-obvious length lookbehind!)

    Read the article

  • How to void authorized transaction in authorize.net gateway using ActiveMerchant

    - by m7d
    Goal: Only have successful purchases show up on a customer's billing statement. I don't want declined authorizations showing up on their billing statement (as seen in an online banking system) as pending. A customer often will accidentally input an incorrect billing address, for example, followed by a correct one. Together, the two attempts, one successful and one not both show up on their billing statement as pending prior to settlement. This can scare the customer as it looks potentially like they will be charged twice. Details: When I do an AUTH_CAPTURE (via ActiveMerchant's purchase) or an AUTH (via ActiveMerchant's authorize) which is declined and subsequently want to void that authorization (via ActiveMerchant's void) so as not to have it appear on a customer's billing statement as pending (even though it will settle out after a few days), the gateway can't find the transaction to void using the authorization code returned from the authorization or capture method calls on the gateway. This is specific to the authorize.net AIM gateway. Please advise. Thanks!

    Read the article

< Previous Page | 794 795 796 797 798 799 800 801 802 803 804 805  | Next Page >