Search Results

Search found 3436 results on 138 pages for 'math grad'.

Page 80/138 | < Previous Page | 76 77 78 79 80 81 82 83 84 85 86 87  | Next Page >

  • How to determine which enemy is hit and destroy it alone

    - by Jon Ferriter
    http://jsfiddle.net/5DB6K/ I have this game being made where you shoot enemies from the sides of the screen. I've got the bullets moving and being removed when they reach the end of the screen (if they didn't hit any enemy) and removing the enemy when they collide with it. //------------collision----------------// if(shot === true){ bulletY = $('.bullet').position().top + 2; bulletX = $('.bullet').position().left + 2; $('.enemy').each(function(){ if($('.enemy').hasClass('smallEnemy')){ enemyY = $(this).position().top + 7; enemyX = $(this).position().left + 7; if(Math.abs(bulletY - enemyY) <= 9 && Math.abs(bulletX - enemyX) <=9){ $(this).remove(); score = score + 40; bulletDestroy(); } } }); } However, the bullet destroys every enemy if the collision check is right which isn't what I want. I want to check if the enemy has the class of either smallEnemy, medEnemy, or lrgEnemy and then do the collision check which is what I thought I had but it doesn't seem to work. Also, the game starts to lag the more and more time goes on. Would anyone know the reason for that?

    Read the article

  • How to ensure I get the picture is complete? (in java)

    - by Zenofo
    i using below code to get a picture from URL: URL url=new URL("http://www.google.com/images/logos/ps_logo2.png"); InputStream in=url.openStream(); ByteArrayOutputStream tmpOut = new ByteArrayOutputStream(); byte[] buf = new byte[512]; int len; while (true) { len = in.read(buf); if (len == -1) { break; } tmpOut.write(buf, 0, len); } tmpOut.close(); byte[] picture=tmpOut.toByteArray(); System.out.println(picture.length); this code is okay,but my internet connect is very very bad, so ,I maybe get a broken picture like this: How can I ensure the picture file is complete ? I think you can add this code to try and test this: if (len == -1) { change to if (len == -1 || (int)(Math.random()*100)==1 ) { full test code: URL url=new URL("http://www.google.com/images/logos/ps_logo2.png"); InputStream in=url.openStream(); ByteArrayOutputStream tmpOut = new ByteArrayOutputStream(); byte[] buf = new byte[512]; int len; while (true) { len = in.read(buf); if (len == -1 || (int)(Math.random()*100)==1 ) { break; } tmpOut.write(buf, 0, len); } tmpOut.close(); byte[] picture =tmpOut.toByteArray(); System.out.println(picture.length); thanks for help :)

    Read the article

  • Should I Teach My Son Programming? What approaches should I take? [closed]

    - by DaveDev
    I was wondering if it's a good idea to teach object oriented programming to my son? I was never really good at math as a kid, but I think since I've started programming it's given me a greater ability to understand math by being better able to visualise relationships between abstract models. I thought it might give him a better advantage in learning & applying logical & mathematical concepts throughout his life if he was able to take advantage of the tools available to programmers. what would be the best programming fields, techniques and/or concepts? What approach should I take? what concepts should I avoid? what fields of mathematics would he find this benfits him most? He's only 2 now so it wouldn't be for another few years before I do this, (and even at that, only from a very high level point of view). I thought I'd put it to the programming community and see what you guys thought? Possible Duplicate: What are some recommended programming resources for pre-teens?

    Read the article

  • How do I make my page respect h1 css addition? [migrated]

    - by Adobe
    I add h1 { margin-top:100px; } to the end of the css, but the page doesn't change. But if I add to the html of some h1: <h1 style="margin-top:100px;"><a class="toc-backref" href="#id4">KHotKeys</a><a class="headerlink" href="#khotkeys" title="Permalink to this headline">¶</a></h1> Then it does. I'm not css pro, and I guess the problem is somewhere in the css file. Here it is: div.clearer { clear: both; } /* -- relbar ---------------------------------------------------------------- */ div.related { width: 100%; font-size: 90%; } div.related h3 { display: none; } div.related ul { margin: 0; padding: 0 0 0 10px; list-style: none; } div.related li { display: inline; } div.related li.right { float: right; margin-right: 5px; } /* -- sidebar --------------------------------------------------------------- */ div.sphinxsidebarwrapper { padding: 10px 5px 0 10px; } div.sphinxsidebar { float: left; width: 230px; margin-left: -100%; font-size: 90%; } div.sphinxsidebar ul { list-style: none; } div.sphinxsidebar ul ul, div.sphinxsidebar ul.want-points { margin-left: 20px; list-style: square; } div.sphinxsidebar ul ul { margin-top: 0; margin-bottom: 0; } div.sphinxsidebar form { margin-top: 10px; } div.sphinxsidebar input { border: 1px solid #98dbcc; font-family: sans-serif; font-size: 1em; } div.sphinxsidebar input[type="text"] { width: 160px; } div.sphinxsidebar input[type="submit"] { width: 30px; } img { border: 0; } /* -- search page ----------------------------------------------------------- */ ul.search { margin: 10px 0 0 20px; padding: 0; } ul.search li { padding: 5px 0 5px 20px; background-image: url(file.png); background-repeat: no-repeat; background-position: 0 7px; } ul.search li a { font-weight: bold; } ul.search li div.context { color: #888; margin: 2px 0 0 30px; text-align: left; } ul.keywordmatches li.goodmatch a { font-weight: bold; } /* -- index page ------------------------------------------------------------ */ table.contentstable { width: 90%; } table.contentstable p.biglink { line-height: 150%; } a.biglink { font-size: 1.3em; } span.linkdescr { font-style: italic; padding-top: 5px; font-size: 90%; } /* -- general index --------------------------------------------------------- */ table.indextable { width: 100%; } table.indextable td { text-align: left; vertical-align: top; } table.indextable dl, table.indextable dd { margin-top: 0; margin-bottom: 0; } table.indextable tr.pcap { height: 10px; } table.indextable tr.cap { margin-top: 10px; background-color: #f2f2f2; } img.toggler { margin-right: 3px; margin-top: 3px; cursor: pointer; } div.modindex-jumpbox { border-top: 1px solid #ddd; border-bottom: 1px solid #ddd; margin: 1em 0 1em 0; padding: 0.4em; } div.genindex-jumpbox { border-top: 1px solid #ddd; border-bottom: 1px solid #ddd; margin: 1em 0 1em 0; padding: 0.4em; } /* -- general body styles --------------------------------------------------- */ a.headerlink { visibility: hidden; } h1:hover > a.headerlink, h2:hover > a.headerlink, h3:hover > a.headerlink, h4:hover > a.headerlink, h5:hover > a.headerlink, h6:hover > a.headerlink, dt:hover > a.headerlink { visibility: visible; } div.body p.caption { text-align: inherit; } div.body td { text-align: left; } .field-list ul { padding-left: 1em; } .first { margin-top: 0 !important; } p.rubric { margin-top: 30px; font-weight: bold; } img.align-left, .figure.align-left, object.align-left { clear: left; float: left; margin-right: 1em; } img.align-right, .figure.align-right, object.align-right { clear: right; float: right; margin-left: 1em; } img.align-center, .figure.align-center, object.align-center { display: block; margin-left: auto; margin-right: auto; } .align-left { text-align: left; } .align-center { text-align: center; } .align-right { text-align: right; } /* -- sidebars -------------------------------------------------------------- */ div.sidebar { margin: 0 0 0.5em 1em; border: 1px solid #ddb; padding: 7px 7px 0 7px; background-color: #ffe; width: 40%; float: right; } p.sidebar-title { font-weight: bold; } /* -- topics ---------------------------------------------------------------- */ div.topic { border: 1px solid #ccc; padding: 7px 7px 0 7px; margin: 10px 0 10px 0; } p.topic-title { font-size: 1.1em; font-weight: bold; margin-top: 10px; } /* -- admonitions ----------------------------------------------------------- */ div.admonition { margin-top: 10px; margin-bottom: 10px; padding: 7px; } div.admonition dt { font-weight: bold; } div.admonition dl { margin-bottom: 0; } p.admonition-title { margin: 0px 10px 5px 0px; font-weight: bold; } div.body p.centered { text-align: center; margin-top: 25px; } /* -- tables ---------------------------------------------------------------- */ table.docutils { border: 0; border-collapse: collapse; } table.docutils td, table.docutils th { padding: 1px 8px 1px 5px; border-top: 0; border-left: 0; border-right: 0; border-bottom: 1px solid #aaa; } table.field-list td, table.field-list th { border: 0 !important; } table.footnote td, table.footnote th { border: 0 !important; } th { text-align: left; padding-right: 5px; } table.citation { border-left: solid 1px gray; margin-left: 1px; } table.citation td { border-bottom: none; } /* -- other body styles ----------------------------------------------------- */ ol.arabic { list-style: decimal; } ol.loweralpha { list-style: lower-alpha; } ol.upperalpha { list-style: upper-alpha; } ol.lowerroman { list-style: lower-roman; } ol.upperroman { list-style: upper-roman; } dl { margin-bottom: 15px; } dd p { margin-top: 0px; } dd ul, dd table { margin-bottom: 10px; } dd { margin-top: 3px; margin-bottom: 10px; margin-left: 30px; } dt:target, .highlighted { background-color: #fbe54e; } dl.glossary dt { font-weight: bold; font-size: 1.1em; } .field-list ul { margin: 0; padding-left: 1em; } .field-list p { margin: 0; } .refcount { color: #060; } .optional { font-size: 1.3em; } .versionmodified { font-style: italic; } .system-message { background-color: #fda; padding: 5px; border: 3px solid red; } .footnote:target { background-color: #ffa; } .line-block { display: block; margin-top: 1em; margin-bottom: 1em; } .line-block .line-block { margin-top: 0; margin-bottom: 0; margin-left: 1.5em; } .guilabel, .menuselection { font-family: sans-serif; } .accelerator { text-decoration: underline; } .classifier { font-style: oblique; } /* -- code displays --------------------------------------------------------- */ pre { overflow: auto; overflow-y: hidden; /* fixes display issues on Chrome browsers */ } td.linenos pre { padding: 5px 0px; border: 0; background-color: transparent; color: #aaa; } table.highlighttable { margin-left: 0.5em; } table.highlighttable td { padding: 0 0.5em 0 0.5em; } tt.descname { background-color: transparent; font-weight: bold; font-size: 1.2em; } tt.descclassname { background-color: transparent; } tt.xref, a tt { background-color: transparent; font-weight: bold; } h1 tt, h2 tt, h3 tt, h4 tt, h5 tt, h6 tt { background-color: transparent; } .viewcode-link { float: right; } .viewcode-back { float: right; font-family: sans-serif; } div.viewcode-block:target { margin: -1px -10px; padding: 0 10px; } /* -- math display ---------------------------------------------------------- */ img.math { vertical-align: middle; } div.body div.math p { text-align: center; } span.eqno { float: right; } /* -- printout stylesheet --------------------------------------------------- */ @media print { div.document, div.documentwrapper, div.bodywrapper { margin: 0 !important; width: 100%; } div.sphinxsidebar, div.related, div.footer, #top-link { display: none; } } body { font-family: sans-serif; font-size: 100%; background-color: #11303d; color: #000; margin: 0; padding: 0; } div.document { background-color: #d4e9f7; } div.documentwrapper { float: left; width: 100%; } div.bodywrapper { margin: 0 0 0 230px; } div.body { background-color: #ffffff; color: #222222; padding: 0 20px 30px 20px; } div.footer { color: #ffffff; width: 100%; padding: 9px 0 9px 0; text-align: center; font-size: 75%; } div.footer a { color: #ffffff; text-decoration: underline; } div.related { background-color: #191a19; line-height: 30px; color: #ffffff; } div.related a { color: #ffffff; } div.sphinxsidebar { top: 30px; bottom: 60px; margin: 0; position: fixed; overflow: auto; height: auto; } div.sphinxsidebar h3 { font-family: 'Trebuchet MS', sans-serif; color: #3a3a3a; font-size: 1.4em; font-weight: normal; margin: 0; padding: 0; } div.sphinxsidebar h3 a { color: #3a3a3a; } div.sphinxsidebar h4 { font-family: 'Trebuchet MS', sans-serif; color: #3a3a3a; font-size: 1.3em; font-weight: normal; margin: 5px 0 0 0; padding: 0; } div.sphinxsidebar p { color: #3a3a3a; } div.sphinxsidebar p.topless { margin: 5px 10px 10px 10px; } div.sphinxsidebar ul { margin: 10px; padding: 0; color: #3a3a3a; } div.sphinxsidebar ul li { margin-top: .2em; } div.sphinxsidebar a { color: #3a8942; } div.sphinxsidebar input { border: 1px solid #3a8942; font-family: sans-serif; font-size: 1em; } /* -- body styles ----------------------------------------------------------- */ a { color: #355f7c; text-decoration: none; } a:hover { text-decoration: underline; } div.body p, div.body dd, div.body li { text-align: left; line-height: 130%; margin-top: 0px; margin-bottom: 0px; } div.body h1, div.body h2, div.body h3, div.body h4, div.body h5, div.body h6 { font-family: 'Trebuchet MS', sans-serif; background-color: #f2f2f2; font-weight: normal; color: #20435c; border-top: 2px solid #cccccc; border-bottom: 1px solid #cccccc; margin: 30px -20px 20px -20px; padding: 3px 0 3px 10px; } div.body h1 { margin-top: 0; font-size: 200%; } div.body h2 { font-size: 160%; } div.body h3 { font-size: 140%; padding-left: 20px; } div.body h4 { font-size: 120%; padding-left: 20px; } div.body h5 { font-size: 110%; padding-left: 20px; } div.body h6 { font-size: 100%; padding-left: 20px; } a.headerlink { color: #c60f0f; font-size: 0.8em; padding: 0 4px 0 4px; text-decoration: none; } a.headerlink:hover { background-color: #c60f0f; color: white; } div.body p, div.body dd, div.body li { text-align: left; line-height: 110%; } div.admonition p.admonition-title + p { display: inline; } div.note { background-color: #eee; border: 1px solid #ccc; } div.seealso { background-color: #ffc; border: 1px solid #ff6; } div.topic { background-color: #eee; } div.warning { background-color: #ffe4e4; border: 1px solid #f66; } p.admonition-title { display: inline; } p.admonition-title:after { content: ":"; } pre { padding: 0px; background-color: #ffffff; color: #000000; line-height: 120%; border: 0px solid #ffffff; border-left: none; border-right: none; white-space: pre-wrap; /* word-wrap: break-word; */ /* width:100px; */ } tt { background-color: #ecf0f3; padding: 0 1px 0 1px; font-size: 110%; } .warning tt { background: #efc2c2; } .note tt { background: #d6d6d6; } body { width:150%; }

    Read the article

  • CodePlex Daily Summary for Thursday, August 01, 2013

    CodePlex Daily Summary for Thursday, August 01, 2013Popular ReleasesmyCollections: Version 2.7.11.0: New in this version : Added Copy To functionality (useful if you have NAS or media player). You can now use you web cam to scan UPC Code or take picture for cover. Added Persian Language Improved Ukrainian Translation Improved Pdf export Improved Cover Flow Improved TMDB Information. Improved Zappiti and Dune player compatibility Improved GameDB provider. Fix IMDB provider. Fix issue with rating BugFixing and performance improvement.wsubi: wsubi-1.6: Enhancements included in this release: Implement issue #6 - Add a 'query' Command for .sql scripts You can now run T-SQL scripts with the application. Results can be out for review to the console or saved to a file. For more details on running queries, check the updated Documentation page.SuperSocket, an extensible socket application framework: SuperSocket 1.6 beta 2: The changes included in this release: introduced ServerManager improved the code about process level isolation added new configuration attribute "storeLocation" for the certificate node added sendTimeOut support for async sending fixed a bug that when you close a session, the data is being sent won't be sent suppressed the socket error 10060 fixed the default clear idle session parameters in the config model class added configuration section detecting and give proper exception ...GoAgent GUI: GoAgent GUI 1.4.0: ??????????: Windows XP SP3 Windows Vista SP1 Windows 7 Windows 8 Windows 8.1 ??Windows 8.1???????????? ????: .Net Framework 4.0 http://59.111.20.19/download/17718/33240761/4/exe/69/54/177181/dotNetFx40Fullx86x64.exe Microsoft Visual C++ 2010 Redistributable Package http://59.111.20.23/download/4894298/8555584/1/exe/28/176/1348305610524944/vcredistx86.exe ???????????????。 ?????Windows XP?Windows 7????,???????????,?issue??????。uygw@outlook.comMVC Generator: MVC Generator Visual Studio Addin: This is the latest build, this includes the MVCGenerator.dll, and Visual Studio Addin file. See the home page of this project for installation instructions.nopCommerce. Open source shopping cart (ASP.NET MVC): nopCommerce 3.10: Highlight features & improvements: • Performance optimization. • New more user-friendly product/product-variant logic. Now we'll have only products (simple and grouped). • Bundle products support added. • Allow a store owner to associate product image for product variant attribute values. To see the full list of fixes and changes please visit the release notes page (http://www.nopCommerce.com/releasenotes.aspx).ExtJS based ASP.NET Controls: FineUI v3.3.1: ??FineUI ?? ExtJS ??? ASP.NET ???。 FineUI??? ?? No JavaScript,No CSS,No UpdatePanel,No ViewState,No WebServices ???????。 ?????? IE 7.0、Firefox 3.6、Chrome 3.0、Opera 10.5、Safari 3.0+ ???? Apache License v2.0 ?:ExtJS ?? GPL v3 ?????(http://www.sencha.com/license)。 ???? ??:http://fineui.com/bbs/ ??:http://fineui.com/demo/ ??:http://fineui.com/doc/ ??:http://fineui.codeplex.com/ FineUI ???? ExtJS ????????,???? ExtJS ?,???????????ExtJS?: 1. ????? FineUI ? ExtJS ?:http://fineui.com/bbs/fo...AutoNLayered - Domain Oriented N-Layered .NET 4.5: AutoNLayered v1.0.5: - Fix Dtos. Abstract collections replaced by concrete (correct serialization WCF). - OrderBy in navigation properties. - Unit Test with Fakes. - Map of entities/dto moved to application services. - Libraries updated. Warning using Fakes: http://connect.microsoft.com/VisualStudio/feedback/details/782031/visual-studio-2012-add-fakes-assembly-does-not-add-all-needed-referencesPath Copy Copy: 11.1: Minor release with two new features: Submenu's contextual menu item now has an icon next to it Added reference to JavaScript regular expression format in Settings application Since this release does not have any glaring bug fixes, it is more of an optional update for existing users. It depends on whether you want to be able to spot the Path Copy Copy submenu more easily. I recommend you install it to see if the icon makes sense. As always, please don't hesitate to leave feedback via Discus...Lib.Web.Mvc & Yet another developer blog: Lib.Web.Mvc 6.3.0: Lib.Web.Mvc is a library which contains some helper classes for ASP.NET MVC such as strongly typed jqGrid helper, XSL transformation HtmlHelper/ActionResult, FileResult with range request support, custom attributes and more. Release contains: Lib.Web.Mvc.dll with xml documentation file Standalone documentation in chm file and change log Library source code Sample application for strongly typed jqGrid helper is available here. Sample application for XSL transformation HtmlHelper/ActionRe...Media Companion: Media Companion MC3.574b: Some good bug fixes been going on with the new XBMC-Link function. Thanks to all who were able to do testing and gave feedback. New:* Added some adhoc extra General movie filters, one of which is Plot = Outline (see fixes above). To see the filters, add the following line to your config.xml: <ShowExtraMovieFilters>True</ShowExtraMovieFilters>. The others are: Imdb in folder name, Imdb in not folder name & Imdb not in folder name & year mismatch. * Movie - display <tag> list on browser tab ...OfflineBrowser: Preview Release with Search: I've added search to this release.VG-Ripper & PG-Ripper: VG-Ripper 2.9.46: changes FIXED LoginFIM 2010 GoogleApps MA: GoogleAppsMA1.1.2: Fixed bug during import. - Fixed following bug. - In some condition, 'dn is missing' error occur.Install Verify Tool: Install Verify Tool V 1.0 With Client: Use a windows service to do a remote validation work. QA can use this tool to verify daily build installation.C# Intellisense for Notepad++: 'Namespace resolution' release: Auto-Completion from "empty spot" Add missing "using" statementsOpen Source Job board: Version X3: Full version of job board, didn't have monies to fund it so it's free.DSeX DragonSpeak eXtended Editor: Version 1.0.116.0726: Cleaned up Wizard Interface Added Functionality for RTF UndoRedo IE Inserting Text from Wizard output to the Tabbed Editor Added Sanity Checks to Search/Replace Dialog to prevent crashes Fixed Template and Paste undoredo Fix Undoredo Blank spots Added New_FileTag Const = "(New FIle)" Added Filename to Modified FileClose queries (Thanks Lothus Marque)Math.NET Numerics: Math.NET Numerics v2.6.0: What's New in Math.NET Numerics 2.6 - Announcement, Explanations and Sample Code. New: Linear Curve Fitting Linear least-squares fitting (regression) to lines, polynomials and linear combinations of arbitrary functions. Multi-dimensional fitting. Also works well in F# with the F# extensions. New: Root Finding Brent's method. ~Candy Chiu, Alexander Täschner Bisection method. ~Scott Stephens, Alexander Täschner Broyden's method, for multi-dimensional functions. ~Alexander Täschner ...mojoPortal: 2.3.9.8: see release notes on mojoportal.com https://www.mojoportal.com/mojoportal-2398-released Note that we have separate deployment packages for .NET 3.5 and .NET 4.0, but we recommend you to use .NET 4 with either .NET 4 or ideally .NET 4.5 hosting, we will probably drop support for .NET 3.5 in the near future. The deployment package downloads on this page are pre-compiled and ready for production deployment, they contain no C# source code and are not intended for use in Visual Studio. To downl...New Projects.NET Micro Framework for STM32F4 with GCC support: The project adds GCC compiler support to .NET Micro Framework code for the STM32F4 family of ARM Cortex-based MCUs originally created by Oberon microsystems.AD Group Comparison Tool: This tool scans Active Directory for groups with matching or empty membership lists, identifying redundant groups that can possibly be eliminated.AdvGenWebRSSReader: This project is to build a portal to manage the rss feed.Best Framework: Using This framework most of .net functions that needs a lot of code writing became available almost in 1 line(s) of code. CargoOnLine: ????????cRumble Framework: C# Reporting Framework for support different technologies and a uncoupled reports.DbDataSource: DbDataSource is a ASP.NET WebForms DataSource control for simple use with EntityFramework CodeFirst.Excel Powershell Library: ExcelPSLib is a PowerShell Module that allows easy creation of XLSX file by using the EPPlus 3.1 .Net LibraryGenProj, a tool for automatic maintenance of Visual Studio .csproj files: Creates a .csproj by scanning folders for files and injecting XML into a previously created .csproj template. Uses a configuration file to control behavior.HLSLBuild: fxc integration for MSBuild and Visual Studio.HotelManagerByHuaibao: Here is a hotel management system on developing.ItemMover ..:: I Like SharePoint ::..: The ItemMover offers your users the ability to move list items between any folder from content type “Folder Content Types”. JadeTours: This is the website for JadeToursNaughty Dog Texture Viewer: A simple program that can view textures inside .pak files from games like The Last of Us and Uncharted series.Number Guessing Game: This is my version of the number guessing game. The computer will generate a number between 1-20 and the goal is to guess that number.prakark07312013Git01: *bold* _italics_ +underline+ ! Heading 1 !! Heading 2 * Bullet List ** Bullet List 2 # Number List ## Number List 2 [another wiki page] [url:http://www.example.prakark07312013Hg01: https://ajaxcontroltoolkit.codeplex.com/workitem/list/basicprakark07312013TFS01: *bold* _italics_ +underline+ ! Heading 1 !! Heading 2 * Bullet List ** Bullet List 2 # Number List ## Number List 2 [another wiki page] [url:http://www.example.PythonCode: Some python code.S1ToKindle: send s1 post to kindleSAML2: An implementation of the SAML 2 specification for .NET.SAML2.Logging.CommonLogging: A logging provider for SAML2 based on Common.Logging.SAML2.Logging.Log4Net: A logging provider for SAML2 based on Log4Net.SAML2.Profiles.DKSAML20: Extension profile for SAML2 which provides OASIS SAML 2.0 validation for the DK specification.SharePoint 2010 Export User Information to Text file, SQL server: This project will help you to export general information about uses from sharepoint 2010 to text file, which you can export into any other database like SQLtestdd07312013git: ftestdd07312013tfs: hjVarian Developers Forum: This project supports Varian collaborators and customers in their work with Varian Medical Systems public APIs.vb??????: vb??????Vinyl: Vinyl is a way to electronically keep track of your record collection.Visual Basic Web Browser: Web browser in visual basicWorkerHourManager: hour managment system,ASP,.NET,college

    Read the article

  • How employable am I as a programmer?

    - by dsimcha
    I'm currently a Ph.D. student in Biomedical Engineering with a concentration in computational biology and am starting to think about what I want to do after graduate school. I feel like I've accumulated a lot of programming skills while in grad school, but taken a very non-traditional path to learning all this stuff. I'm wondering whether I would have an easy time getting hired as a programmer and could fall back on that if I can't find a good job directly in my field, and if so whether I would qualify for a more prestigious position than "code monkey". Things I Have Going For Me Approximately 4 years of experience programming as part of my research. I believe I have a solid enough grasp of the fundamentals that I could pick up new languages and technologies pretty fast, and could demonstrate this in an interview. Good math and statistics skills. An extensive portfolio of open source work (and the knowledge that working on these projects implies): I wrote a statistics library in D, mostly from scratch. I wrote a parallelism library (parallel map, reduce, foreach, task parallelism, pipelining, etc.) that is currently in review for adoption by the D standard library. I wrote a 2D plotting library for D against the GTK Cairo backend. I currently use it for most of the figures I make for my research. I've contributed several major performance optimizations to the D garbage collector. (Most of these were low-hanging fruit, but it still shows my knowledge of low-level issues like memory management, pointers and bit twiddling.) I've contributed lots of miscellaneous bug fixes to the D standard library and could show the change logs to prove it. (This demonstrates my ability read other people's code.) Things I Have Going Against Me Most of my programming experience is in D and Python. I have very little to virtually no experience in the more established, "enterprise-y" languages like Java, C# and C++, though I have learned a decent amount about these languages from small, one-off projects and discussions about language design in the D community. In general I have absolutely no knowledge of "enterprise-y" technlogies. I've never used a framework before, possibly because most reusable code for scientific work and for D tends to call itself a "library" instead. I have virtually no formal computer science/software engineering training. Almost all of my knowledge comes from talking to programming geek friends, reading blogs, forums, StackOverflow, etc. I have zero professional experience with the official title of "developer", "software engineer", or something similar.

    Read the article

  • What books would I recommend?

    - by user12277104
    One of my mentees (I have three right now) said he had some time on his hands this Summer and was looking for good UX books to read ... I sigh heavily, because there is no shortage of good UX books to read. My bookshelves have titles by well-read authors like Nielsen, Norman, Tufte, Dumas, Krug, Gladwell, Pink, Csikszentmihalyi, and Roam. I have titles buy lesser-known authors, many whom I call friends, and many others whom I'll likely never meet. I have books on Excel pivot tables, typography, mental models, culture, accessibility, surveys, checklists, prototyping, Agile, Java, sketching, project management, HTML, negotiation, statistics, user research methods, six sigma, usability guidelines, dashboards, the effects of aging on cognition, UI design, and learning styles, among others ... many others. So I feel the need to qualify any book recommendations with "it depends ...", because it depends on who I'm talking to, and what they are looking for.  It's probably best that I also mention that the views expressed in this blog are mine, and may not necessarily reflect the views of Oracle. There. I'm glad I got that off my chest. For that mentee, who will be graduating with his MS HFID + MBA from Bentley in the Fall, I'll recommend this book: Universal Principles of Design -- this is a great book, which in its first edition held "100  ways to enhance usability, influence perception, increase appeal, make better design decisions, and teach through design." Granted, the second edition expanded that number to 125, but when I first found this book, I felt like I'd discovered the Grail. Its research-based principles are all laid out in 2 pages each, with lots of pictures and good references. A must-have for the new grad. Do I have recommendations for a book that will teach you how to conduct a usability test? Yes, three of them. To communicate what we do to management? Yes. To create personas? Yep -- two or three. Help you with UX in an Agile environment? You bet, I've got two I'd recommend. Create an excellent presentation? Uh hunh. Get buy-in from your team? Of course. There are a plethora of excellent UX books out there. But which ones I recommend ... well ... it depends. 

    Read the article

  • Why is user asked to choose their workgroup?

    - by Clinton Blackmore
    We running Mac OS X Server 10.5.8 with Mac OS X 10.5.8 clients. Students use network logins to, well, log in. I've been asked to deny internet access to a specific user. I was told that a good way to do it is to create a user workgroup called "No Internet Access" and manage settings there. (Specifically, I told parental controls to allow access to no sites, and blacklisted all the installed web browsers). Now, when the user authenticates to log in, they are greeted with this dialog: Workgroups for <username> Grade 7 Students No Internet Access It is unlikely that the student would willing choose "No Internet Access" to be their base group. Looking in Workgroup Manager at the student's record, it shows their primary group ID is the grade 7 group, and "No Internet Access" is listed as another group they belong to. I looked at the managed preferences for all the computers pertaining to logins. They are set to their defaults. Specifically, the computer groups' preference for Logins - Access has the defaults: [unchecked] Ignore workgroup nesting [checked] Combine available workgroup settings Based on my reading of Tips and Tricks for Mac Administrators, this should be correct, the user should not be asked which group they belong to, and settings from all applicable groups should be applied. How can I achieve that result? Edit: I've decided to add some additional information from the Tips and Tricks for Mac Management White Paper (via Apple in Education, via the author's site). On page 21, it says: With Leopard MCX, workgroup preference settings are combined by default into a single set of values. This means that instead of having to choose between the Math, Science, or Language Arts workgroups when logging in, a user can just authenticate and be taken directly to the desktop. All the settings for each of those workgroups are composited together, providing you with all the Dock items and a composite of all the other settings. On page 40, an example is given in which settings are combined from different 'domains', one computer group, two (user) workgroups, and one individual user's settings. [When johnd logs into a leopard client,] the items staged in the Dock from left to right are: computer group, first workgroup alphabetically, second workgroup, user. Items within the workgroup are staged alphabetically. Nowhere is there an indication that groups are nested; indeed, I can see no sensible (non-flat) heirarchy for groups like Math, Science, and Language Arts. I strongly believe that there is a way to apply settings from two unrelated user workgroups such that a user of OS X 10.5.x or newer does not need to choose their workgroup. This is what I seek to achieve.

    Read the article

  • Scientific notation in Excel

    - by Vojtech R.
    Hi, I need make Number Format like scientific notation, but without E nor e. Just classic like this: (In latex its 2.3\times10^3) Maybe excel doesn't support this format. (I have on mind Number Format - for hundreds numbers - not in math formula)

    Read the article

  • Help understanding some OpenGL stuff

    - by shinjuo
    I am working with some code to create a triangle that moves with arrow keys. I want to create a second object that moves independently. This is where I am having trouble, I have created the second actor, but cannot get it to move. There is too much code to post it all so I will just post a little and see if anyone can help at all. ogl_test.cpp #include "platform.h" #include "srt/scheduler.h" #include "model.h" #include "controller.h" #include "model_module.h" #include "graphics_module.h" class blob : public actor { public: blob(float x, float y) : actor(math::vector2f(x, y)) { } void render() { transform(); glBegin(GL_TRIANGLES); glVertex3f(0.25f, 0.0f, -5.0f); glVertex3f(-.5f, 0.25f, -5.0f); glVertex3f(-.5f, -0.25f, -5.0f); glEnd(); end_transform(); } void update(controller& c, float dt) { if (c.left_key) { rho += pi / 9.0f * dt; c.left_key = false; } if (c.right_key) { rho -= pi / 9.0f * dt; c.right_key = false; } if (c.up_key) { v += .1f * dt; c.up_key = false; } if (c.down_key) { v -= .1f * dt; if (v < 0.0) { v = 0.0; } c.down_key = false; } actor::update(c, dt); } }; class enemyOne : public actor { public: enemyOne(float x, float y) : actor(math::vector2f(x, y)) { } void render() { transform(); glBegin(GL_TRIANGLES); glVertex3f(0.25f, 0.0f, -5.0f); glVertex3f(-.5f, 0.25f, -5.0f); glVertex3f(-.5f, -0.25f, -5.0f); glEnd(); end_transform(); } void update(controller& c, float dt) { if (c.left_key) { rho += pi / 9.0f * dt; c.left_key = false; } if (c.right_key) { rho -= pi / 9.0f * dt; c.right_key = false; } if (c.up_key) { v += .1f * dt; c.up_key = false; } if (c.down_key) { v -= .1f * dt; if (v < 0.0) { v = 0.0; } c.down_key = false; } actor::update(c, dt); } }; int APIENTRY WinMain( HINSTANCE hInstance, HINSTANCE hPrevInstance, char* lpCmdLine, int nCmdShow ) { model m; controller control(m); srt::scheduler scheduler(33); srt::frame* model_frame = new srt::frame(scheduler.timer(), 0, 1, 2); srt::frame* render_frame = new srt::frame(scheduler.timer(), 1, 1, 2); model_frame->add(new model_module(m, control)); render_frame->add(new graphics_module(m)); scheduler.add(model_frame); scheduler.add(render_frame); blob* prime = new blob(0.0f, 0.0f); m.add(prime); m.set_prime(prime); enemyOne* primeTwo = new enemyOne(2.0f, 0.0f); m.add(primeTwo); m.set_prime(primeTwo); scheduler.start(); control.start(); return 0; } model.h #include <vector> #include "vec.h" const double pi = 3.14159265358979323; class controller; using math::vector2f; class actor { public: vector2f P; float theta; float v; float rho; actor(const vector2f& init_location) : P(init_location), rho(0.0), v(0.0), theta(0.0) { } virtual void render() = 0; virtual void update(controller&, float dt) { float v1 = v; float theta1 = theta + rho * dt; vector2f P1 = P + v1 * vector2f(cos(theta1), sin(theta1)); if (P1.x < -4.5f || P1.x > 4.5f) { P1.x = -P1.x; } if (P1.y < -4.5f || P1.y > 4.5f) { P1.y = -P1.y; } v = v1; theta = theta1; P = P1; } protected: void transform() { glPushMatrix(); glTranslatef(P.x, P.y, 0.0f); glRotatef(theta * 180.0f / pi, 0.0f, 0.0f, 1.0f); //Rotate about the z-axis } void end_transform() { glPopMatrix(); } }; class model { private: typedef std::vector<actor*> actor_vector; actor_vector actors; public: actor* _prime; model() { } void add(actor* a) { actors.push_back(a); } void set_prime(actor* a) { _prime = a; } void update(controller& control, float dt) { for (actor_vector::iterator i = actors.begin(); i != actors.end(); ++i) { (*i)->update(control, dt); } } void render() { for (actor_vector::iterator i = actors.begin(); i != actors.end(); ++i) { (*i)->render(); } } };

    Read the article

  • Can basic mathematics be done in Microsoft Word?

    - by Christopher Chipps
    Is there a function of MS Word that enables users to solve basic math problems, in this case addition or subtraction? I use its platform for a budget and of course I could just use a calculator but it would be more convenient if I could solve it all in one place. For instance: (6.75 + 12.65 + 27.35) Sorry for the simplicity of this question. Wondering if MS Word had a functionality like this of some sort?

    Read the article

  • What super-calculator do you use?

    - by Jeremy Rudd
    Windows Calculator can switch into a "Scientific" mode, getting more math and logical operators, but that's not good enough. I know there are tons of features its missing, such as the ones we see in the Windows 7 calc, or simply making things more visual. Its been years and I still haven't found a good calculator replacement. Suggestions? And hopefully your calc replaces MS Calc when I press the dedicated "calculator key" on my Keyboard, so I don't have to hunt around for a shortcut.

    Read the article

  • Unexpected StackOverflowError in KeyListener

    - by BillThePlatypus
    I am writing a program that can write sets of questions for review to a file for another program to read. The possible answers are typed into JTextFields at the bottom. It has code to ensure that there won't bew more than one blank JTextField at the end. When I type in answers, at varying points it will throw a StackOverflowError. The stack trace: Exception in thread "AWT-EventQueue-0" java.lang.StackOverflowError at java.awt.AWTEventMulticaster.keyPressed(AWTEventMulticaster.java:232) at java.awt.AWTEventMulticaster.keyPressed(AWTEventMulticaster.java:232) at java.awt.AWTEventMulticaster.keyPressed(AWTEventMulticaster.java:232) at java.awt.AWTEventMulticaster.keyPressed(AWTEventMulticaster.java:232) and the code: package writer; import java.awt.BorderLayout; import java.awt.Font; import java.awt.FontMetrics; import java.awt.GridLayout; import java.awt.Insets; import java.awt.event.KeyEvent; import java.awt.event.KeyListener; import java.util.ArrayList; import javax.swing.JPanel; import javax.swing.JScrollPane; import javax.swing.JSplitPane; import javax.swing.JTextArea; import javax.swing.JTextField; import javax.swing.event.DocumentEvent; import javax.swing.event.DocumentListener; import main.QuestionSet; public class SetPanel extends JPanel implements KeyListener { private QuestionSet set; private WriterPanel writer; private JPanel top=new JPanel(new BorderLayout()),controls=new JPanel(new GridLayout(1,0)),answerPanel=new JPanel(new GridLayout(0,1)); private JSplitPane split; private JTextField title=new JTextField(); private JTextArea question=new JTextArea(); private ArrayList<JTextField> answers=new ArrayList<JTextField>(); public SetPanel(QuestionSet s,WriterPanel writer) { super(new BorderLayout()); top.add(controls,BorderLayout.PAGE_START); title.setFont(title.getFont().deriveFont(40f)); title.addKeyListener(new KeyListener(){ @Override public void keyTyped(KeyEvent e) { title.setText(WriterPanel.convertString(title.getText())); } @Override public void keyPressed(KeyEvent e) { title.setText(WriterPanel.convertString(title.getText())); } @Override public void keyReleased(KeyEvent e) { title.setText(WriterPanel.convertString(title.getText())); } }); title.getDocument().addDocumentListener(new DocumentListener(){ @Override public void insertUpdate(DocumentEvent e) { // TODO Auto-generated method stub fitTitle(); } @Override public void removeUpdate(DocumentEvent e) { // TODO Auto-generated method stub fitTitle(); } @Override public void changedUpdate(DocumentEvent e) { // TODO Auto-generated method stub fitTitle(); } }); top.add(title,BorderLayout.PAGE_END); this.add(top,BorderLayout.PAGE_START); question.setLineWrap(true); question.setWrapStyleWord(true); question.setFont(question.getFont().deriveFont(20f)); question.addKeyListener(new KeyListener(){ @Override public void keyTyped(KeyEvent e) { // TODO Auto-generated method stub question.setText(WriterPanel.convertString(question.getText())); } @Override public void keyPressed(KeyEvent e) { // TODO Auto-generated method stub question.setText(WriterPanel.convertString(question.getText())); } @Override public void keyReleased(KeyEvent e) { // TODO Auto-generated method stub question.setText(WriterPanel.convertString(question.getText())); }}); split=new JSplitPane(JSplitPane.VERTICAL_SPLIT,true,new JScrollPane(question),new JScrollPane(answerPanel)); split.setDividerLocation(150); this.add(split,BorderLayout.CENTER); answers.add(new JTextField()); answerPanel.add(answers.get(0)); answers.get(0).addKeyListener(this); } private void fitTitle() { if(title==null||title.getText().equals("")) return; //title.setText(WriterPanel.convertString(title.getText())); String text=title.getText(); Insets insets=title.getInsets(); int width=title.getWidth()-insets.left-insets.right; int height=title.getHeight()-insets.top-insets.bottom; Font root=title.getFont().deriveFont((float)height); FontMetrics m=title.getFontMetrics(root); if(m.stringWidth(text)<width) { title.setFont(title.getFont().deriveFont((float)height)); return; } float delta=-100; while(Math.abs(delta)>.1f) { m=title.getFontMetrics(root); int w=m.stringWidth(text); if(w==width) break; if(Math.signum(w-width)==Math.signum(delta)||root.getSize2D()+delta<0) { delta/=-10; continue; } root=root.deriveFont(root.getSize2D()+delta); } title.setFont(root); } private void fixAnswers() { //System.out.println(answers); while(answers.get(answers.size()-1).getText().equals("")&&answers.size()>1&&answers.get(answers.size()-2).getText().equals("")) removeAnswer(answers.size()-1); if(!answers.get(answers.size()-1).getText().equals("")) { answers.add(new JTextField()); answerPanel.add(answers.get(answers.size()-1)); answers.get(answers.size()-2).removeKeyListener(this); answerPanel.revalidate(); } answers.get(answers.size()-1).addKeyListener(this); } private void removeAnswer(int i) { answers.remove(i); answerPanel.remove(i); answerPanel.revalidate(); } @Override public void keyTyped(KeyEvent e) { // TODO Auto-generated method stub } @Override public void keyPressed(KeyEvent e) { // TODO Auto-generated method stub fixAnswers(); } @Override public void keyReleased(KeyEvent e) { // TODO Auto-generated method stub } } Thank you in advance for any help.

    Read the article

  • why this condition not work i put the full code link plz help

    - by migo
    I've noticed that the first condition does not work if (empty($ss)) { echo "please write your search words"; } but the second does else if ($num < 1) { echo "not found any like "; full code <?php require_once "conf.php"; $ss= $_POST["ss"]; $sql2=("SELECT * FROM student WHERE snum = $ss"); $rs2 = mysql_query($sql2) or die(mysql_error()); $num = mysql_num_rows($rs2); if (empty($ss)) { echo "please write your search words"; } else if ($num < 1 ) { echo "not found any like "; }else { $sql=("SELECT * FROM student WHERE snum = $ss "); $rs = mysql_query($sql) or die(mysql_error()); while($data=mysql_fetch_array($rs)) { ?> <div id="name"> <table align="center" border="3" bgcolor="#FF6666"> <tr> <td><? echo $data ["sname"]." "."????? ??????"; ?></td> </tr> </table> </div> <div id="ahmed"> <table width="50%" height="50" align="center" border="2px" bgcolor="#BCD5F8"> <tr> <td width="18%"><strong>???????</strong></td> <td width="13%"><strong>?????</strong></td> <td width="13%"><strong>?????</strong></td> <td width="14%"><strong>????</strong></td> <td width="12%"><strong>????</strong></td> <td width="30%"><strong>??????</strong></td> </tr> <tr> <td>100</td> <td>100</td> <td>100</td> <td>100</td> <td>100</td> <td><strong>?????? ????????</strong></td> </tr> <td><? echo $data['geo']; ?></td> <td><? echo $data['snum']; ?></td> <td><? echo $data['math']; ?></td> <td><? echo $data['arab']; ?></td> <td><? echo $data['history']; ?></td> <td><strong>????? ??????</strong></td> </tr> <tr> <td colspan="5" align="center" valign="middle"> <? $sum= $data['geo'] + $data['snum'] + $data['math'] + $data['arab'] + $data['history']; echo $sum ; ?> </td> <td><strong>????? ???????</strong></td> </tr> <tr> <td colspan="5" align="center"> <? $all=500 ; $sum= $data['geo'] + $data['snum'] + $data['math'] + $data['arab'] + $data['history']; $av=$sum/$all*100 ; echo $av."%" ; ?> </td> <td><strong> ?????? ??????? </strong></td> </tr> </table> </tr> </div> <? } }; the full code link is http://www.mediafire.com/?2d4yzdjiym0

    Read the article

  • Find Search Replace from landmark to landmark - including everything in between

    - by Erick Tronboll
    Appreciate some Jedi help... I have the following string: gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR repeating sporadically throughout my document and want to remove everything from: gi|37463 to the AAMGR sequence but, I want to keep the blocks where JQ250 appears: gi|374638936|gb|*JQ250*332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC and remove only the lines that have AEZ554 gi|374638939|gb|*AEZ554*52.1| myosin light chain 2, partial [Batrachoseps major] AAMGR ..................................... So, ideally the following block: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638935|gb|AEZ55450.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638937|gb|AEZ55451.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR Would be left as just: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC ................................many thanks as I help a struggling Grad Student

    Read the article

  • Acer Aspire One (mini) mfgd 9/03 locks up also when plugged in

    - by LAURIE ANN
    My problem is almost the same as the Toshiba user (Toshiba A205-5804 freezes when plugged in): Well I have a Toshiba A205-5804 and the problem is that the screen freezes anytime I plug the pc into the external power supply, not as most of the computers having the same issue, my computer DOES freeze in safe mode, and I really can't bear this problem for much longer... It's not an overheat problem, the computer is not getting hot or anything related, I've tried already to change the AC adapter, to boot only with AC and no battery, and also all of these suggestions: The only difference in my case is: I can be using the battery and when it runs down, I can just close the lid and the system goes into hibernation mode. I then plug it in and let it charge. When I think it's finally charged, I can UNPLUG it, open the lid and all is running fine on the battery again. Note: the system was NOT shut down and it still runs as long as I remove the power plug before opening the lid. I have ALL the same issues as the other Toshiba user, also. I was a tech for 9 yrs in my own business and this one has not only stumped me, but anyone I have asked has never heard of this problem. Every repair center wants to charge me for diagnosis, even is they cannot fix it. I would really like to run this system along side of my new Acer Aspire 17" laptop as I need it to finish my grad school work. Any ideas would be GREATLY appreciated. Thanx, Laurie Ann

    Read the article

  • Building vs buying a server for an academic lab [closed]

    - by Roy
    I'm looking for advice on the classic build vs buy question. We need a new linux server to run Matlab computation on in our lab (academic). Matlab parallel computing toolbox licence allows up to 12 local workers so we are aiming at a 12 core server with 4GB memory per core (total of 48gb). The system will have an SSD for the OS and a raid-5 (4x2tb) for data. I looked around and found a (relatively) cheap vendor, Silicon Mechanics, that offers a system to our liking (specs below) for $6732. However, buying the components from newegg cost only $4464! The difference is $2268 which is 50% of the base cost. If buying from a company can be thought of as a sort of insurance, basically my premiums are of 50% of the base cost which to me sounds like a lot. Of course any downtime is bad, but the work is not "mission critical", i.e. if it takes a few days to fix it when it breaks its no the end of the world. If it takes weeks to months then its a problem. If it breaks 2-3 times in 3 years, not too bad. If it breaks every month not good. In term of build experience, I set up a linux cluster in grad school (from existing computers) and I build my home pcs but I never built a server before. The server components I'm thinking about: 1 x SUPERMICRO SYS-7046T-6F 4U Tower Server Barebone Dual LGA 1366 Intel 5520 DDR3 1333/1066/800 ($1,050) 12 x Kingston 4GB 240-Pin DDR3 SDRAM DDR3 1333 (PC3 10600) ECC Unbuffered Server Memory ($420) 2 x Intel Xeon E5645 Westmere-EP 2.4GHz LGA 1366 80W Six-Core ($1,116) 4 x Seagate Constellation ES 2TB 7200 RPM SATA 6.0Gb/s 3.5" ($1,040) 1 x SAMSUNG Internal DVD Writer Black SATA ($20) 1 x Intel 520 Series 2.5" 180GB SATA III MLC SSD $300 1 x LSI LSI00281 PCI-Express 2.0 x8 MD2 Low profile SATA / SAS MegaRAID SAS 9260CV-4i Controller Card, $695

    Read the article

  • How to fix "BASIC runtime error 1; Type: com.sun.star.uno.Runtime Exception, Message: Toolbar do not exist " error in Libreoffice calc, Ubuntu 12.04

    - by PDeb
    I get the following error while openning a .xls file in Libreoffice Calc, Ubuntu 12.04 [LibreOffice 3.5.5.2; Build ID: 350m 1 (Build:2)] To overcome this I checked the LibreOffice Security Level to Low under Macro Security (from Tools---- Options--- Security tab. Then I went ahead intalling java by running the following commands from the terminal window (with some tips from various forums) sudo add-apt-repository ppa:libreoffice/ppa sudo apt-get update sudo apt-get install libreoffice libreoffice-java-common libreoffice-math libreoffice-gnome libreoffice-java-common Still I got the BASIC runtime error (as in the title), even after clicking Tools---- Options ---- Java and checking the 'Use a Java runtime environment option' and then clicking on 'Sun Microsystems Inc' under listed JRE environments installed. Even I ran the following commands to install latest Java run time environments from terminal window sudo apt-get install openjdk-7-jre icedtea-7-plugin But still I get the same Basicruntime error (details as in the title bar). This particular file opens perfectly in Microsoft Excel 2007, in Win XP Professional.

    Read the article

  • OpenGL or OpenGL ES

    - by zxspectrum
    What should I learn? OpenGL 4.1 or OpenGL ES 2.0? I will be developing desktop applications using Qt but I may start developing mobile applications in a few months, too. I don't know anything about 3D, 3D math, etc and I'd rather spend 100 bucks in a good book than 1 week digging websites and going through trial and error. One problem I see with OpenGL 4.1 is as far as I know there is no book yet (the most recent ones are for OpenGL 3.3 or 4.0), while there are books on OpenGL ES 2.0. On the other hand, from my naive point of view, OpenGL 4.1 seems like OpenGL ES 2.0 + additions, so it looks like it would be easier/better to first learn OpenGL ES 2.0, then go for the shader language, etc Please, don't tell me to use NeHe (it's generally agreed it's full of bad/old practices), the Durian tutorial, etc. Thanks

    Read the article

  • Do you have any “Family Feud” style questions and answers for a game for high school students?

    - by Ben Jakuben
    I am gathering questions and responses in math, science, and technology for a "Family Feud" style game for high school students. I am having trouble finding and thinking of questions, especially in the technology realm. Technology (programming or general tech) questions are preferred. If you have never seen the game show, "Family Feud" involves two teams trying to guess the most popular responses to questions asked to a group of 100 respondents. The team must guess all the popular responses to get the points for the question. For example, if the question is, "What are the major tags in HTML 4.0?", the responses might be: P (64 votes) DIV (16 votes) TABLE (8 votes) BLINK (4 votes)

    Read the article

  • What are the pros and cons of Coffeescript?

    - by Philip
    Of course one big pro is the amount of syntactic sugar leading to shorter code in a lot of cases. On http://jashkenas.github.com/coffee-script/ there are impressive examples. On the other hand I have doubts that these examples represent code of complex real world applications. In my code for instance I never add functions to bare objects but rather to their prototypes. Moreover the prototype feature is hidden from the user, suggesting classical OOP rather than idiomatic Javascript. The array comprehension example would look in my code probably like this: cubes = $.map(list, math.cube); // which is 8 characters less using jQuery...

    Read the article

  • Triangle - Rectangle Intersection in 2D

    - by Kevin Boyd
    I had previously asked this for 3D but now I changed my strategy and would like to do the intersection in 2D. The Rectangle is axis aligned and will always be in a fixed position, and has a constant shape and size, basically I want to clip the red areas of the triangles that extend outside the bounds of the rectangle The triangles could be in any position, shape or size, I my code I have a loop where I check the triangles one by one however I am still clueless about the math. I have identified 5 cases of triangle rectangle intersection as shown here. How do I find the intersection points of the triangle and the rectangle?

    Read the article

  • Why do you need float/double?

    - by acidzombie24
    I was watching http://www.joelonsoftware.com/items/2011/06/27.html and laughed at Jon Skeet joke about 0.3 not being 0.3. I personally never had problems with floats/decimals/doubles but then I remember I learned 6502 very early and never needed floats in most of my programs. The only time I used it was for graphics and math where inaccurate numbers were ok and the output was for the screen and not to be stored (in a db, file) or dependent on. My question is, where are places were you typically use floats/decimals/double? So I know to watch out for these gotchas. With money I use longs and store values by the cent, for speed of an object in a game I add ints and divide (or bitshift) the value to know if I need to move a pixel or not. (I made object move in the 6502 days, we had no divide nor floats but had shifts). So I was mostly curious.

    Read the article

< Previous Page | 76 77 78 79 80 81 82 83 84 85 86 87  | Next Page >