Search Results

Search found 4451 results on 179 pages for 'split brain'.

Page 80/179 | < Previous Page | 76 77 78 79 80 81 82 83 84 85 86 87  | Next Page >

  • im writing a spellchecking program, how do i replace ch in a string..eg..

    - by Ajay Hopkins
    what am i doing wrong/what can i do?? import sys import string def remove(file): punctuation = string.punctuation for ch in file: if len(ch) > 1: print('error - ch is larger than 1 --| {0} |--'.format(ch)) if ch in punctuation: ch = ' ' return ch else: return ch ref = (open("ref.txt","r")) test_file = (open("test.txt", "r")) dictionary = ref.read().split() file = test_file.read().lower() file = remove(file) print(file) p.s, this is in Python 3.1.2

    Read the article

  • More elegant way to write this?

    - by tesmar
    Hi, I am trying to make a multi-dimensional array of characters in ruby, and this works, but is there a more elegant way? def initialize(text) @map = Array.new i = 0 text.split("\n").each do |x| @map[i] = x.scan(/./) i += 1 end #@map = text end#constructor

    Read the article

  • How to get path to the installed GIT in Python?

    - by Vladimir Prudnikov
    I need to get a path to the GIT on Max OS X 10.6 using Python 2.6.1 into script variables. I use this code for that: r = subprocess.Popen(shlex.split("which git"), stdout=subprocess.PIPE) print r.stdout.read() but the problem is that output is empty (I tried stderr too). It works fine with another commands such as pwd or ls. Can anyone help me with that?

    Read the article

  • SQL Server architecture guidance

    - by Liam
    Hi, We are designing a new version of our existing product on a new schema. Its an internal web application with possibly 100 concurrent users (max)This will run on a SQL Server 2008 database. On of the discussion items recently is whether we should have a single database of split the database for performance reasons across 2 separate databases. The database could grow anywhere from 50-100GB over 5 years. We are Developers and not DBAs so it would be nice to get some general guidance. [I know the answer is not simple as it depends on the schema, archiving policy, amount of data etc. ] Option 1 Single Main Database [This is my preferred option]. The plan would be to have all the tables in a single database and possibly to use file groups and partitioning to separate the data if required across multiple disks. [Use schema if appropriate]. This should deal with the performance concerns One of the comments wrt this was that the a single server instance would still be processing this data so there would still be a processing bottle neck. For reporting we could have a separate reporting DB but this is still being discussed. Option 2 Split the database into 2 separate databases DB1 - Customers, Accounts, Customer resources etc DB2 - This would contain the bulk of the data [i.e. Vehicle tracking data, financial transaction tables etc]. These tables would typically contain a lot of data. [It could reside on a separate server if required] This plan would involve keeping the main data in a smaller database [DB1] and retaining the [mainly] read only transaction type data in a separate DB [DB2]. The UI would mainly read from DB1 and thus be more responsive. [I'm aware that this option makes it harder for Referential Integrity to be enforced.] Points for consideration As we are at the design stage we can at least make proper use of indexes to deal performance issues so thats why option 1 to me is attractive and its more of a standard approach. For both options we are considering implementing an archiving database. Apologies for the long Question. In summary the question is 1 DB or 2? Thanks in advance, Liam

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • How should I parse this simple text file in Java?

    - by Winston
    I have a text file that looks like this: grn129 agri- ac-214 ahss hud114 ahss lov1150 ahss lov1160 ahss lov1170 ahss lov1210 ahss What is the best way to parse this file using Java if I want to create a HashMap with the first column as the key and the second column as the value. Should I use the Scanner class? Try to read in the whole file as a string and split it? What is the best way?

    Read the article

  • python - remove string from words in an array

    - by tekknolagi
    #!/usr/bin/python #this looks for words in dictionary that begin with 'in' and the suffix is a real word wordlist = [line.strip() for line in open('/usr/share/dict/words')] newlist = [] for word in wordlist: if word.startswith("in"): newlist.append(word) for word in newlist: word = word.split('in') print newlist how would I get the program to remove the string "in" from all the words that it starts with? right now it does not work

    Read the article

  • Parsing string logic issue c#

    - by N0xus
    This is a follow on from this question My program is taking in a string that is comprised of two parts: a distance value and an id number respectively. I've split these up and stored them in local variables inside my program. All of the id numbers are stored in a dictionary and are used check the incoming distance value. Though I should note that each string that gets sent into my program from the device is passed along on a single string. The next time my program receives that a signal from a device, it overrides the previous data that was there before. Should the id key coming into my program match one inside my dictionary, then a variable held next to my dictionaries key, should be updated. However, when I run my program, I don't get 6 different values, I only get the same value and they all update at the same time. This is all the code I have written trying to do this: Dictionary<string, string> myDictonary = new Dictionary<string, string>(); string Value1 = ""; string Value2 = ""; string Value3 = ""; string Value4 = ""; string Value5 = ""; string Value6 = ""; void Start() { myDictonary.Add("11111111", Value1); myDictonary.Add("22222222", Value2); myDictonary.Add("33333333", Value3); myDictonary.Add("44444444", Value4); myDictonary.Add("55555555", Value5); myDictonary.Add("66666666", Value6); } private void AppendString(string message) { testMessage = message; string[] messages = message.Split(','); foreach(string w in messages) { if(!message.StartsWith(" ")) outputContent.text += w + "\n"; } messageCount = "RSSI number " + messages[0]; uuidString = "UUID number " + messages[1]; if(myDictonary.ContainsKey(messages[1])) { Value1 = messageCount; Value2 = messageCount; Value3 = messageCount; Value4 = messageCount; Value5 = messageCount; Value6 = messageCount; } } How can I get it so that when programs recives the first key, for example 1111111, it only updates Value1? The information that comes through can be dynamic, so I'd like to avoid harding as much information as I possibly can.

    Read the article

  • Are "proxy properties" good style?

    - by erlando
    I have a class with a string property that's actually several strings joined with a separator. I'm wondering if it is good form to have a proxy property like this: public string ActualProperty { get { return actualProperty; } set { actualProperty = value; } } public string[] IndividualStrings { get { return ActualProperty.Split(.....); } set { // join strings from array in propval .... ; ActualProperty = propval; } } Is there any risks I have overlooked?

    Read the article

  • Detect if a key does is bound to something in vim

    - by WishCow
    I'd like to know if there is a way to figure out if a key does something in vim. I know that I can use :map to see user-defined mappings, but is there something for the built-in stuff? For example, I always had CTRL-W bound to close tab, because I thought that it was unused. After half a year, I found out that there are some sequences that use it, like CTRL-W CTRL-S to split the window, and it was a nightmare to retrain myself.

    Read the article

  • What is a good way of Enhancing contrast of color images?

    - by erjik
    I split color image for 3 channels and made a contrast enhancement of each channel. Then merged them together, I like the image at the result, but it has different colors. Black objects became yellow and so on... EDIT: The algorithm I used is to calculate the 5th percentile and the 95th percentile as min and max values, and then expand the values of image so that it will have min and max values as 0 and 255. If there is a better approach please tell me.

    Read the article

  • Best practice to modularise a large Grails app?

    - by Mulone
    Hi all, A Grails app I'm working on is becoming pretty big, and it would be good to refactor it into several modules, so that we don't have to redeploy the whole thing every time. In your opinion, what is the best practice to split a Grails app in several modules? In particular I'd like to create a package of domain classes + relevant services and use it in the app as a module. Is this possible? Is it possible to do it with plugins? Cheers, Mulone

    Read the article

  • How can you use jQuery to make sIFR-replaced elements fade in?

    - by Sam Goldman
    This is what I currently have: // #content is visibility=hidden sIFR.replace(mix_bold, { selector: '#content p', onReplacement: function(fi) { $('#content').fadeIn("slow"); } }); The fade in happens, but for a split second the replaced flash movie appears before being hidden. Has anyone gotten this to work? I am using jQuery 1.2.6 and sIFR 3 r436. Tested in Safari 4 and FF 3. Thanks!

    Read the article

  • JS text to array

    - by Sonny
    Hi i got this text 2/92/20 3/32/32 4/62/6 5/22/28 6/60/61 7/33/32 8/34/31 9/31/19 10/19/19 11/34/39 12/32/32 14/19/25 15/45/37 16/32/32 17/84/36 18/72/33 and i need it to be like // 2/92/20 chars[0][0]=2; chars[0][1]=92; chars[0][2]=20; How should i make that PS: the split must be in $.ajax({ type: "POST", url: "char_info2.php", dataType: "html", success: function(data) { //here }

    Read the article

  • Control characters as delimiters

    - by Gio Borje
    I have a nodejs TCP server and a client. Basic network communication happens. Client sends "data + STX_CHARACTER + data + ETX_CHARACTER" (just an example). How do I split the string using the STX Control Character as a delimiter or how do I reference the character at all in Javascript.

    Read the article

  • how to wait multiple function processing to finish

    - by user351412
    I have a problem about multiple function processing , listed as below code, the main function is btnEvalClick, I have try to use alter native 1and 2 to wait the function not move to next record before theprocessed function finish, but it does not work //private function btnEvalClick(event:Event):void { // var i:int; // for(i= 0; i < (dataArr1.length); i++) { // dispatchEvent( new FlexEvent('test') ); // callfunc1('cydatGMX'); //call function 1 // callfun2('cydatGMO'); //call function 1 // editSave(); //save record (HTTP) //## Alternative 1 //if (String(event) == 'SAVEOK') { // RecMov('next'); //move record if save = OK //} //## Alternative 2 //while (waitfc == '') // if waitfc not 'OK' continue looping //{ // z = z + 1; //} // RecMov('next'); //Move to next record to process //} //private function callfunc1(tasal:String):void { // var mySO :SharedObject; // var myDP: Array; // var i:int; // var prm:Array; // try // { // mySO = SharedObject.getLocal(tasal,'/'); // prm = mySO.data.txt.split('?'); // for(i=0; i < (prm.length - 1); i++) { // myDP = prm[i].toString().split('^'); // if ( myDP[0].toString() == String(dataArr1[dg].MatrixCDCol)){ // myDPX = myDP; // break; // } // } // } // catch (err:Error) { // Alert.show('Limit object creation fail (' + tasal + '), please retry ); // } //} //private function editSave():void //{ // var parameters:* = // { // 'CertID': CertIDCol.text, 'AssetID': AssetIDCol.text, 'CertDate': cdt, //'Ccatat': CcatatCol.text, 'CertBy': CertByCol.text, 'StatusID': StatusIDCol.text, //'UpdDate': lele, 'UpdUsr': ApplicationState.instance.luNm }; // doRequest('Update', parameters, saveItemHandler); //} //private function doRequest(method_name:String, parameters:Object, callback:Function):void // { // add the method to the parameters list // parameters['method'] = (method_name + 'ASC'); // gateway.request = parameters; // var call:AsyncToken = gateway.send(); // call.request_params = gateway.request; // call.handler = callback; // } //private function saveItemHandler(e:Object):void // { // if (e.isError) // { // Alert.show('Error: ' + e.data.error); // } // else // { // Alert.show('Record Saved..'); // waitfc = 'OK'; // dispatchEvent( new FlexEvent('SAVEOK') ); // } // }

    Read the article

  • What common routines do you put in your Program.cs for C#

    - by Rick
    I'm interested in any common routine/procedures/methods that you might use in you Program.cs when creating a .NET project. For instance I commonly use the following code in my desktop applications to allow easy upgrades, single instance execution and friendly and simple reporting of uncaught system application errors. using System; using System.Diagnostics; using System.Threading; using System.Windows.Forms; namespace NameoftheAssembly { internal static class Program { /// <summary> /// The main entry point for the application. Modified to check for another running instance on the same computer and to catch and report any errors not explicitly checked for. /// </summary> [STAThread] private static void Main() { //for upgrading and installing newer versions string[] arguments = Environment.GetCommandLineArgs(); if (arguments.GetUpperBound(0) > 0) { foreach (string argument in arguments) { if (argument.Split('=')[0].ToLower().Equals("/u")) { string guid = argument.Split('=')[1]; string path = Environment.GetFolderPath(Environment.SpecialFolder.System); var si = new ProcessStartInfo(path + "\\msiexec.exe", "/x" + guid); Process.Start(si); Application.Exit(); } } //end of upgrade } else { bool onlyInstance = false; var mutex = new Mutex(true, Application.ProductName, out onlyInstance); if (!onlyInstance) { MessageBox.Show("Another copy of this running"); return; } AppDomain.CurrentDomain.UnhandledException += CurrentDomain_UnhandledException; Application.ThreadException += ApplicationThreadException; Application.EnableVisualStyles(); Application.SetCompatibleTextRenderingDefault(false); Application.Run(new Form1()); } } private static void CurrentDomain_UnhandledException(object sender, UnhandledExceptionEventArgs e) { try { var ex = (Exception) e.ExceptionObject; MessageBox.Show("Whoops! Please contact the developers with the following" + " information:\n\n" + ex.Message + ex.StackTrace, " Fatal Error", MessageBoxButtons.OK, MessageBoxIcon.Stop); } catch (Exception) { //do nothing - Another Exception! Wow not a good thing. } finally { Application.Exit(); } } public static void ApplicationThreadException(object sender, ThreadExceptionEventArgs e) { try { MessageBox.Show("Whoops! Please contact the developers with the following" + " information:\n\n" + e.Exception.Message + e.Exception.StackTrace, " Error", MessageBoxButtons.OK, MessageBoxIcon.Stop); } catch (Exception) { //do nothing - Another Exception! Wow not a good thing. } } } } I find these routines to be very helpful. What methods have you found helpful in Program.cs?

    Read the article

  • Dreamweaver CS5 - Have Design Window as a Panel?

    - by Oliver Jones
    I've been looking around on the dreamweaver interface, and I'm trying to get my design window as an external panel. Reason is, I have a dual monitor system, and I would like to have the main window (where you can have both code/split/design) on my main screen, but with the code selected, and a design view on my secondary monitor. I'm assuming this can't be done, although I have noticed you can have your code as an external panel (Code Inspector). Would like to hear your input. Thanks

    Read the article

< Previous Page | 76 77 78 79 80 81 82 83 84 85 86 87  | Next Page >