Search Results

Search found 3145 results on 126 pages for 'cs brandt'.

Page 82/126 | < Previous Page | 78 79 80 81 82 83 84 85 86 87 88 89  | Next Page >

  • Paging with jQuery

    - by zurna
    I get data from another page using jQuery get method. But I have a small problem. Sometimes, data that I take from another page is too long so it's divided into pages. When the user clicks on 1, 2, 3, ... links he/she is redirected to the other page. However, I want data to be reloaded on the same page. Edit $('ul.thumbs li.pagination a').live('click', function() { var pageNumber = parseInt($(this).text().replace(/[^0-9]/g, '')); $.ajax({ type: "GET", url: "images.cs.asp?Process=ViewImages&PAGEID=<%=Request.QueryString("PAGEID")%>", success: function(data) { $("#ViewImages").html(data); }, error: function (XMLHttpRequest, textStatus, errorThrown) { $("#ViewImages").html('.'); } }); return false; });

    Read the article

  • How to set ItemsSource?

    - by Mark
    This dialog makes no sense to me And I'm having trouble finding good tutorials on it. Most of the examples aren't detailed enough, or do stuff via code, but I'd like to take advantage of the IDE as much as possible. Whats the difference between ItemsSource and DataContext? I'd like to bind it to just a List for starters. I don't need SQL or databases or anything fancy. Where would I declare my list? In MainWindow.xaml.cs? How do I get it to appear in that dialog?

    Read the article

  • How is the implicit segment register of a near pointer determined?

    - by Daniel Trebbien
    In section 4.3 of Intel 64® and IA-32 Architectures Software Developer's Manual. Volume 1: Basic Architecture, it says: A near pointer is a 32-bit offset ... within a segment. Near pointers are used for all memory references in a flat memory model or for references in a segmented model where the identity of the segment being accessed is implied. This leads me to wondering: how is the implied segment register determined? I know that (%eip) and displaced (%eip) (e.g. -4(%eip)) addresses use %cs by default, and that (%esp) and displaced (%esp) addresses use %ss, but what about (%eax), (%edx), (%edi), (%ebp) etc., and can the implicit segment register depend also on the instruction that the memory address operand appears in?

    Read the article

  • How does the dataset determine the return type of a scalar query?

    - by Tobias Funke
    I am attempting to add a scalar query to a dataset. The query is pretty straight forward, it's just adding up some decimal values in a few columns and returning them. I am 100% confident that only one row and one column is returned, and that it is of decimal type (SQL money type). The problem is that for some reason, the generated method (in the .designer.cs code file) is returning a value of type object, when it should be decimal. What's strange is that there's another scalar query that has the exact same SQL but is returning decimal like it should. How does the dataset designer determine the data type, and how can I tell it to return decimal?

    Read the article

  • Programmatically Setting the Version of a Window's Service on the ProjectInstaller

    - by user302004
    I have a Windows Service created in Visual Studio 2005 in C#. I have a setup project and a ProjectInstaller class. I also have code to programmatically get the version from the AssemblyFileVersionAttribute. I need to figure out where I set the version that I've obtained (and where this code should go). I tried placing it in the InitializeComponent method on ProjectInstaller.Designer.cs and then appending the version to serviceInstaller1.DisplayName and serviceInstaller1.ServiceName. This didn't work and you're not supposed to modify the contents of this method. Any ideas?

    Read the article

  • Text property in a UserControl in C#

    - by yeyeyerman
    I have a control with a inner TextBox. I want to make a direct relationship between the Text property of the UserControl and the Text property of the TextBox. The first thing I realized is that Text was not being displayed in the Properties of the UserControl. Then I added the Browsable(true) attribute. [Browsable(true)] public override string Text { get { return m_textBox.Text; } set { m_textBox.Text = value; } } Now, the text will be shown for a while, but then is deleted. This is because the information is not written within the xxxx.Designer.cs. How can this behviour be changed?

    Read the article

  • Clear the form once form submitted

    - by zurna
    Once the form submitted, response from another page is printed to #GameStorySys. But values entered to the form still stays there. Is it possible for the form values to disappear (but the form should still stay) once the form submitted? $("[name='GameStoryForm']").click(function() { $.ajax({ type: "POST", data: $("#GameStoryForm").serialize(), url: "content/commentary/index.cs.asp?Process=EditLiveCommentaryStory&CommentaryID=<%=Request.QueryString("CommentaryID")%>", success: function(output) { $('#GameStorySys').html(output); }, error: function(output) { $('#GameStorySys').html(output); } }); });

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • How does the dataset designer determine the return type of a scalar query?

    - by Tobias Funke
    I am attempting to add a scalar query to a dataset. The query is pretty straight forward, it's just adding up some decimal values in a few columns and returning them. I am 100% confident that only one row and one column is returned, and that it is of decimal type (SQL money type). The problem is that for some reason, the generated method (in the .designer.cs code file) is returning a value of type object, when it should be decimal. What's strange is that there's another scalar query that has the exact same SQL but is returning decimal like it should. How does the dataset designer determine the data type, and how can I tell it to return decimal?

    Read the article

  • C++ Questions about vectors

    - by xbonez
    Hey guys, I have a CS exam tomorrow. Just want to get a few questions cleared up. Thanks a lot, and I really appreciate the help. Que 1. What are parallel vectors? Vectors of the same length that contain data that is meant to be processed together Vectors that are all of the same data type Vectors that are of the same length Any vector of data type parallel Que 2. Arrays are faster and more efficient than vectors. True False Que 3. Arrays can be a return type of a function call. True False Que 4. Vectors can be a return type of a function call. True False

    Read the article

  • How to Use a Windows App with Embeded files and folders to copy to a destination. In C#

    - by Mark Sweetman
    I am trying to write a small application, whose only purpose is to copy some folders and .cs source files into a user specified Directory, I can do it easy enough by simply having the application look for the files and folders in its own install directory then copy them to thier destination Directory, but I was wondering if its possible to Embed the Folders and Files into the Application, so that when you run the application it creates or copies the folders and files from the exe app directly to the install directory, rather than searching for them in the apps install directory then copying them over. Basically Im trying to only have a single exe file rather than having an exe file and a bunch of folders and files along side it. Is this possible to do with just a Windows Form App without using an actual Installer Class?

    Read the article

  • Catching / Redirecting 404's (ASP.NET)

    - by maxp
    Ive noticed that when I request a page in ASP.NET (webforms) that does not exist, the 'StaticFile' handler deals with the error notification. Id like to be a bit more helpful in these situations. What is the correct way for me to intercept this 404, and as a result, run some code to redirect the user? Two ways Ive thought of doing which I currently don't really like are: 1 - Create a module that basically does a if (!file.exists($url){redirect to $correctedurl}) 2 - Modify the error.aspx.cs(or the default error page) to do something similar (yuck!)

    Read the article

  • Example applications and benefits of using "C" , "C++" or "Java"

    - by Waltzy
    Ok, I'm revising for my upcoming year 2 exams on a CS course and its likely something like this will come up. my question is what is an ideal application that would especially benefit from the program features of each of the three languages? I have a vague idea but getting a second opinion could really help. JavaPortability, easy - good for GUIs. C++Fast but may requite significant changes in order to be moved from system to system, good for image processing. CI'm unsure here small embedded applications? Some clarification on this would be really appreciated, thanks again StackOverflow

    Read the article

  • Changing careers to Software Engineering.... Wise?

    - by Phil
    Hello everyone, I notice this site has a wealth of software professionals and I am investigating a career change to Software Engineering: *Particularly, I would like to know how likely one would be able to work from home or another country over the internet. Is this something that can be done and what does it usually entail? (time?,experience?, specific companies?, etc) *Currently, I am a teacher but always had a passion for tech. I am interested in a MS - Software Engineering program designed for individuals based from another field. Is this a wise degree to obtain? Would I be just wasting my time and money obtaining this degree? (I'm suspicious about this program and the feasibility of obtaining employment without a healthy CS background) Thanks for any assistance you can provide!

    Read the article

  • Error message regarding IEnumerable.GetEnumerator().

    - by Bon_chan
    I get this error message and I can't figure out why! Error 1 'Exo5Chap12.ShortCollection<T>' does not implement interface member 'System.Collections.IEnumerable.GetEnumerator()'. 'Exo5Chap12.ShortCollection<T>.GetEnumerator()' cannot implement 'System.Collections.IEnumerable.GetEnumerator()' because it does not have the matching return type of 'System.Collections.IEnumerator'. E:\MyFolders\Dev\c#\Chapter12\Exo5Chap12\Exo5Chap12\exo5.cs 9 18 Exo5Chap12 Here is the code with an implementation of GetEnumerator(). What is wrong? public class ShortCollection<T> : IList<T> { protected Collection<T> innerCollection; protected int maxSize = 10; public IEnumerator<T> GetEnumerator() { return (innerCollection as IEnumerator<T>).GetEnumerator(); } }

    Read the article

  • Should I use C(99) booleans ? ( also c++ booleans in c++ ?)

    - by Roman A. Taycher
    I haven't done much c programming but when I do when I need a false I put 0 when I want true I put 1, (ex. while(1)), in other cases I use things like "while(ptr)" or "if(x)". Should I try using C99 booleans, should I recommend them to others if I'm helping people new to programming learn c basics(thinking of cs 1?? students)? I'm pretty sure the Visual Studio compiler supports c99 bools, but do a lot of projects (open source and c apps in industry) compile for c89? If I don't use C bools should I at least do something like #define TRUE 1 #define FALSE 0? Also what about c++ Booleans (for c++)?

    Read the article

  • Did anybody use the constream (constrea.h) lib?

    - by user337938
    Two years ago, I used the conio.h (actually conio2.h for Dev-C++) to create a console form interface. Now I want to make the same thing, but C++ std lib does not provide the needed functions and I don't want to use the old C conio lib. I found some websites which highlights the constream lib, but I have no idea to use it on VS! I tried just copying the header file into my project, but VS show several erros. I believe I am doing something wrong. ps: i got this file: ftp://ftp.cs.technion.ac.il/pub/misc/baram/TC31/INCLUDE/CONSTREA.H

    Read the article

  • IEnumerable<SelectListItem> error question

    - by user281180
    I have the following code, but i`m having error of Error 6 foreach statement cannot operate on variables of type 'int' because 'int' does not contain a public definition for 'GetEnumerator' C:\Dev\DEV\Code\MvcUI\Models\MappingModel.cs 100 13 MvcUI How can I solve this? Note: string [] projectID; Class Employee { int id {get; set;} string Name {get;set;} } public IEnumerable<SelectListItem> GetStudents() { List<SelectListItem> result = new List<SelectListItem>(); foreach (var id in Convert.ToInt32(projectID)) { foreach( Employee emp in Project.Load(id)) result.Add(new SelectListItem { Selected = false, Text = emp.ID.ToString(), Value = emp.Name }); return result.AsEnumerable(); } }

    Read the article

  • Hilighting div tag in Masterpage on redirection to content page

    - by user1713632
    I have a link in Master page within a div tag. I want to highlight the div when I am clicking the link, in order to redirect to some content page. I have written the following code: <li> <div id="div_test" runat="server"> <asp:LinkButton ID="lnk_test_menu" Font-Underline="false" ForeColor="Black" runat="server" Text="Test Link" CausesValidation="false" onclick="lnk_test_menu_Click1" > </asp:LinkButton></div> </li> Code in the cs page: protected void lnk_test_menu_Click1(object sender, EventArgs e) { div_test.Attributes.Add("class", "testSelected"); Response.Redirect(Test.aspx"); } The div in the master page is not being selected on redirection. Could anybody help me on this?

    Read the article

  • Data binding of itemscontrol in Silverlight 3.0

    - by jmkarthik
    I am trying to define an itemscontrol and data bind it to a List and the code is as below. XAML Item Class public class Item { public string val; } XAML.cs public MainPage() { InitializeComponent(); List<Item> items = new List<Item>(); Item item1 = new Item(); item1.val = "iasl;fdj1"; items.Add(item1); Item item2 = new Item(); item2.val = "iasfdkasdkljf2"; items.Add(item2); ic.ItemsSource = items; } The items are displayed when I run this. Am I missing something?

    Read the article

  • Introducing the Earthquake Locator – A Bing Maps Silverlight Application, part 1

    - by Bobby Diaz
    Update: Live demo and source code now available!  The recent wave of earthquakes (no pun intended) being reported in the news got me wondering about the frequency and severity of earthquakes around the world. Since I’ve been doing a lot of Silverlight development lately, I decided to scratch my curiosity with a nice little Bing Maps application that will show the location and relative strength of recent seismic activity. Here is a list of technologies this application will utilize, so be sure to have everything downloaded and installed if you plan on following along. Silverlight 3 WCF RIA Services Bing Maps Silverlight Control * Managed Extensibility Framework (optional) MVVM Light Toolkit (optional) log4net (optional) * If you are new to Bing Maps or have not signed up for a Developer Account, you will need to visit www.bingmapsportal.com to request a Bing Maps key for your application. Getting Started We start out by creating a new Silverlight Application called EarthquakeLocator and specify that we want to automatically create the Web Application Project with RIA Services enabled. I cleaned up the web app by removing the Default.aspx and EarthquakeLocatorTestPage.html. Then I renamed the EarthquakeLocatorTestPage.aspx to Default.aspx and set it as my start page. I also set the development server to use a specific port, as shown below. RIA Services Next, I created a Services folder in the EarthquakeLocator.Web project and added a new Domain Service Class called EarthquakeService.cs. This is the RIA Services Domain Service that will provide earthquake data for our client application. I am not using LINQ to SQL or Entity Framework, so I will use the <empty domain service class> option. We will be pulling data from an external Atom feed, but this example could just as easily pull data from a database or another web service. This is an important distinction to point out because each scenario I just mentioned could potentially use a different Domain Service base class (i.e. LinqToSqlDomainService<TDataContext>). Now we can start adding Query methods to our EarthquakeService that pull data from the USGS web site. Here is the complete code for our service class: using System; using System.Collections.Generic; using System.IO; using System.Linq; using System.ServiceModel.Syndication; using System.Web.DomainServices; using System.Web.Ria; using System.Xml; using log4net; using EarthquakeLocator.Web.Model;   namespace EarthquakeLocator.Web.Services {     /// <summary>     /// Provides earthquake data to client applications.     /// </summary>     [EnableClientAccess()]     public class EarthquakeService : DomainService     {         private static readonly ILog log = LogManager.GetLogger(typeof(EarthquakeService));           // USGS Data Feeds: http://earthquake.usgs.gov/earthquakes/catalogs/         private const string FeedForPreviousDay =             "http://earthquake.usgs.gov/earthquakes/catalogs/1day-M2.5.xml";         private const string FeedForPreviousWeek =             "http://earthquake.usgs.gov/earthquakes/catalogs/7day-M2.5.xml";           /// <summary>         /// Gets the earthquake data for the previous week.         /// </summary>         /// <returns>A queryable collection of <see cref="Earthquake"/> objects.</returns>         public IQueryable<Earthquake> GetEarthquakes()         {             var feed = GetFeed(FeedForPreviousWeek);             var list = new List<Earthquake>();               if ( feed != null )             {                 foreach ( var entry in feed.Items )                 {                     var quake = CreateEarthquake(entry);                     if ( quake != null )                     {                         list.Add(quake);                     }                 }             }               return list.AsQueryable();         }           /// <summary>         /// Creates an <see cref="Earthquake"/> object for each entry in the Atom feed.         /// </summary>         /// <param name="entry">The Atom entry.</param>         /// <returns></returns>         private Earthquake CreateEarthquake(SyndicationItem entry)         {             Earthquake quake = null;             string title = entry.Title.Text;             string summary = entry.Summary.Text;             string point = GetElementValue<String>(entry, "point");             string depth = GetElementValue<String>(entry, "elev");             string utcTime = null;             string localTime = null;             string depthDesc = null;             double? magnitude = null;             double? latitude = null;             double? longitude = null;             double? depthKm = null;               if ( !String.IsNullOrEmpty(title) && title.StartsWith("M") )             {                 title = title.Substring(2, title.IndexOf(',')-3).Trim();                 magnitude = TryParse(title);             }             if ( !String.IsNullOrEmpty(point) )             {                 var values = point.Split(' ');                 if ( values.Length == 2 )                 {                     latitude = TryParse(values[0]);                     longitude = TryParse(values[1]);                 }             }             if ( !String.IsNullOrEmpty(depth) )             {                 depthKm = TryParse(depth);                 if ( depthKm != null )                 {                     depthKm = Math.Round((-1 * depthKm.Value) / 100, 2);                 }             }             if ( !String.IsNullOrEmpty(summary) )             {                 summary = summary.Replace("</p>", "");                 var values = summary.Split(                     new string[] { "<p>" },                     StringSplitOptions.RemoveEmptyEntries);                   if ( values.Length == 3 )                 {                     var times = values[1].Split(                         new string[] { "<br>" },                         StringSplitOptions.RemoveEmptyEntries);                       if ( times.Length > 0 )                     {                         utcTime = times[0];                     }                     if ( times.Length > 1 )                     {                         localTime = times[1];                     }                       depthDesc = values[2];                     depthDesc = "Depth: " + depthDesc.Substring(depthDesc.IndexOf(":") + 2);                 }             }               if ( latitude != null && longitude != null )             {                 quake = new Earthquake()                 {                     Id = entry.Id,                     Title = entry.Title.Text,                     Summary = entry.Summary.Text,                     Date = entry.LastUpdatedTime.DateTime,                     Url = entry.Links.Select(l => Path.Combine(l.BaseUri.OriginalString,                         l.Uri.OriginalString)).FirstOrDefault(),                     Age = entry.Categories.Where(c => c.Label == "Age")                         .Select(c => c.Name).FirstOrDefault(),                     Magnitude = magnitude.GetValueOrDefault(),                     Latitude = latitude.GetValueOrDefault(),                     Longitude = longitude.GetValueOrDefault(),                     DepthInKm = depthKm.GetValueOrDefault(),                     DepthDesc = depthDesc,                     UtcTime = utcTime,                     LocalTime = localTime                 };             }               return quake;         }           private T GetElementValue<T>(SyndicationItem entry, String name)         {             var el = entry.ElementExtensions.Where(e => e.OuterName == name).FirstOrDefault();             T value = default(T);               if ( el != null )             {                 value = el.GetObject<T>();             }               return value;         }           private double? TryParse(String value)         {             double d;             if ( Double.TryParse(value, out d) )             {                 return d;             }             return null;         }           /// <summary>         /// Gets the feed at the specified URL.         /// </summary>         /// <param name="url">The URL.</param>         /// <returns>A <see cref="SyndicationFeed"/> object.</returns>         public static SyndicationFeed GetFeed(String url)         {             SyndicationFeed feed = null;               try             {                 log.Debug("Loading RSS feed: " + url);                   using ( var reader = XmlReader.Create(url) )                 {                     feed = SyndicationFeed.Load(reader);                 }             }             catch ( Exception ex )             {                 log.Error("Error occurred while loading RSS feed: " + url, ex);             }               return feed;         }     } }   The only method that will be generated in the client side proxy class, EarthquakeContext, will be the GetEarthquakes() method. The reason being that it is the only public instance method and it returns an IQueryable<Earthquake> collection that can be consumed by the client application. GetEarthquakes() calls the static GetFeed(String) method, which utilizes the built in SyndicationFeed API to load the external data feed. You will need to add a reference to the System.ServiceModel.Web library in order to take advantage of the RSS/Atom reader. The API will also allow you to create your own feeds to serve up in your applications. Model I have also created a Model folder and added a new class, Earthquake.cs. The Earthquake object will hold the various properties returned from the Atom feed. Here is a sample of the code for that class. Notice the [Key] attribute on the Id property, which is required by RIA Services to uniquely identify the entity. using System; using System.Collections.Generic; using System.Linq; using System.Runtime.Serialization; using System.ComponentModel.DataAnnotations;   namespace EarthquakeLocator.Web.Model {     /// <summary>     /// Represents an earthquake occurrence and related information.     /// </summary>     [DataContract]     public class Earthquake     {         /// <summary>         /// Gets or sets the id.         /// </summary>         /// <value>The id.</value>         [Key]         [DataMember]         public string Id { get; set; }           /// <summary>         /// Gets or sets the title.         /// </summary>         /// <value>The title.</value>         [DataMember]         public string Title { get; set; }           /// <summary>         /// Gets or sets the summary.         /// </summary>         /// <value>The summary.</value>         [DataMember]         public string Summary { get; set; }           // additional properties omitted     } }   View Model The recent trend to use the MVVM pattern for WPF and Silverlight provides a great way to separate the data and behavior logic out of the user interface layer of your client applications. I have chosen to use the MVVM Light Toolkit for the Earthquake Locator, but there are other options out there if you prefer another library. That said, I went ahead and created a ViewModel folder in the Silverlight project and added a EarthquakeViewModel class that derives from ViewModelBase. Here is the code: using System; using System.Collections.ObjectModel; using System.ComponentModel.Composition; using System.ComponentModel.Composition.Hosting; using Microsoft.Maps.MapControl; using GalaSoft.MvvmLight; using EarthquakeLocator.Web.Model; using EarthquakeLocator.Web.Services;   namespace EarthquakeLocator.ViewModel {     /// <summary>     /// Provides data for views displaying earthquake information.     /// </summary>     public class EarthquakeViewModel : ViewModelBase     {         [Import]         public EarthquakeContext Context;           /// <summary>         /// Initializes a new instance of the <see cref="EarthquakeViewModel"/> class.         /// </summary>         public EarthquakeViewModel()         {             var catalog = new AssemblyCatalog(GetType().Assembly);             var container = new CompositionContainer(catalog);             container.ComposeParts(this);             Initialize();         }           /// <summary>         /// Initializes a new instance of the <see cref="EarthquakeViewModel"/> class.         /// </summary>         /// <param name="context">The context.</param>         public EarthquakeViewModel(EarthquakeContext context)         {             Context = context;             Initialize();         }           private void Initialize()         {             MapCenter = new Location(20, -170);             ZoomLevel = 2;         }           #region Private Methods           private void OnAutoLoadDataChanged()         {             LoadEarthquakes();         }           private void LoadEarthquakes()         {             var query = Context.GetEarthquakesQuery();             Context.Earthquakes.Clear();               Context.Load(query, (op) =>             {                 if ( !op.HasError )                 {                     foreach ( var item in op.Entities )                     {                         Earthquakes.Add(item);                     }                 }             }, null);         }           #endregion Private Methods           #region Properties           private bool autoLoadData;         /// <summary>         /// Gets or sets a value indicating whether to auto load data.         /// </summary>         /// <value><c>true</c> if auto loading data; otherwise, <c>false</c>.</value>         public bool AutoLoadData         {             get { return autoLoadData; }             set             {                 if ( autoLoadData != value )                 {                     autoLoadData = value;                     RaisePropertyChanged("AutoLoadData");                     OnAutoLoadDataChanged();                 }             }         }           private ObservableCollection<Earthquake> earthquakes;         /// <summary>         /// Gets the collection of earthquakes to display.         /// </summary>         /// <value>The collection of earthquakes.</value>         public ObservableCollection<Earthquake> Earthquakes         {             get             {                 if ( earthquakes == null )                 {                     earthquakes = new ObservableCollection<Earthquake>();                 }                   return earthquakes;             }         }           private Location mapCenter;         /// <summary>         /// Gets or sets the map center.         /// </summary>         /// <value>The map center.</value>         public Location MapCenter         {             get { return mapCenter; }             set             {                 if ( mapCenter != value )                 {                     mapCenter = value;                     RaisePropertyChanged("MapCenter");                 }             }         }           private double zoomLevel;         /// <summary>         /// Gets or sets the zoom level.         /// </summary>         /// <value>The zoom level.</value>         public double ZoomLevel         {             get { return zoomLevel; }             set             {                 if ( zoomLevel != value )                 {                     zoomLevel = value;                     RaisePropertyChanged("ZoomLevel");                 }             }         }           #endregion Properties     } }   The EarthquakeViewModel class contains all of the properties that will be bound to by the various controls in our views. Be sure to read through the LoadEarthquakes() method, which handles calling the GetEarthquakes() method in our EarthquakeService via the EarthquakeContext proxy, and also transfers the loaded entities into the view model’s Earthquakes collection. Another thing to notice is what’s going on in the default constructor. I chose to use the Managed Extensibility Framework (MEF) for my composition needs, but you can use any dependency injection library or none at all. To allow the EarthquakeContext class to be discoverable by MEF, I added the following partial class so that I could supply the appropriate [Export] attribute: using System; using System.ComponentModel.Composition;   namespace EarthquakeLocator.Web.Services {     /// <summary>     /// The client side proxy for the EarthquakeService class.     /// </summary>     [Export]     public partial class EarthquakeContext     {     } }   One last piece I wanted to point out before moving on to the user interface, I added a client side partial class for the Earthquake entity that contains helper properties that we will bind to later: using System;   namespace EarthquakeLocator.Web.Model {     /// <summary>     /// Represents an earthquake occurrence and related information.     /// </summary>     public partial class Earthquake     {         /// <summary>         /// Gets the location based on the current Latitude/Longitude.         /// </summary>         /// <value>The location.</value>         public string Location         {             get { return String.Format("{0},{1}", Latitude, Longitude); }         }           /// <summary>         /// Gets the size based on the Magnitude.         /// </summary>         /// <value>The size.</value>         public double Size         {             get { return (Magnitude * 3); }         }     } }   View Now the fun part! Usually, I would create a Views folder to place all of my View controls in, but I took the easy way out and added the following XAML code to the default MainPage.xaml file. Be sure to add the bing prefix associating the Microsoft.Maps.MapControl namespace after adding the assembly reference to your project. The MVVM Light Toolkit project templates come with a ViewModelLocator class that you can use via a static resource, but I am instantiating the EarthquakeViewModel directly in my user control. I am setting the AutoLoadData property to true as a way to trigger the LoadEarthquakes() method call. The MapItemsControl found within the <bing:Map> control binds its ItemsSource property to the Earthquakes collection of the view model, and since it is an ObservableCollection<T>, we get the automatic two way data binding via the INotifyCollectionChanged interface. <UserControl x:Class="EarthquakeLocator.MainPage"     xmlns="http://schemas.microsoft.com/winfx/2006/xaml/presentation"     xmlns:x="http://schemas.microsoft.com/winfx/2006/xaml"     xmlns:d="http://schemas.microsoft.com/expression/blend/2008"     xmlns:mc="http://schemas.openxmlformats.org/markup-compatibility/2006"     xmlns:bing="clr-namespace:Microsoft.Maps.MapControl;assembly=Microsoft.Maps.MapControl"     xmlns:vm="clr-namespace:EarthquakeLocator.ViewModel"     mc:Ignorable="d" d:DesignWidth="640" d:DesignHeight="480" >     <UserControl.Resources>         <DataTemplate x:Key="EarthquakeTemplate">             <Ellipse Fill="Red" Stroke="Black" StrokeThickness="1"                      Width="{Binding Size}" Height="{Binding Size}"                      bing:MapLayer.Position="{Binding Location}"                      bing:MapLayer.PositionOrigin="Center">                 <ToolTipService.ToolTip>                     <StackPanel>                         <TextBlock Text="{Binding Title}" FontSize="14" FontWeight="Bold" />                         <TextBlock Text="{Binding UtcTime}" />                         <TextBlock Text="{Binding LocalTime}" />                         <TextBlock Text="{Binding DepthDesc}" />                     </StackPanel>                 </ToolTipService.ToolTip>             </Ellipse>         </DataTemplate>     </UserControl.Resources>       <UserControl.DataContext>         <vm:EarthquakeViewModel AutoLoadData="True" />     </UserControl.DataContext>       <Grid x:Name="LayoutRoot">           <bing:Map x:Name="map" CredentialsProvider="--Your-Bing-Maps-Key--"                   Center="{Binding MapCenter, Mode=TwoWay}"                   ZoomLevel="{Binding ZoomLevel, Mode=TwoWay}">             <bing:MapItemsControl ItemsSource="{Binding Earthquakes}"                                   ItemTemplate="{StaticResource EarthquakeTemplate}" />         </bing:Map>       </Grid> </UserControl>   The EarthquakeTemplate defines the Ellipse that will represent each earthquake, the Width and Height that are determined by the Magnitude, the Position on the map, and also the tooltip that will appear when we mouse over each data point. Running the application will give us the following result (shown with a tooltip example): That concludes this portion of our show but I plan on implementing additional functionality in later blog posts. Be sure to come back soon to see the next installments in this series. Enjoy!   Additional Resources USGS Earthquake Data Feeds Brad Abrams shows how RIA Services and MVVM can work together

    Read the article

  • Camera for 2.5D Game

    - by me--
    I'm hoping someone can explain this to me like I'm 5, because I've been struggling with this for hours and simply cannot understand what I'm doing wrong. I've written a Camera class for my 2.5D game. The intention is to support world and screen spaces like this: The camera is the black thing on the right. The +Z axis is upwards in that image, with -Z heading downwards. As you can see, both world space and screen space have (0, 0) at their top-left. I started writing some unit tests to prove that my camera was working as expected, and that's where things started getting...strange. My tests plot coordinates in world, view, and screen spaces. Eventually I will use image comparison to assert that they are correct, but for now my test just displays the result. The render logic uses Camera.ViewMatrix to transform world space to view space, and Camera.WorldPointToScreen to transform world space to screen space. Here is an example test: [Fact] public void foo() { var camera = new Camera(new Viewport(0, 0, 250, 100)); DrawingVisual worldRender; DrawingVisual viewRender; DrawingVisual screenRender; this.Render(camera, out worldRender, out viewRender, out screenRender, new Vector3(30, 0, 0), new Vector3(30, 40, 0)); this.ShowRenders(camera, worldRender, viewRender, screenRender); } And here's what pops up when I run this test: World space looks OK, although I suspect the z axis is going into the screen instead of towards the viewer. View space has me completely baffled. I was expecting the camera to be sitting above (0, 0) and looking towards the center of the scene. Instead, the z axis seems to be the wrong way around, and the camera is positioned in the opposite corner to what I expect! I suspect screen space will be another thing altogether, but can anyone explain what I'm doing wrong in my Camera class? UPDATE I made some progress in terms of getting things to look visually as I expect, but only through intuition: not an actual understanding of what I'm doing. Any enlightenment would be greatly appreciated. I realized that my view space was flipped both vertically and horizontally compared to what I expected, so I changed my view matrix to scale accordingly: this.viewMatrix = Matrix.CreateLookAt(this.location, this.target, this.up) * Matrix.CreateScale(this.zoom, this.zoom, 1) * Matrix.CreateScale(-1, -1, 1); I could combine the two CreateScale calls, but have left them separate for clarity. Again, I have no idea why this is necessary, but it fixed my view space: But now my screen space needs to be flipped vertically, so I modified my projection matrix accordingly: this.projectionMatrix = Matrix.CreatePerspectiveFieldOfView(0.7853982f, viewport.AspectRatio, 1, 2) * Matrix.CreateScale(1, -1, 1); And this results in what I was expecting from my first attempt: I have also just tried using Camera to render sprites via a SpriteBatch to make sure everything works there too, and it does. But the question remains: why do I need to do all this flipping of axes to get the space coordinates the way I expect? UPDATE 2 I've since improved my rendering logic in my test suite so that it supports geometries and so that lines get lighter the further away they are from the camera. I wanted to do this to avoid optical illusions and to further prove to myself that I'm looking at what I think I am. Here is an example: In this case, I have 3 geometries: a cube, a sphere, and a polyline on the top face of the cube. Notice how the darkening and lightening of the lines correctly identifies those portions of the geometries closer to the camera. If I remove the negative scaling I had to put in, I see: So you can see I'm still in the same boat - I still need those vertical and horizontal flips in my matrices to get things to appear correctly. In the interests of giving people a repro to play with, here is the complete code needed to generate the above. If you want to run via the test harness, just install the xunit package: Camera.cs: using Microsoft.Xna.Framework; using Microsoft.Xna.Framework.Graphics; using System.Diagnostics; public sealed class Camera { private readonly Viewport viewport; private readonly Matrix projectionMatrix; private Matrix? viewMatrix; private Vector3 location; private Vector3 target; private Vector3 up; private float zoom; public Camera(Viewport viewport) { this.viewport = viewport; // for an explanation of the negative scaling, see: http://gamedev.stackexchange.com/questions/63409/ this.projectionMatrix = Matrix.CreatePerspectiveFieldOfView(0.7853982f, viewport.AspectRatio, 1, 2) * Matrix.CreateScale(1, -1, 1); // defaults this.location = new Vector3(this.viewport.Width / 2, this.viewport.Height, 100); this.target = new Vector3(this.viewport.Width / 2, this.viewport.Height / 2, 0); this.up = new Vector3(0, 0, 1); this.zoom = 1; } public Viewport Viewport { get { return this.viewport; } } public Vector3 Location { get { return this.location; } set { this.location = value; this.viewMatrix = null; } } public Vector3 Target { get { return this.target; } set { this.target = value; this.viewMatrix = null; } } public Vector3 Up { get { return this.up; } set { this.up = value; this.viewMatrix = null; } } public float Zoom { get { return this.zoom; } set { this.zoom = value; this.viewMatrix = null; } } public Matrix ProjectionMatrix { get { return this.projectionMatrix; } } public Matrix ViewMatrix { get { if (this.viewMatrix == null) { // for an explanation of the negative scaling, see: http://gamedev.stackexchange.com/questions/63409/ this.viewMatrix = Matrix.CreateLookAt(this.location, this.target, this.up) * Matrix.CreateScale(this.zoom) * Matrix.CreateScale(-1, -1, 1); } return this.viewMatrix.Value; } } public Vector2 WorldPointToScreen(Vector3 point) { var result = viewport.Project(point, this.ProjectionMatrix, this.ViewMatrix, Matrix.Identity); return new Vector2(result.X, result.Y); } public void WorldPointsToScreen(Vector3[] points, Vector2[] destination) { Debug.Assert(points != null); Debug.Assert(destination != null); Debug.Assert(points.Length == destination.Length); for (var i = 0; i < points.Length; ++i) { destination[i] = this.WorldPointToScreen(points[i]); } } } CameraFixture.cs: using Microsoft.Xna.Framework.Graphics; using System; using System.Collections.Generic; using System.Linq; using System.Windows; using System.Windows.Controls; using System.Windows.Media; using Xunit; using XNA = Microsoft.Xna.Framework; public sealed class CameraFixture { [Fact] public void foo() { var camera = new Camera(new Viewport(0, 0, 250, 100)); DrawingVisual worldRender; DrawingVisual viewRender; DrawingVisual screenRender; this.Render( camera, out worldRender, out viewRender, out screenRender, new Sphere(30, 15) { WorldMatrix = XNA.Matrix.CreateTranslation(155, 50, 0) }, new Cube(30) { WorldMatrix = XNA.Matrix.CreateTranslation(75, 60, 15) }, new PolyLine(new XNA.Vector3(0, 0, 0), new XNA.Vector3(10, 10, 0), new XNA.Vector3(20, 0, 0), new XNA.Vector3(0, 0, 0)) { WorldMatrix = XNA.Matrix.CreateTranslation(65, 55, 30) }); this.ShowRenders(worldRender, viewRender, screenRender); } #region Supporting Fields private static readonly Pen xAxisPen = new Pen(Brushes.Red, 2); private static readonly Pen yAxisPen = new Pen(Brushes.Green, 2); private static readonly Pen zAxisPen = new Pen(Brushes.Blue, 2); private static readonly Pen viewportPen = new Pen(Brushes.Gray, 1); private static readonly Pen nonScreenSpacePen = new Pen(Brushes.Black, 0.5); private static readonly Color geometryBaseColor = Colors.Black; #endregion #region Supporting Methods private void Render(Camera camera, out DrawingVisual worldRender, out DrawingVisual viewRender, out DrawingVisual screenRender, params Geometry[] geometries) { var worldDrawingVisual = new DrawingVisual(); var viewDrawingVisual = new DrawingVisual(); var screenDrawingVisual = new DrawingVisual(); const int axisLength = 15; using (var worldDrawingContext = worldDrawingVisual.RenderOpen()) using (var viewDrawingContext = viewDrawingVisual.RenderOpen()) using (var screenDrawingContext = screenDrawingVisual.RenderOpen()) { // draw lines around the camera's viewport var viewportBounds = camera.Viewport.Bounds; var viewportLines = new Tuple<int, int, int, int>[] { Tuple.Create(viewportBounds.Left, viewportBounds.Bottom, viewportBounds.Left, viewportBounds.Top), Tuple.Create(viewportBounds.Left, viewportBounds.Top, viewportBounds.Right, viewportBounds.Top), Tuple.Create(viewportBounds.Right, viewportBounds.Top, viewportBounds.Right, viewportBounds.Bottom), Tuple.Create(viewportBounds.Right, viewportBounds.Bottom, viewportBounds.Left, viewportBounds.Bottom) }; foreach (var viewportLine in viewportLines) { var viewStart = XNA.Vector3.Transform(new XNA.Vector3(viewportLine.Item1, viewportLine.Item2, 0), camera.ViewMatrix); var viewEnd = XNA.Vector3.Transform(new XNA.Vector3(viewportLine.Item3, viewportLine.Item4, 0), camera.ViewMatrix); var screenStart = camera.WorldPointToScreen(new XNA.Vector3(viewportLine.Item1, viewportLine.Item2, 0)); var screenEnd = camera.WorldPointToScreen(new XNA.Vector3(viewportLine.Item3, viewportLine.Item4, 0)); worldDrawingContext.DrawLine(viewportPen, new Point(viewportLine.Item1, viewportLine.Item2), new Point(viewportLine.Item3, viewportLine.Item4)); viewDrawingContext.DrawLine(viewportPen, new Point(viewStart.X, viewStart.Y), new Point(viewEnd.X, viewEnd.Y)); screenDrawingContext.DrawLine(viewportPen, new Point(screenStart.X, screenStart.Y), new Point(screenEnd.X, screenEnd.Y)); } // draw axes var axisLines = new Tuple<int, int, int, int, int, int, Pen>[] { Tuple.Create(0, 0, 0, axisLength, 0, 0, xAxisPen), Tuple.Create(0, 0, 0, 0, axisLength, 0, yAxisPen), Tuple.Create(0, 0, 0, 0, 0, axisLength, zAxisPen) }; foreach (var axisLine in axisLines) { var viewStart = XNA.Vector3.Transform(new XNA.Vector3(axisLine.Item1, axisLine.Item2, axisLine.Item3), camera.ViewMatrix); var viewEnd = XNA.Vector3.Transform(new XNA.Vector3(axisLine.Item4, axisLine.Item5, axisLine.Item6), camera.ViewMatrix); var screenStart = camera.WorldPointToScreen(new XNA.Vector3(axisLine.Item1, axisLine.Item2, axisLine.Item3)); var screenEnd = camera.WorldPointToScreen(new XNA.Vector3(axisLine.Item4, axisLine.Item5, axisLine.Item6)); worldDrawingContext.DrawLine(axisLine.Item7, new Point(axisLine.Item1, axisLine.Item2), new Point(axisLine.Item4, axisLine.Item5)); viewDrawingContext.DrawLine(axisLine.Item7, new Point(viewStart.X, viewStart.Y), new Point(viewEnd.X, viewEnd.Y)); screenDrawingContext.DrawLine(axisLine.Item7, new Point(screenStart.X, screenStart.Y), new Point(screenEnd.X, screenEnd.Y)); } // for all points in all geometries to be rendered, find the closest and furthest away from the camera so we can lighten lines that are further away var distancesToAllGeometrySections = from geometry in geometries let geometryViewMatrix = geometry.WorldMatrix * camera.ViewMatrix from section in geometry.Sections from point in new XNA.Vector3[] { section.Item1, section.Item2 } let viewPoint = XNA.Vector3.Transform(point, geometryViewMatrix) select viewPoint.Length(); var furthestDistance = distancesToAllGeometrySections.Max(); var closestDistance = distancesToAllGeometrySections.Min(); var deltaDistance = Math.Max(0.000001f, furthestDistance - closestDistance); // draw each geometry for (var i = 0; i < geometries.Length; ++i) { var geometry = geometries[i]; // there's probably a more correct name for this, but basically this gets the geometry relative to the camera so we can check how far away each point is from the camera var geometryViewMatrix = geometry.WorldMatrix * camera.ViewMatrix; // we order roughly by those sections furthest from the camera to those closest, so that the closer ones "overwrite" the ones further away var orderedSections = from section in geometry.Sections let startPointRelativeToCamera = XNA.Vector3.Transform(section.Item1, geometryViewMatrix) let endPointRelativeToCamera = XNA.Vector3.Transform(section.Item2, geometryViewMatrix) let startPointDistance = startPointRelativeToCamera.Length() let endPointDistance = endPointRelativeToCamera.Length() orderby (startPointDistance + endPointDistance) descending select new { Section = section, DistanceToStart = startPointDistance, DistanceToEnd = endPointDistance }; foreach (var orderedSection in orderedSections) { var start = XNA.Vector3.Transform(orderedSection.Section.Item1, geometry.WorldMatrix); var end = XNA.Vector3.Transform(orderedSection.Section.Item2, geometry.WorldMatrix); var viewStart = XNA.Vector3.Transform(start, camera.ViewMatrix); var viewEnd = XNA.Vector3.Transform(end, camera.ViewMatrix); worldDrawingContext.DrawLine(nonScreenSpacePen, new Point(start.X, start.Y), new Point(end.X, end.Y)); viewDrawingContext.DrawLine(nonScreenSpacePen, new Point(viewStart.X, viewStart.Y), new Point(viewEnd.X, viewEnd.Y)); // screen rendering is more complicated purely because I wanted geometry to fade the further away it is from the camera // otherwise, it's very hard to tell whether the rendering is actually correct or not var startDistanceRatio = (orderedSection.DistanceToStart - closestDistance) / deltaDistance; var endDistanceRatio = (orderedSection.DistanceToEnd - closestDistance) / deltaDistance; // lerp towards white based on distance from camera, but only to a maximum of 90% var startColor = Lerp(geometryBaseColor, Colors.White, startDistanceRatio * 0.9f); var endColor = Lerp(geometryBaseColor, Colors.White, endDistanceRatio * 0.9f); var screenStart = camera.WorldPointToScreen(start); var screenEnd = camera.WorldPointToScreen(end); var brush = new LinearGradientBrush { StartPoint = new Point(screenStart.X, screenStart.Y), EndPoint = new Point(screenEnd.X, screenEnd.Y), MappingMode = BrushMappingMode.Absolute }; brush.GradientStops.Add(new GradientStop(startColor, 0)); brush.GradientStops.Add(new GradientStop(endColor, 1)); var pen = new Pen(brush, 1); brush.Freeze(); pen.Freeze(); screenDrawingContext.DrawLine(pen, new Point(screenStart.X, screenStart.Y), new Point(screenEnd.X, screenEnd.Y)); } } } worldRender = worldDrawingVisual; viewRender = viewDrawingVisual; screenRender = screenDrawingVisual; } private static float Lerp(float start, float end, float amount) { var difference = end - start; var adjusted = difference * amount; return start + adjusted; } private static Color Lerp(Color color, Color to, float amount) { var sr = color.R; var sg = color.G; var sb = color.B; var er = to.R; var eg = to.G; var eb = to.B; var r = (byte)Lerp(sr, er, amount); var g = (byte)Lerp(sg, eg, amount); var b = (byte)Lerp(sb, eb, amount); return Color.FromArgb(255, r, g, b); } private void ShowRenders(DrawingVisual worldRender, DrawingVisual viewRender, DrawingVisual screenRender) { var itemsControl = new ItemsControl(); itemsControl.Items.Add(new HeaderedContentControl { Header = "World", Content = new DrawingVisualHost(worldRender)}); itemsControl.Items.Add(new HeaderedContentControl { Header = "View", Content = new DrawingVisualHost(viewRender) }); itemsControl.Items.Add(new HeaderedContentControl { Header = "Screen", Content = new DrawingVisualHost(screenRender) }); var window = new Window { Title = "Renders", Content = itemsControl, ShowInTaskbar = true, SizeToContent = SizeToContent.WidthAndHeight }; window.ShowDialog(); } #endregion #region Supporting Types // stupidly simple 3D geometry class, consisting of a series of sections that will be connected by lines private abstract class Geometry { public abstract IEnumerable<Tuple<XNA.Vector3, XNA.Vector3>> Sections { get; } public XNA.Matrix WorldMatrix { get; set; } } private sealed class Line : Geometry { private readonly XNA.Vector3 magnitude; public Line(XNA.Vector3 magnitude) { this.magnitude = magnitude; } public override IEnumerable<Tuple<XNA.Vector3, XNA.Vector3>> Sections { get { yield return Tuple.Create(XNA.Vector3.Zero, this.magnitude); } } } private sealed class PolyLine : Geometry { private readonly XNA.Vector3[] points; public PolyLine(params XNA.Vector3[] points) { this.points = points; } public override IEnumerable<Tuple<XNA.Vector3, XNA.Vector3>> Sections { get { if (this.points.Length < 2) { yield break; } var end = this.points[0]; for (var i = 1; i < this.points.Length; ++i) { var start = end; end = this.points[i]; yield return Tuple.Create(start, end); } } } } private sealed class Cube : Geometry { private readonly float size; public Cube(float size) { this.size = size; } public override IEnumerable<Tuple<XNA.Vector3, XNA.Vector3>> Sections { get { var halfSize = this.size / 2; var frontBottomLeft = new XNA.Vector3(-halfSize, halfSize, -halfSize); var frontBottomRight = new XNA.Vector3(halfSize, halfSize, -halfSize); var frontTopLeft = new XNA.Vector3(-halfSize, halfSize, halfSize); var frontTopRight = new XNA.Vector3(halfSize, halfSize, halfSize); var backBottomLeft = new XNA.Vector3(-halfSize, -halfSize, -halfSize); var backBottomRight = new XNA.Vector3(halfSize, -halfSize, -halfSize); var backTopLeft = new XNA.Vector3(-halfSize, -halfSize, halfSize); var backTopRight = new XNA.Vector3(halfSize, -halfSize, halfSize); // front face yield return Tuple.Create(frontBottomLeft, frontBottomRight); yield return Tuple.Create(frontBottomLeft, frontTopLeft); yield return Tuple.Create(frontTopLeft, frontTopRight); yield return Tuple.Create(frontTopRight, frontBottomRight); // left face yield return Tuple.Create(frontTopLeft, backTopLeft); yield return Tuple.Create(backTopLeft, backBottomLeft); yield return Tuple.Create(backBottomLeft, frontBottomLeft); // right face yield return Tuple.Create(frontTopRight, backTopRight); yield return Tuple.Create(backTopRight, backBottomRight); yield return Tuple.Create(backBottomRight, frontBottomRight); // back face yield return Tuple.Create(backBottomLeft, backBottomRight); yield return Tuple.Create(backTopLeft, backTopRight); } } } private sealed class Sphere : Geometry { private readonly float radius; private readonly int subsections; public Sphere(float radius, int subsections) { this.radius = radius; this.subsections = subsections; } public override IEnumerable<Tuple<XNA.Vector3, XNA.Vector3>> Sections { get { var latitudeLines = this.subsections; var longitudeLines = this.subsections; // see http://stackoverflow.com/a/4082020/5380 var results = from latitudeLine in Enumerable.Range(0, latitudeLines) from longitudeLine in Enumerable.Range(0, longitudeLines) let latitudeRatio = latitudeLine / (float)latitudeLines let longitudeRatio = longitudeLine / (float)longitudeLines let nextLatitudeRatio = (latitudeLine + 1) / (float)latitudeLines let nextLongitudeRatio = (longitudeLine + 1) / (float)longitudeLines let z1 = Math.Cos(Math.PI * latitudeRatio) let z2 = Math.Cos(Math.PI * nextLatitudeRatio) let x1 = Math.Sin(Math.PI * latitudeRatio) * Math.Cos(Math.PI * 2 * longitudeRatio) let y1 = Math.Sin(Math.PI * latitudeRatio) * Math.Sin(Math.PI * 2 * longitudeRatio) let x2 = Math.Sin(Math.PI * nextLatitudeRatio) * Math.Cos(Math.PI * 2 * longitudeRatio) let y2 = Math.Sin(Math.PI * nextLatitudeRatio) * Math.Sin(Math.PI * 2 * longitudeRatio) let x3 = Math.Sin(Math.PI * latitudeRatio) * Math.Cos(Math.PI * 2 * nextLongitudeRatio) let y3 = Math.Sin(Math.PI * latitudeRatio) * Math.Sin(Math.PI * 2 * nextLongitudeRatio) let start = new XNA.Vector3((float)x1 * radius, (float)y1 * radius, (float)z1 * radius) let firstEnd = new XNA.Vector3((float)x2 * radius, (float)y2 * radius, (float)z2 * radius) let secondEnd = new XNA.Vector3((float)x3 * radius, (float)y3 * radius, (float)z1 * radius) select new { First = Tuple.Create(start, firstEnd), Second = Tuple.Create(start, secondEnd) }; foreach (var result in results) { yield return result.First; yield return result.Second; } } } } #endregion }

    Read the article

  • Fixing the Model Binding issue of ASP.NET MVC 4 and ASP.NET Web API

    - by imran_ku07
            Introduction:                     Yesterday when I was checking ASP.NET forums, I found an important issue/bug in ASP.NET MVC 4 and ASP.NET Web API. The issue is present in System.Web.PrefixContainer class which is used by both ASP.NET MVC and ASP.NET Web API assembly. The details of this issue is available in this thread. This bug can be a breaking change for you if you upgraded your application to ASP.NET MVC 4 and your application model properties using the convention available in the above thread. So, I have created a package which will fix this issue both in ASP.NET MVC and ASP.NET Web API. In this article, I will show you how to use this package.           Description:                     Create or open an ASP.NET MVC 4 project and install ImranB.ModelBindingFix NuGet package. Then, add this using statement on your global.asax.cs file, using ImranB.ModelBindingFix;                     Then, just add this line in Application_Start method,   Fixer.FixModelBindingIssue(); // For fixing only in MVC call this //Fixer.FixMvcModelBindingIssue(); // For fixing only in Web API call this //Fixer.FixWebApiModelBindingIssue(); .                     This line will fix the model binding issue. If you are using Html.Action or Html.RenderAction then you should use Html.FixedAction or Html.FixedRenderAction instead to avoid this bug(make sure to reference ImranB.ModelBindingFix.SystemWebMvc namespace). If you are using FormDataCollection.ReadAs extension method then you should use FormDataCollection.FixedReadAs instead to avoid this bug(make sure to reference ImranB.ModelBindingFix.SystemWebHttp namespace). The source code of this package is available at github.          Summary:                     There is a small but important issue/bug in ASP.NET MVC 4. In this article, I showed you how to fix this issue/bug by using a package. Hopefully you will enjoy this article too.

    Read the article

  • Creating Custom Ajax Control Toolkit Controls

    - by Stephen Walther
    The goal of this blog entry is to explain how you can extend the Ajax Control Toolkit with custom Ajax Control Toolkit controls. I describe how you can create the two halves of an Ajax Control Toolkit control: the server-side control extender and the client-side control behavior. Finally, I explain how you can use the new Ajax Control Toolkit control in a Web Forms page. At the end of this blog entry, there is a link to download a Visual Studio 2010 solution which contains the code for two Ajax Control Toolkit controls: SampleExtender and PopupHelpExtender. The SampleExtender contains the minimum skeleton for creating a new Ajax Control Toolkit control. You can use the SampleExtender as a starting point for your custom Ajax Control Toolkit controls. The PopupHelpExtender control is a super simple custom Ajax Control Toolkit control. This control extender displays a help message when you start typing into a TextBox control. The animated GIF below demonstrates what happens when you click into a TextBox which has been extended with the PopupHelp extender. Here’s a sample of a Web Forms page which uses the control: <%@ Page Language="C#" AutoEventWireup="true" CodeBehind="ShowPopupHelp.aspx.cs" Inherits="MyACTControls.Web.Default" %> <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html > <head runat="server"> <title>Show Popup Help</title> </head> <body> <form id="form1" runat="server"> <div> <act:ToolkitScriptManager ID="tsm" runat="server" /> <%-- Social Security Number --%> <asp:Label ID="lblSSN" Text="SSN:" AssociatedControlID="txtSSN" runat="server" /> <asp:TextBox ID="txtSSN" runat="server" /> <act:PopupHelpExtender id="ph1" TargetControlID="txtSSN" HelpText="Please enter your social security number." runat="server" /> <%-- Social Security Number --%> <asp:Label ID="lblPhone" Text="Phone Number:" AssociatedControlID="txtPhone" runat="server" /> <asp:TextBox ID="txtPhone" runat="server" /> <act:PopupHelpExtender id="ph2" TargetControlID="txtPhone" HelpText="Please enter your phone number." runat="server" /> </div> </form> </body> </html> In the page above, the PopupHelp extender is used to extend the functionality of the two TextBox controls. When focus is given to a TextBox control, the popup help message is displayed. An Ajax Control Toolkit control extender consists of two parts: a server-side control extender and a client-side behavior. For example, the PopupHelp extender consists of a server-side PopupHelpExtender control (PopupHelpExtender.cs) and a client-side PopupHelp behavior JavaScript script (PopupHelpBehavior.js). Over the course of this blog entry, I describe how you can create both the server-side extender and the client-side behavior. Writing the Server-Side Code Creating a Control Extender You create a control extender by creating a class that inherits from the abstract ExtenderControlBase class. For example, the PopupHelpExtender control is declared like this: public class PopupHelpExtender: ExtenderControlBase { } The ExtenderControlBase class is part of the Ajax Control Toolkit. This base class contains all of the common server properties and methods of every Ajax Control Toolkit extender control. The ExtenderControlBase class inherits from the ExtenderControl class. The ExtenderControl class is a standard class in the ASP.NET framework located in the System.Web.UI namespace. This class is responsible for generating a client-side behavior. The class generates a call to the Microsoft Ajax Library $create() method which looks like this: <script type="text/javascript"> $create(MyACTControls.PopupHelpBehavior, {"HelpText":"Please enter your social security number.","id":"ph1"}, null, null, $get("txtSSN")); }); </script> The JavaScript $create() method is part of the Microsoft Ajax Library. The reference for this method can be found here: http://msdn.microsoft.com/en-us/library/bb397487.aspx This method accepts the following parameters: type – The type of client behavior to create. The $create() method above creates a client PopupHelpBehavior. Properties – Enables you to pass initial values for the properties of the client behavior. For example, the initial value of the HelpText property. This is how server property values are passed to the client. Events – Enables you to pass client-side event handlers to the client behavior. References – Enables you to pass references to other client components. Element – The DOM element associated with the client behavior. This will be the DOM element associated with the control being extended such as the txtSSN TextBox. The $create() method is generated for you automatically. You just need to focus on writing the server-side control extender class. Specifying the Target Control All Ajax Control Toolkit extenders inherit a TargetControlID property from the ExtenderControlBase class. This property, the TargetControlID property, points at the control that the extender control extends. For example, the Ajax Control Toolkit TextBoxWatermark control extends a TextBox, the ConfirmButton control extends a Button, and the Calendar control extends a TextBox. You must indicate the type of control which your extender is extending. You indicate the type of control by adding a [TargetControlType] attribute to your control. For example, the PopupHelp extender is declared like this: [TargetControlType(typeof(TextBox))] public class PopupHelpExtender: ExtenderControlBase { } The PopupHelp extender can be used to extend a TextBox control. If you try to use the PopupHelp extender with another type of control then an exception is thrown. If you want to create an extender control which can be used with any type of ASP.NET control (Button, DataView, TextBox or whatever) then use the following attribute: [TargetControlType(typeof(Control))] Decorating Properties with Attributes If you decorate a server-side property with the [ExtenderControlProperty] attribute then the value of the property gets passed to the control’s client-side behavior. The value of the property gets passed to the client through the $create() method discussed above. The PopupHelp control contains the following HelpText property: [ExtenderControlProperty] [RequiredProperty] public string HelpText { get { return GetPropertyValue("HelpText", "Help Text"); } set { SetPropertyValue("HelpText", value); } } The HelpText property determines the help text which pops up when you start typing into a TextBox control. Because the HelpText property is decorated with the [ExtenderControlProperty] attribute, any value assigned to this property on the server is passed to the client automatically. For example, if you declare the PopupHelp extender in a Web Form page like this: <asp:TextBox ID="txtSSN" runat="server" /> <act:PopupHelpExtender id="ph1" TargetControlID="txtSSN" HelpText="Please enter your social security number." runat="server" />   Then the PopupHelpExtender renders the call to the the following Microsoft Ajax Library $create() method: $create(MyACTControls.PopupHelpBehavior, {"HelpText":"Please enter your social security number.","id":"ph1"}, null, null, $get("txtSSN")); You can see this call to the JavaScript $create() method by selecting View Source in your browser. This call to the $create() method calls a method named set_HelpText() automatically and passes the value “Please enter your social security number”. There are several attributes which you can use to decorate server-side properties including: ExtenderControlProperty – When a property is marked with this attribute, the value of the property is passed to the client automatically. ExtenderControlEvent – When a property is marked with this attribute, the property represents a client event handler. Required – When a value is not assigned to this property on the server, an error is displayed. DefaultValue – The default value of the property passed to the client. ClientPropertyName – The name of the corresponding property in the JavaScript behavior. For example, the server-side property is named ID (uppercase) and the client-side property is named id (lower-case). IDReferenceProperty – Applied to properties which refer to the IDs of other controls. URLProperty – Calls ResolveClientURL() to convert from a server-side URL to a URL which can be used on the client. ElementReference – Returns a reference to a DOM element by performing a client $get(). The WebResource, ClientResource, and the RequiredScript Attributes The PopupHelp extender uses three embedded resources named PopupHelpBehavior.js, PopupHelpBehavior.debug.js, and PopupHelpBehavior.css. The first two files are JavaScript files and the final file is a Cascading Style sheet file. These files are compiled as embedded resources. You don’t need to mark them as embedded resources in your Visual Studio solution because they get added to the assembly when the assembly is compiled by a build task. You can see that these files get embedded into the MyACTControls assembly by using Red Gate’s .NET Reflector tool: In order to use these files with the PopupHelp extender, you need to work with both the WebResource and the ClientScriptResource attributes. The PopupHelp extender includes the following three WebResource attributes. [assembly: WebResource("PopupHelp.PopupHelpBehavior.js", "text/javascript")] [assembly: WebResource("PopupHelp.PopupHelpBehavior.debug.js", "text/javascript")] [assembly: WebResource("PopupHelp.PopupHelpBehavior.css", "text/css", PerformSubstitution = true)] These WebResource attributes expose the embedded resource from the assembly so that they can be accessed by using the ScriptResource.axd or WebResource.axd handlers. The first parameter passed to the WebResource attribute is the name of the embedded resource and the second parameter is the content type of the embedded resource. The PopupHelp extender also includes the following ClientScriptResource and ClientCssResource attributes: [ClientScriptResource("MyACTControls.PopupHelpBehavior", "PopupHelp.PopupHelpBehavior.js")] [ClientCssResource("PopupHelp.PopupHelpBehavior.css")] Including these attributes causes the PopupHelp extender to request these resources when you add the PopupHelp extender to a page. If you open View Source in a browser which uses the PopupHelp extender then you will see the following link for the Cascading Style Sheet file: <link href="/WebResource.axd?d=0uONMsWXUuEDG-pbJHAC1kuKiIMteQFkYLmZdkgv7X54TObqYoqVzU4mxvaa4zpn5H9ch0RDwRYKwtO8zM5mKgO6C4WbrbkWWidKR07LD1d4n4i_uNB1mHEvXdZu2Ae5mDdVNDV53znnBojzCzwvSw2&amp;t=634417392021676003" type="text/css" rel="stylesheet" /> You also will see the following script include for the JavaScript file: <script src="/ScriptResource.axd?d=pIS7xcGaqvNLFBvExMBQSp_0xR3mpDfS0QVmmyu1aqDUjF06TrW1jVDyXNDMtBHxpRggLYDvgFTWOsrszflZEDqAcQCg-hDXjun7ON0Ol7EXPQIdOe1GLMceIDv3OeX658-tTq2LGdwXhC1-dE7_6g2&amp;t=ffffffff88a33b59" type="text/javascript"></script> The JavaScrpt file returned by this request to ScriptResource.axd contains the combined scripts for any and all Ajax Control Toolkit controls in a page. By default, the Ajax Control Toolkit combines all of the JavaScript files required by a page into a single JavaScript file. Combining files in this way really speeds up how quickly all of the JavaScript files get delivered from the web server to the browser. So, by default, there will be only one ScriptResource.axd include for all of the JavaScript files required by a page. If you want to disable Script Combining, and create separate links, then disable Script Combining like this: <act:ToolkitScriptManager ID="tsm" runat="server" CombineScripts="false" /> There is one more important attribute used by Ajax Control Toolkit extenders. The PopupHelp behavior uses the following two RequirdScript attributes to load the JavaScript files which are required by the PopupHelp behavior: [RequiredScript(typeof(CommonToolkitScripts), 0)] [RequiredScript(typeof(PopupExtender), 1)] The first parameter of the RequiredScript attribute represents either the string name of a JavaScript file or the type of an Ajax Control Toolkit control. The second parameter represents the order in which the JavaScript files are loaded (This second parameter is needed because .NET attributes are intrinsically unordered). In this case, the RequiredScript attribute will load the JavaScript files associated with the CommonToolkitScripts type and the JavaScript files associated with the PopupExtender in that order. The PopupHelp behavior depends on these JavaScript files. Writing the Client-Side Code The PopupHelp extender uses a client-side behavior written with the Microsoft Ajax Library. Here is the complete code for the client-side behavior: (function () { // The unique name of the script registered with the // client script loader var scriptName = "PopupHelpBehavior"; function execute() { Type.registerNamespace('MyACTControls'); MyACTControls.PopupHelpBehavior = function (element) { /// <summary> /// A behavior which displays popup help for a textbox /// </summmary> /// <param name="element" type="Sys.UI.DomElement">The element to attach to</param> MyACTControls.PopupHelpBehavior.initializeBase(this, [element]); this._textbox = Sys.Extended.UI.TextBoxWrapper.get_Wrapper(element); this._cssClass = "ajax__popupHelp"; this._popupBehavior = null; this._popupPosition = Sys.Extended.UI.PositioningMode.BottomLeft; this._popupDiv = null; this._helpText = "Help Text"; this._element$delegates = { focus: Function.createDelegate(this, this._element_onfocus), blur: Function.createDelegate(this, this._element_onblur) }; } MyACTControls.PopupHelpBehavior.prototype = { initialize: function () { MyACTControls.PopupHelpBehavior.callBaseMethod(this, 'initialize'); // Add event handlers for focus and blur var element = this.get_element(); $addHandlers(element, this._element$delegates); }, _ensurePopup: function () { if (!this._popupDiv) { var element = this.get_element(); var id = this.get_id(); this._popupDiv = $common.createElementFromTemplate({ nodeName: "div", properties: { id: id + "_popupDiv" }, cssClasses: ["ajax__popupHelp"] }, element.parentNode); this._popupBehavior = new $create(Sys.Extended.UI.PopupBehavior, { parentElement: element }, {}, {}, this._popupDiv); this._popupBehavior.set_positioningMode(this._popupPosition); } }, get_HelpText: function () { return this._helpText; }, set_HelpText: function (value) { if (this._HelpText != value) { this._helpText = value; this._ensurePopup(); this._popupDiv.innerHTML = value; this.raisePropertyChanged("Text") } }, _element_onfocus: function (e) { this.show(); }, _element_onblur: function (e) { this.hide(); }, show: function () { this._popupBehavior.show(); }, hide: function () { if (this._popupBehavior) { this._popupBehavior.hide(); } }, dispose: function() { var element = this.get_element(); $clearHandlers(element); if (this._popupBehavior) { this._popupBehavior.dispose(); this._popupBehavior = null; } } }; MyACTControls.PopupHelpBehavior.registerClass('MyACTControls.PopupHelpBehavior', Sys.Extended.UI.BehaviorBase); Sys.registerComponent(MyACTControls.PopupHelpBehavior, { name: "popupHelp" }); } // execute if (window.Sys && Sys.loader) { Sys.loader.registerScript(scriptName, ["ExtendedBase", "ExtendedCommon"], execute); } else { execute(); } })();   In the following sections, we’ll discuss how this client-side behavior works. Wrapping the Behavior for the Script Loader The behavior is wrapped with the following script: (function () { // The unique name of the script registered with the // client script loader var scriptName = "PopupHelpBehavior"; function execute() { // Behavior Content } // execute if (window.Sys && Sys.loader) { Sys.loader.registerScript(scriptName, ["ExtendedBase", "ExtendedCommon"], execute); } else { execute(); } })(); This code is required by the Microsoft Ajax Library Script Loader. You need this code if you plan to use a behavior directly from client-side code and you want to use the Script Loader. If you plan to only use your code in the context of the Ajax Control Toolkit then you can leave out this code. Registering a JavaScript Namespace The PopupHelp behavior is declared within a namespace named MyACTControls. In the code above, this namespace is created with the following registerNamespace() method: Type.registerNamespace('MyACTControls'); JavaScript does not have any built-in way of creating namespaces to prevent naming conflicts. The Microsoft Ajax Library extends JavaScript with support for namespaces. You can learn more about the registerNamespace() method here: http://msdn.microsoft.com/en-us/library/bb397723.aspx Creating the Behavior The actual Popup behavior is created with the following code. MyACTControls.PopupHelpBehavior = function (element) { /// <summary> /// A behavior which displays popup help for a textbox /// </summmary> /// <param name="element" type="Sys.UI.DomElement">The element to attach to</param> MyACTControls.PopupHelpBehavior.initializeBase(this, [element]); this._textbox = Sys.Extended.UI.TextBoxWrapper.get_Wrapper(element); this._cssClass = "ajax__popupHelp"; this._popupBehavior = null; this._popupPosition = Sys.Extended.UI.PositioningMode.BottomLeft; this._popupDiv = null; this._helpText = "Help Text"; this._element$delegates = { focus: Function.createDelegate(this, this._element_onfocus), blur: Function.createDelegate(this, this._element_onblur) }; } MyACTControls.PopupHelpBehavior.prototype = { initialize: function () { MyACTControls.PopupHelpBehavior.callBaseMethod(this, 'initialize'); // Add event handlers for focus and blur var element = this.get_element(); $addHandlers(element, this._element$delegates); }, _ensurePopup: function () { if (!this._popupDiv) { var element = this.get_element(); var id = this.get_id(); this._popupDiv = $common.createElementFromTemplate({ nodeName: "div", properties: { id: id + "_popupDiv" }, cssClasses: ["ajax__popupHelp"] }, element.parentNode); this._popupBehavior = new $create(Sys.Extended.UI.PopupBehavior, { parentElement: element }, {}, {}, this._popupDiv); this._popupBehavior.set_positioningMode(this._popupPosition); } }, get_HelpText: function () { return this._helpText; }, set_HelpText: function (value) { if (this._HelpText != value) { this._helpText = value; this._ensurePopup(); this._popupDiv.innerHTML = value; this.raisePropertyChanged("Text") } }, _element_onfocus: function (e) { this.show(); }, _element_onblur: function (e) { this.hide(); }, show: function () { this._popupBehavior.show(); }, hide: function () { if (this._popupBehavior) { this._popupBehavior.hide(); } }, dispose: function() { var element = this.get_element(); $clearHandlers(element); if (this._popupBehavior) { this._popupBehavior.dispose(); this._popupBehavior = null; } } }; The code above has two parts. The first part of the code is used to define the constructor function for the PopupHelp behavior. This is a factory method which returns an instance of a PopupHelp behavior: MyACTControls.PopupHelpBehavior = function (element) { } The second part of the code modified the prototype for the PopupHelp behavior: MyACTControls.PopupHelpBehavior.prototype = { } Any code which is particular to a single instance of the PopupHelp behavior should be placed in the constructor function. For example, the default value of the _helpText field is assigned in the constructor function: this._helpText = "Help Text"; Any code which is shared among all instances of the PopupHelp behavior should be added to the PopupHelp behavior’s prototype. For example, the public HelpText property is added to the prototype: get_HelpText: function () { return this._helpText; }, set_HelpText: function (value) { if (this._HelpText != value) { this._helpText = value; this._ensurePopup(); this._popupDiv.innerHTML = value; this.raisePropertyChanged("Text") } }, Registering a JavaScript Class After you create the PopupHelp behavior, you must register the behavior as a class by using the Microsoft Ajax registerClass() method like this: MyACTControls.PopupHelpBehavior.registerClass('MyACTControls.PopupHelpBehavior', Sys.Extended.UI.BehaviorBase); This call to registerClass() registers PopupHelp behavior as a class which derives from the base Sys.Extended.UI.BehaviorBase class. Like the ExtenderControlBase class on the server side, the BehaviorBase class on the client side contains method used by every behavior. The documentation for the BehaviorBase class can be found here: http://msdn.microsoft.com/en-us/library/bb311020.aspx The most important methods and properties of the BehaviorBase class are the following: dispose() – Use this method to clean up all resources used by your behavior. In the case of the PopupHelp behavior, the dispose() method is used to remote the event handlers created by the behavior and disposed the Popup behavior. get_element() -- Use this property to get the DOM element associated with the behavior. In other words, the DOM element which the behavior extends. get_id() – Use this property to the ID of the current behavior. initialize() – Use this method to initialize the behavior. This method is called after all of the properties are set by the $create() method. Creating Debug and Release Scripts You might have noticed that the PopupHelp behavior uses two scripts named PopupHelpBehavior.js and PopupHelpBehavior.debug.js. However, you never create these two scripts. Instead, you only create a single script named PopupHelpBehavior.pre.js. The pre in PopupHelpBehavior.pre.js stands for preprocessor. When you build the Ajax Control Toolkit (or the sample Visual Studio Solution at the end of this blog entry), a build task named JSBuild generates the PopupHelpBehavior.js release script and PopupHelpBehavior.debug.js debug script automatically. The JSBuild preprocessor supports the following directives: #IF #ELSE #ENDIF #INCLUDE #LOCALIZE #DEFINE #UNDEFINE The preprocessor directives are used to mark code which should only appear in the debug version of the script. The directives are used extensively in the Microsoft Ajax Library. For example, the Microsoft Ajax Library Array.contains() method is created like this: $type.contains = function Array$contains(array, item) { //#if DEBUG var e = Function._validateParams(arguments, [ {name: "array", type: Array, elementMayBeNull: true}, {name: "item", mayBeNull: true} ]); if (e) throw e; //#endif return (indexOf(array, item) >= 0); } Notice that you add each of the preprocessor directives inside a JavaScript comment. The comment prevents Visual Studio from getting confused with its Intellisense. The release version, but not the debug version, of the PopupHelpBehavior script is also minified automatically by the Microsoft Ajax Minifier. The minifier is invoked by a build step in the project file. Conclusion The goal of this blog entry was to explain how you can create custom AJAX Control Toolkit controls. In the first part of this blog entry, you learned how to create the server-side portion of an Ajax Control Toolkit control. You learned how to derive a new control from the ExtenderControlBase class and decorate its properties with the necessary attributes. Next, in the second part of this blog entry, you learned how to create the client-side portion of an Ajax Control Toolkit control by creating a client-side behavior with JavaScript. You learned how to use the methods of the Microsoft Ajax Library to extend your client behavior from the BehaviorBase class. Download the Custom ACT Starter Solution

    Read the article

  • Dynamic connection for LINQ to SQL DataContext

    - by Steve Clements
    If for some reason you need to specify a specific connection string for a DataContext, you can of course pass the connection string when you initialise you DataContext object.  A common scenario could be a dev/test/stage/live connection string, but in my case its for either a live or archive database.   I however want the connection string to be handled by the DataContext, there are probably lots of different reasons someone would want to do this…but here are mine. I want the same connection string for all instances of DataContext, but I don’t know what it is yet! I prefer the clean code and ease of not using a constructor parameter. The refactoring of using a constructor parameter could be a nightmare.   So my approach is to create a new partial class for the DataContext and handle empty constructor in there. First from within the LINQ to SQL designer I changed the connection property to None.  This will remove the empty constructor code from the auto generated designer.cs file. Right click on the .dbml file, click View Code and a file and class is created for you! You’ll see the new class created in solutions explorer and the file will open. We are going to be playing with constructors so you need to add the inheritance from System.Data.Linq.DataContext public partial class DataClasses1DataContext : System.Data.Linq.DataContext    {    }   Add the empty constructor and I have added a property that will get my connection string, you will have whatever logic you need to decide and get the connection string you require.  In my case I will be hitting a database, but I have omitted that code. public partial class DataClasses1DataContext : System.Data.Linq.DataContext {    // Connection String Keys - stored in web.config    static string LiveConnectionStringKey = "LiveConnectionString";    static string ArchiveConnectionStringKey = "ArchiveConnectionString";      protected static string ConnectionString    {       get       {          if (DoIWantToUseTheLiveConnection) {             return global::System.Configuration.ConfigurationManager.ConnectionStrings[LiveConnectionStringKey].ConnectionString;          }          else {             return global::System.Configuration.ConfigurationManager.ConnectionStrings[ArchiveConnectionStringKey].ConnectionString;          }       }    }      public DataClasses1DataContext() :       base(ConnectionString, mappingSource)    {       OnCreated();    } }   Now when I new up my DataContext, I can just leave the constructor empty and my partial class will decide which one i need to use. Nice, clean code that can be easily refractored and tested.   Share this post :

    Read the article

< Previous Page | 78 79 80 81 82 83 84 85 86 87 88 89  | Next Page >