Search Results

Search found 22668 results on 907 pages for 'command prompt'.

Page 829/907 | < Previous Page | 825 826 827 828 829 830 831 832 833 834 835 836  | Next Page >

  • How can I remove relative path components but leave symlinks alone in Perl?

    - by jnylen
    I need to get Perl to remove relative path components from a Linux path. I've found a couple of functions that almost do what I want, but: File::Spec->rel2abs does too little. It does not resolve ".." into a directory properly. Cwd::realpath does too much. It resolves all symbolic links in the path, which I do not want. Perhaps the best way to illustrate how I want this function to behave is to post a bash log where FixPath is a hypothetical command that gives the desired output: '/tmp/test'$ mkdir -p a/b/c1 a/b/c2 '/tmp/test'$ cd a '/tmp/test/a'$ ln -s b link '/tmp/test/a'$ ls b link '/tmp/test/a'$ cd b '/tmp/test/a/b'$ ls c1 c2 '/tmp/test/a/b'$ FixPath . # rel2abs works here ===> /tmp/test/a/b '/tmp/test/a/b'$ FixPath .. # realpath works here ===> /tmp/test/a '/tmp/test/a/b'$ FixPath c1 # rel2abs works here ===> /tmp/test/a/b/c1 '/tmp/test/a/b'$ FixPath ../b # realpath works here ===> /tmp/test/a/b '/tmp/test/a/b'$ FixPath ../link/c1 # neither one works here ===> /tmp/test/a/link/c1 '/tmp/test/a/b'$ FixPath missing # should work for nonexistent files ===> /tmp/test/a/b/missing

    Read the article

  • If setUpBeforeClass() fails, test failures are hidden in PHPUnit's JUnit XML output

    - by Adam Monsen
    If setUpBeforeClass() throws an exception, no failures or errors are reported in the PHPUnit's JUnit XML output. Why? Example test class: <?php class Test extends PHPUnit_Framework_TestCase { public static function setUpBeforeClass() { throw new \Exception('masks all failures in xml output'); } public function testFoo() { $this->fail('failing'); } } Command line: phpunit --verbose --log-junit out.xml Test.php Console output: PHPUnit 3.6.10 by Sebastian Bergmann. E Time: 0 seconds, Memory: 3.25Mb There was 1 error: 1) Test Exception: masks all failures in xml output /tmp/pu/Test.php:6 FAILURES! Tests: 0, Assertions: 0, Errors: 1. JUnit XML output: <?xml version="1.0" encoding="UTF-8"?> <testsuites> <testsuite name="Test" file="/tmp/phpunit-broken/Test.php"/> </testsuites> More info: $ php --version PHP 5.3.10-1ubuntu3.1 with Suhosin-Patch (cli) (built: May 4 2012 02:21:57) Copyright (c) 1997-2012 The PHP Group Zend Engine v2.3.0, Copyright (c) 1998-2012 Zend Technologies with Xdebug v2.1.0, Copyright (c) 2002-2010, by Derick Rethans

    Read the article

  • Tagging in Subversion - how do I make the decision about continuing to work on my trunk vs. the new

    - by Howiecamp
    I'm running Tortoise SVN to manage a project. Obviously the principles around tagging apply to any implementation of SVN but in this question I'll be referring to some TortoiseSVN-specific dialog boxes and messages. My working directory and the subversion repository structure both have a Source root directory and the Trunk, Tags and Branches directories underneath. (I couldn't figure out how to do a multilevel indented hierarchy in markdown without using bullets, so if someone could edit and fix this I'd appreciate it.) I'm working out of the Trunk directory in my working copy and it's pointing at the Trunk directory in the repo. I want to apply a Tag "Release1" so I click the "Branch/tag..." menu option and set the repo path as my [repo_path/bla/Source/Tags/Release1" tag. This dialog box gives me the option to "Switch my working copy to new branch/tag". I understand that if this option is left unchecked, the new "Release1" branch under /Tags" will be created but my working copy will remain on the previous "Trunk" path. If I do check this option (or use the Switch command) I understand that my working copy will switch to the new "Release1" branch under "/Tags". Where I'm missing a concept is how to make this decision. It doesn't seem like I want to switch my working directory to the recently created tag since by definition (?) I want that tag to be a snapshot of my code as of a point in time. If I don't switch the working directory, I'll continue working off Trunk and when I'm ready to take another snapshot I'll make another tag. And so on... Am I understanding this right or am I stating something incorrectly in the previous paragraph (e.g. the statement about not wanting to switch to the tag since the tag should represent a point in time snapshot) or otherwise missing something regarding how to make this decision?

    Read the article

  • How to figure out which record has been deleted in an effiecient way?

    - by janetsmith
    Hi, I am working on an in-house ETL solution, from db1 (Oracle) to db2 (Sybase). We needs to transfer data incrementally (Change Data Capture?) into db2. I have only read access to tables, so I can't create any table or trigger in Oracle db1. The challenge I am facing is, how to detect record deletion in Oracle? The solution which I can think of, is by using additional standalone/embedded db (e.g. derby, h2 etc). This db contains 2 tables, namely old_data, new_data. old_data contains primary key field from tahle of interest in Oracle. Every time ETL process runs, new_data table will be populated with primary key field from Oracle table. After that, I will run the following sql command to get the deleted rows: SELECT old_data.id FROM old_data WHERE old_data.id NOT IN (SELECT new_data.id FROM new_data) I think this will be a very expensive operation when the volume of data become very large. Do you have any better idea of doing this? Thanks.

    Read the article

  • Populate asp.net MVC Index page with data from the database

    - by Sunil Ramu
    I have a web application in which I need to fetch data from the database and display in the index page. As you know, asp.net mvc has given options to edit delete etc... I need to populate the page using the conventional DB way and it uses a stored procedure to retrieve results. I dont want to use LINQ. This is my model entity class using System; using System.Collections.Generic; using System.Linq; using System.Web; namespace LogMVCApp.Models { public class Property { public int Id { get; set; } public string LogInId { get; set; } public string Username { get; set; } public string Action { get; set; } public string Information { get; set; } public bool Passed{get; set; } public string LogType { get; set; } } } and I need to retrieve data using something like this... var conString = ConfigurationManager.ConnectionStrings["connection"].ToString(); var conn = new SqlConnection(conString); var command = new SqlCommand("LogInsert", conn){CommandType=CommandType.StoredProcedure};

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • adb doesn't get phone's device name/number

    - by Dona Hertel
    Okay, I have a strange problem I haven't seen listed anywhere. I'm developing an android app and I would like to run it on my Huawei Ascend. I have set up a file in /etc/udev/90-android.rules with the line: SUBSYSTEM=="usb", SYSFS{idVendor}=="12d1", MODE="0666" where '12d1' is the correct vendor ID for this phone (I verified this with 'lsusb' command). When I plug in the phone (it does have debugging on) and restart the adb server I get a connection but the name field does not get set. The output to 'adb devices' is: List of devices attached \n ???????????? device Plugging and unplugging the cable doesn't resolve this. Neither does restarting the adb server. Nor does a total reboot of both my computer or the phone. This is fine as I can get logs and a shell. The problem is that in the eclipse plugin, the device's name is list as "????????????" and so when it tries connect, it quits with an error message of 'device not found' even though the device is listed and 'online'. Is there something else I need to do? Do I need to set the name of the device somehow? cocofan P.S.: The app has 'debuggable' set to true in the manifest file.

    Read the article

  • PHP -- automatic SQL injection protection?

    - by ashgromnies
    I took over maintenance of a PHP app recently and I'm not super familiar with PHP but some of the things I've been seeing on the site are making me nervous that it could be vulnerable to a SQL injection attack. For example, see how this code for logging into the administrative section works: $password = md5(HASH_SALT . $_POST['loginPass']); $query = "SELECT * FROM `administrators` WHERE `active`='1' AND `email`='{$_POST['loginEmail']}' AND `password`='{$password}'"; $userInfo = db_fetch_array(db_query($query)); if($userInfo['id']) { $_SESSION['adminLoggedIn'] = true; // user is logged in, other junk happens here, not important The creators of the site made a special db_query method and db_fetch_array method, shown here: function db_query($qstring,$print=0) { return @mysql(DB_NAME,$qstring); } function db_fetch_array($qhandle) { return @mysql_fetch_array($qhandle); } Now, this makes me think I should be able to do some sort of SQL injection attack with an email address like: ' OR 'x'='x' LIMIT 1; and some random password. When I use that on the command line, I get an administrative user back, but when I try it in the application, I get an invalid username/password error, like I should. Could there be some sort of global PHP configuration they have enabled to block these attacks? Where would that be configured? Here is the PHP --version information: # php --version PHP 5.2.12 (cli) (built: Feb 28 2010 15:59:21) Copyright (c) 1997-2009 The PHP Group Zend Engine v2.2.0, Copyright (c) 1998-2009 Zend Technologies with the ionCube PHP Loader v3.3.14, Copyright (c) 2002-2010, by ionCube Ltd., and with Zend Optimizer v3.3.9, Copyright (c) 1998-2009, by Zend Technologies

    Read the article

  • UnicodeEncodeError: 'ascii' codec can't encode character [...]

    - by user1461135
    I have read the HOWTO on Unicode from the official docs and a full, very detailed article as well. Still I don't get it why it throws me this error. Here is what I attempt: I open an XML file that contains chars out of ASCII range (but inside allowed XML range). I do that with cfg = codecs.open(filename, encoding='utf-8, mode='r') which runs fine. Looking at the string with repr() also shows me a unicode string. Now I go ahead and read that with parseString(cfg.read().encode('utf-8'). Of course, my XML file starts with this: <?xml version="1.0" encoding="utf-8"?>. Although I suppose it is not relevant, I also defined utf-8 for my python script, but since I am not writing unicode characters directly in it, this should not apply here. Same for the following line: from __future__ import unicode_literals which also is right at the beginning. Next thing I pass the generated Object to my own class where I read tags into variables like this: xmldata.getElementsByTagName(tagName)[0].firstChild.data and assign it to a variable in my class. Now what perfectly works are those commands (obj is an instance of the class): for element in obj: print element And this command does work as well: print obj.__repr__() I defined __iter__() to just yield every variable while __repr__() uses the typical printf stuff: "%s" % self.varname Both commands print perfectly and can output the unicode character. What does not work is this: print obj And now I am stuck because this throws the dreaded UnicodeEncodeError: 'ascii' codec can't encode character u'\xfc' in position 47: So what am I missing? What am I doing wrong? I am looking for a general solution, I always want to handle strings as unicode, just to avoid any possible errors and write a compatible program. Edit: I also defined this: def __str__(self): return self.__repr__() def __unicode__(self): return self.__repr__() From documentation I got that this

    Read the article

  • Installing django on dreamhost (help a newb out)

    - by augustfirst
    I'm trying to get django running on my dreahost account. I've been trying to sort of use two tutorials at once: the one on the dreamhost wiki and the one in the django book. I installed django using the script on the wiki page, but I ran into trouble immediately while trying to work through the django book. It says: To start the server, change into your project directory (cd mysite), if you haven’t already, and run this command: python manage.py runserver This launches the server locally, on port 8000, accessible only to connections from your own computer. Now that it’s running, visit 127.0.0.1:8000 with your Web browser. You’ll see a “Welcome to Django” page shaded in a pleasant pastel blue. It worked! Those instructions seem to assume that you're developing locally, not on a shared server. Where the heck am I supposed to look for the "Welcome to Django" page after starting the server? In my webroot? No dice. Anyway, I tried to blunder ahead through the django book to its hello world tutorial (chapter 3). But once I've edited the view file and the URLconf, I don't get a nice clean "hello world" text. Instead (as you can see) I get an "import error". Any help would be greatly appreciated.

    Read the article

  • Rails wont install at create Makefile stage

    - by mattc
    I am getting this error after running sudo gem install rails /System/Library/Frameworks/Ruby.framework/Versions/1.8/usr/bin/ruby extconf.rb creating Makefile make xcrun cc -I. - I/System/Library/Frameworks/Ruby.framework/Versions/1.8/usr/lib/ruby/1.8/universal-darwin12.0 -I/System/Library/Frameworks/Ruby.framework/Versions/1.8/usr/lib/ruby/1.8/universal-darwin12.0 -I. -DJSON_GENERATOR -D_XOPEN_SOURCE -D_DARWIN_C_SOURCE -fno-common -arch i386 -arch x86_64 -g -O3 -pipe -fno-common -DENABLE_DTRACE -fno-common -pipe -fno-common -c generator.c xcrun: Error: failed to exec real xcrun. (No such file or directory) cc -arch i386 -arch x86_64 -pipe -bundle -undefined dynamic_lookup -o generator.bundle generator.o -L. -L/System/Library/Frameworks/Ruby.framework/Versions/1.8/usr/lib -L. -arch i386 -arch x86_64 -lruby -lpthread -ldl -lobjc i686-apple-darwin11-llvm-gcc-4.2: generator.o: No such file or directory i686-apple-darwin11-llvm-gcc-4.2: generator.o: No such file or directory lipo: can't figure out the architecture type of: /var/tmp//ccHCNNwM.out make: *** [generator.bundle] Error 1 I have Homebrew installed, Xcode 4.4 with command line tools installed, Osx 10.6.2 I run gem env and get this but not sure what I'm looking for: RubyGems Environment: - RUBYGEMS VERSION: 1.8.24 - RUBY VERSION: 1.8.7 (2012-02-08 patchlevel 358) [universal-darwin12.0] - INSTALLATION DIRECTORY: /Library/Ruby/Gems/1.8 - RUBY EXECUTABLE: /System/Library/Frameworks/Ruby.framework/Versions/1.8/usr/bin/ruby - EXECUTABLE DIRECTORY: /usr/bin - RUBYGEMS PLATFORMS: - ruby - universal-darwin-12 - GEM PATHS: - /Library/Ruby/Gems/1.8 - /Users/matthewcleghorn/.gem/ruby/1.8 - /System/Library/Frameworks/Ruby.framework/Versions/1.8/usr/lib/ruby/gems/1.8 - GEM CONFIGURATION: - :update_sources => true - :verbose => true - :benchmark => false - :backtrace => false - :bulk_threshold => 1000 - REMOTE SOURCES: - http://rubygems.org/ Any help greatly appreciated. Thanks.

    Read the article

  • How do you organise multiple git repositories?

    - by dbr
    With SVN, I had a single big repository I kept on a server, and checked-out on a few machines. This was a pretty good backup system, and allowed me easily work on any of the machines. I could checkout a specific project, commit and it updated the 'master' project, or I could checkout the entire thing. Now, I have a bunch of git repositories, for various projects, several of which are on github. I also have the SVN repository I mentioned, imported via the git-svn command.. Basically, I like having all my code (not just projects, but random snippets and scripts, some things like my CV, articles I've written, websites I've made and so on) in one big repository I can easily clone onto remote machines, or memory-sticks/harddrives as backup. The problem is, since it's a private repository, and git doesn't allow checking out of a specific folder (that I could push to github as a separate project, but have the changes appear in both the master-repo, and the sub-repos) I could use the git submodule system, but it doesn't act how I want it too (submodules are pointers to other repositories, and don't really contain the actual code, so it's useless for backup) Currently I have a folder of git-repos (for example, ~/code_projects/proj1/.git/ ~/code_projects/proj2/.git/), and after doing changes to proj1 I do git push github, then I copy the files into ~/Documents/code/python/projects/proj1/ and do a single commit (instead of the numerous ones in the individual repos). Then do git push backupdrive1, git push mymemorystick etc So, the question: How do your personal code and projects with git repositories, and keep them synced and backed-up?

    Read the article

  • How to associate application with existing file types using WiX installer?

    - by Marek
    related to this: http://stackoverflow.com/questions/138550/how-to-register-file-types-extensions-with-a-wix-installer but not a duplicate. I need to handle existing file types (.jpg files). I do not want to be the default handler for .jpg, I would just like to extend the "Open with" menu with a link to my app. I see HKCR\.jpg\OpenWithList\ and HKCR\.jpg\OpenWithProgIds\ in the registry but I am not sure whether to write to these and how to do it correctly with WiX. Should I use something like this? <ProgId Id='??what here?' Description='Jpeg handled by my App'> <Extension Id='jpg' ContentType='image/jpeg'> <Verb Id='openwithmyapp' Sequence='10' Command='OpenWithMyApp' Target='[!FileId]' Argument='"%1"' /> </Extension> </ProgId> There are many ways how to fail here (like Photo Mechanics did, the HKCR for image file types is a real mess after I have installed this software) How to do this correctly with WiX?

    Read the article

  • How do repos (SVN, GIT) work?

    - by masfenix
    I read SO nearly everyday and mostly there is a thread about source control. I have a few questions. I am going to use SVN as example. 1) There is a team (small, large dosnt matter). In the morning everyone checks out the code to start working. At noon Person A commits, while person B still works on it. What happens when person B commits? how will person B know that there is an updated file? 2) I am assuming the answer to the first question is "run an update command which tells you", ok so person B finds out that the file they have been working on all morning in changed. When they see the udpated file, it seems like person A has REWRITTEN the file for better performance. What does person B do? Seems like there whole day was a waste of time. Or if they commit their version then its a waste of person A's time? 3) What are branches? thanks, and if anyone knows a laymen terms pdf or something that explains it that would be awesome.

    Read the article

  • I am not able to kill a child process using TerminateProcess

    - by user1681210
    I have a problem to kill a child process using TerminateProcess. I call to this function and the process still there (in the Task Manager) This piece of code is called many times launching the same program.exe many times and these process are there in the task manager which i think is not good. sorry, I am quiet new in c++ I will really appreciate any help. thanks a lot!! the code is the following: STARTUPINFO childProcStartupInfo; memset( &childProcStartupInfo, 0, sizeof(childProcStartupInfo)); childProcStartupInfo.cb = sizeof(childProcStartupInfo); childProcStartupInfo.hStdInput = hFromParent; // stdin childProcStartupInfo.hStdOutput = hToParent; // stdout childProcStartupInfo.hStdError = hToParentDup; // stderr childProcStartupInfo.dwFlags = STARTF_USESTDHANDLES | STARTF_USESHOWWINDOW; childProcStartupInfo.wShowWindow = SW_HIDE; PROCESS_INFORMATION childProcInfo; /* for CreateProcess call */ bOk = CreateProcess( NULL, // filename pCmdLine, // full command line for child NULL, // process security descriptor */ NULL, // thread security descriptor */ TRUE, // inherit handles? Also use if STARTF_USESTDHANDLES */ 0, // creation flags */ NULL, // inherited environment address */ NULL, // startup dir; NULL = start in current */ &childProcStartupInfo, // pointer to startup info (input) */ &childProcInfo); // pointer to process info (output) */ CloseHandle( hFromParent ); CloseHandle( hToParent ); CloseHandle( hToParentDup ); CloseHandle( childProcInfo.hThread); CloseHandle( childProcInfo.hProcess); TerminateProcess( childProcInfo.hProcess ,0); //this is not working, the process thanks

    Read the article

  • What's the next steps for moving from appengine to full django?

    - by tomcritchlow
    Hey guys, I'm super new to programming and I've been using appengine to help me learn python and general coding. I'm getting better quickly and I'm loving it all the way :) Appengine was awesome for allowing me to just dive into writing my app and getting something live that works (see http://www.7bks.com/). But I'm realising that the longer I continue to learn on appengine the more I'm constraining myself and locking myself into a single system. I'd like to move to developing on full django (since django looks super cool!). What are my next steps? To give you a feel for my level of knowledge: I'm not a unix user I'm not familiar with command line controls (I still use appengine/python completely via the appengine SDK) I've never programmed in anything other than python, anywhere other than appengine I know the word SQL, but don't know what MySQL is really or how to use it. So, specifically: What are the skills I need to learn to get up and running with full django/python? If I'm going to host somewhere else I suppose I'll need to learn some sysadmin type skills (maybe even unix?). Is there anywhere that offers easy hosting (like appengine) but that supports django? I hear such great things about heroku I'm considering switching to RoR and going there I appreciate that I'm likely not quite ready to move away from appengine just yet but I'm a fiercely passionate learner (http://www.7bks.com/blog/179001) and would love it if I knew all the steps I needed to learn so I could set about learning them. At the moment, I don't even know what the steps are I need to learn! Thank you very much. Sorry this isn't a specific programming question but I've looked around and haven't found a good how-to for someone of my level of experience and I think others would appreciate a good roadmap for the things we need to learn to get up and running. Thanks, Tom PS - if anyone is in London and fancies showing me the ropes in person that would be super awesome :)

    Read the article

  • How do you fix loading plugins in eclipse 3.5.1 on linux?

    - by Jay R.
    I have two linux boxes. Both Fedora 11 x64. On one, I downloaded the eclipse-java-galileo-SR1-linux-gtk-x86_64.tar.gz. I unpacked it to /opt/eclipse-3.5.1/ and used the Install New Software... item to install the SVN team provider and the Polarion SVN connectors. Everything works. On the second, I copied the tar.gar for eclipse there, and then tried to follow the same steps. When I get to the install SVN team provided, eclipse downloads it and claims to install it and asks to restart. I restart and there is no SVN support. The software installer knows its there because I can't reinstall it without uninstalling it. So the questions: Why isn't the plugin/feature loading for the SVN Team Support? Is there a checkbox that I forgot about that enables the plugin? Is there a command line option that will force reload all of the features on the disk? I've tried to install other things like findbugs, but I get the same result. I have no messages in the log file indicating an exception or anything like that.

    Read the article

  • MinGW-gcc PCH not speeding up wxWidget build times. Is my setup correct?

    - by Victor T.
    Hi all, I've been building wxMSW 2.8.11 with the latest stable release of mingw-gcc 4.5.1 and I'm trying to see if the build could be sped up using precompiled headers. My initial attempts at this doesn't seem to work. I basically followed the given instructions here. I created a wxprec.h precompiled header with the following: g++ -O2 -mthreads -DHAVE_W32API_H -D__WXMSW__ -DNDEBUG -D_UNICODE -I..\..\lib\gcc_dll\mswu -I..\..\include -W -Wall -DWXBUILDING -I..\.. \src\tiff -I..\..\src\jpeg -I..\..\src\png -I..\..\src\zlib -I..\..\src \regex -I..\..\src\expat\lib -DwxUSE_BASE=1 -DWXMAKINGDLL -Wno-ctor- dtor-privacy ../../include/wx/wxprec.h That does successfully create a wxprec.h.gch that's about ~1.6meg in size. Now I proceed to build wxmsw using the follow make command from cmd.exe shell: mingw32-make -f makefile.gcc While, the build does succeed I noticed no speedup whatsoever then if pch wasn't used. To make sure gcc was actually using the pch I added -H in the config.gcc and did another rebuild. Indeed, the outputted include list does show a '!' next to the wxprec.h so gcc is supposely using it. What's the reason for pch not working? Did I setup the precompiled headers correctly or am I missing a step? Just for reference comparison, here's the compile times I get when building wxmsw 2.8.11 with the other compilers(visual studio 2010 and C++ Builder 2007). The time savings is pretty significant. | | release, pch | release, nopch | debug, nopch ------------------------------------------------------- | gcc451 | 8min 33sec | 8min 17sec | 8min 49sec | msc_1600 | 2min 23sec | 13min 11sec | -- | bcc593 | 0min 59sec | 2min 29sec | -- Thanks

    Read the article

  • Maven3 Issues with building a multi-module enterprise project

    - by Sujit K
    I just migrated from Maven2 to Maven3 and I'm able to build each module individually or all the modules in one shot by calling mvn clean install. However, in Maven2, since we have multi-module enterprise project, we build multiple ear's and each ear is built as its own module with its own child pom. To build an individual ear with its dependents, the below command works fine in Maven2 but not in Maven3. Let me explain the issue in Maven3 a bit later. mvn -pl ear_module -rf first_dependent_module -am clean install In Maven2 when the reactor lists the build order, I see first_dependent_module second_dependent_module ear_module End of the day I have my ear module also part of the reactor which is how it should be. The reason we call -rf is we don't want to delete the target folder at the main ${project.basedir} (so not to delete the output created in target from building the other ear modules). With Maven3, however, this is all I see when the reactor lists the build order: first_dependent_module second_dependent_module Maven3 totally ignores the argument (ear_module) set to -pl flag to be also built after its dependents have been. Not sure what I'm missing here. Any help/tips would be greatly appreciated. P.S: The build I'm making is similar to the one below.... Build specific module in multi-module project Thanks, SK

    Read the article

  • Resolving the WMI DNS Host Name

    - by Stephen Murby
    I am trying to make a comparison between a machine name i have retrieved from AD, and the DNS Host Name i want to get using WMI from the machine. I currently have: foreach (SearchResult oneMachine in allMachinesCollected) { pcName = oneMachine.Properties["name"][0].ToString(); ConnectionOptions setupConnection = new ConnectionOptions(); setupConnection.Username = USERNAME; setupConnection.Password = PASSWORD; setupConnection.Authority = "ntlmdomain:DOMAIN"; ManagementScope setupScope = new ManagementScope("\\\\" + pcName + "\\root\\cimv2", setupConnection); setupScope.Connect(); ObjectQuery dnsNameQuery = new ObjectQuery("SELECT * FROM Win32_ComputerSystem"); ManagementObjectSearcher dnsNameSearch = new ManagementObjectSearcher(setupScope, dnsNameQuery); ManagementObjectCollection allDNSNames = dnsNameSearch.Get(); string dnsHostName; foreach (ManagementObject oneName in allDNSNames) { dnsHostName = oneName.Properties["DNSHostName"].ToString(); if (dnsHostName == pcName) { shutdownMethods.ShutdownMachine(pcName, USERNAME, PASSWORD); MessageBox.Show(pcName + " has been sent the reboot command"); } } } } But i get a ManagementException dnsHostName = oneName.Properties["DNSHostName"].ToString(); << here saying not found. Any ideas?

    Read the article

  • C# / Silverlight / WPF / Fast rendering lots of circles

    - by Walt W
    I want to render a lot of circles or small graphics within either silverlight or wpf (around 1000-10000) as fast and as frequently as possible. If I have to go to DX or OGL, that's fine, but I'm wondering about doing this within either of those two frameworks first (read: it's OK if an answer is WPF-only or Silverlight-only). Also, if there is a way to access DX through WPF and render on a surface that way, I would be interested in that as well. So, what's the fastest way to draw a load of circles? They can be as plain as necessary, but they do need to have a radius. Currently I'm using DrawingVisual and a DrawingContext.DrawEllipse() command for each circle, then rendering the visual to a RenderTargetBItmap, but it becomes very slow as the number of circles rises. By the way, these circles move every frame, so caching isn't really an option unless you're going to suggest caching the individual circles . . . But their sizes are dynamic, so I'm not sure that's a great approach.

    Read the article

  • Creating a RESTful service in CakePHP

    - by NathanGaskin
    I'm attempting to create a RESTful service in CakePHP but I've hit a bit of a brick wall. I've enabled the default RESTful routing using Router::mapResources('users') and Router::parseExtensions(). This works well if I make a GET request, and returns some nicely formatted XML. So far so good. The problem is if I want to make a POST or PUT request. CakePHP doesn't seem to be able to read the data from the request. At the moment my add(), edit() and delete() actions don't contain any logic, they're simply setting $this-data to the view. I'm testing with the following cURL command: curl -v -d "<user><username>blahblah</username><password>blahblah</password>" http://localhost/users.xml --header 'content-type: text/xml' Which only returns a 404 header. If I remove the --header parameter then it returns the view but no data is set. It feels like I'm missing something obvious here. Any ideas?

    Read the article

  • Hibernate saveorUpdate method problem

    - by umesh awasthi
    Hi all, i am trying to work on with Hibernate (Database side for first time) and some how struck in choosing best possible way to use saveOrUpdate or Save.Update i have a destination POJO class and its other attributes which needs to be updated along with the Destination entity. i am getting an XML file to be imported and i am using the following code to update/save the destination entity along with its attribute classes. try{ getSessionFactory().getCurrentSession().beginTransaction(); getSessionFactory().getCurrentSession().saveOrUpdate(entity); getSessionFactory().getCurrentSession().getTransaction().commit(); } catch(Exception e){ getSessionFactory().getCurrentSession().getTransaction().rollback(); } finally{ getSessionFactory().close(); } everything is working fine untill i am using the same session instance.but later on when i am using the same XML file to update the destination PO for certain attributes it giving me the following error. SEVERE: Duplicate entry 'MNLI' for key 'DESTINATIONID' 9 Jan, 2011 4:58:11 PM org.hibernate.event.def.AbstractFlushingEventListener performExecutions SEVERE: Could not synchronize database state with session org.hibernate.exception.ConstraintViolationException: Could not execute JDBC batch update at org.hibernate.exception.SQLStateConverter.convert(SQLStateConverter.java:94) at org.hibernate.exception.JDBCExceptionHelper.convert(JDBCExceptionHelper.java:66) at org.hibernate.jdbc.AbstractBatcher.executeBatch(AbstractBatcher.java:275) at org.hibernate.jdbc.AbstractBatcher.prepareStatement(AbstractBatcher.java:114) at org.hibernate.jdbc.AbstractBatcher.prepareStatement(AbstractBatcher.java:109) at org.hibernate.jdbc.AbstractBatcher.prepareBatchStatement(AbstractBatcher.java:244) at org.hibernate.persister.entity.AbstractEntityPersister.insert(AbstractEntityPersister.java:2242) at org.hibernate.persister.entity.AbstractEntityPersister.insert(AbstractEntityPersister.java:2678) at org.hibernate.action.EntityInsertAction.execute(EntityInsertAction.java:79) i am using UUID as primary key for the Destination table and in destination table i have a destination id which is unique.but i can understand that in the secodn case hibernate is not able to find if there is already an entry for the same destination in the DB and trying to execute insert statement rather than update. one possible solution is i can user destinationid to check if there is already a destination inplace with the given id and based on the results i can issue save or update command. my question is can this be achieve by any other good way..? Thanks in advance

    Read the article

  • HTTP POST with URL query parameters -- good idea or not?

    - by Steven Huwig
    I'm designing an API to go over HTTP and I am wondering if using the HTTP POST command, but with URL query parameters only and no request body, is a good way to go. Considerations: "Good Web design" requires non-idempotent actions to be sent via POST. This is a non-idempotent action. It is easier to develop and debug this app when the request parameters are present in the URL. The API is not intended for widespread use. It seems like making a POST request with no body will take a bit more work, e.g. a Content-Length: 0 header must be explicitly added. It also seems to me that a POST with no body is a bit counter to most developer's and HTTP frameworks' expectations. Are there any more pitfalls or advantages to sending parameters on a POST request via the URL query rather than the request body? Edit: The reason this is under consideration is that the operations are not idempotent and have side effects other than retrieval. See the HTTP spec: In particular, the convention has been established that the GET and HEAD methods SHOULD NOT have the significance of taking an action other than retrieval. These methods ought to be considered "safe". This allows user agents to represent other methods, such as POST, PUT and DELETE, in a special way, so that the user is made aware of the fact that a possibly unsafe action is being requested. ... Methods can also have the property of "idempotence" in that (aside from error or expiration issues) the side-effects of N 0 identical requests is the same as for a single request. The methods GET, HEAD, PUT and DELETE share this property. Also, the methods OPTIONS and TRACE SHOULD NOT have side effects, and so are inherently idempotent.

    Read the article

  • multiple clients - one server connection with sockets tcp/ip c# .net

    - by jagse
    Hello guys, I need to develop a client server system where I can have multiple clients communicating with one server at the same time. I want to communicate xml serialized objects and also need to send and receive other commands to invoke methods. Now, I am just starting with socket programming in C# and .Net and found that the asynchronous I/O is the way to go so that the methods dont block the execution of code. Also there are many examples of how to make a simple client server system. So I have a basic understanding of how that works. Anyway, what still is not clear to me is how I can set up a server which can manage connections to multiple clients? Can I just create a new socket per connection and then store those in some kind of list? Do I need some kind of multiplexing to achieve this? Do I have to listen at multiple ports? What`s the best way here? And the other thing is if I need to develop my own protocol to differentiate between what I am actually sending over the network -- xml serialized object or a command which might be just a string encoded in ascII or something. Or would I develop my own protocol just to send these commands? Any kind of help is apreciated! If someone knows a good book which covers this sort of stuff, let me know. Cheers I forgot to mention that some of my clients which are supposed to communicate with my server will be pda and I therefore use the compact framework... So this might bring in some restrictions...

    Read the article

< Previous Page | 825 826 827 828 829 830 831 832 833 834 835 836  | Next Page >