Search Results

Search found 22668 results on 907 pages for 'command prompt'.

Page 829/907 | < Previous Page | 825 826 827 828 829 830 831 832 833 834 835 836  | Next Page >

  • Doubt about instance creation by using Spring framework ???

    - by Arthur Ronald F D Garcia
    Here goes a command object which needs to be populated from a Spring form public class Person { private String name; private Integer age; /** * on-demand initialized */ private Address address; // getter's and setter's } And Address public class Address { private String street; // getter's and setter's } Now suppose the following MultiActionController @Component public class PersonController extends MultiActionController { @Autowired @Qualifier("personRepository") private Repository<Person, Integer> personRepository; /** * mapped To /person/add */ public ModelAndView add(HttpServletRequest request, HttpServletResponse response, Person person) throws Exception { personRepository.add(person); return new ModelAndView("redirect:/home.htm"); } } Because Address attribute of Person needs to be initialized on-demand, i need to override newCommandObject to create an instance of Person to initiaze address property. Otherwise, i will get NullPointerException @Component public class PersonController extends MultiActionController { /** * code as shown above */ @Override public Object newCommandObject(Class clazz) thorws Exception { if(clazz.isAssignableFrom(Person.class)) { Person person = new Person(); person.setAddress(new Address()); return person; } } } Ok, Expert Spring MVC and Web Flow says Options for alternate object creation include pulling an instance from a BeanFactory or using method injection to transparently return a new instance. First option pulling an instance from a BeanFactory can be written as @Override public Object newCommandObject(Class clazz) thorws Exception { /** * Will retrieve a prototype instance from ApplicationContext whose name matchs its clazz.getSimpleName() */ getApplicationContext().getBean(clazz.getSimpleName()); } But what does he want to say by using method injection to transparently return a new instance ??? Can you show how i implement what he said ??? ATT: I know this funcionality can be filled by a SimpleFormController instead of MultiActionController. But it is shown just as an example, nothing else

    Read the article

  • Tagging in Subversion - how do I make the decision about continuing to work on my trunk vs. the new

    - by Howiecamp
    I'm running Tortoise SVN to manage a project. Obviously the principles around tagging apply to any implementation of SVN but in this question I'll be referring to some TortoiseSVN-specific dialog boxes and messages. My working directory and the subversion repository structure both have a Source root directory and the Trunk, Tags and Branches directories underneath. (I couldn't figure out how to do a multilevel indented hierarchy in markdown without using bullets, so if someone could edit and fix this I'd appreciate it.) I'm working out of the Trunk directory in my working copy and it's pointing at the Trunk directory in the repo. I want to apply a Tag "Release1" so I click the "Branch/tag..." menu option and set the repo path as my [repo_path/bla/Source/Tags/Release1" tag. This dialog box gives me the option to "Switch my working copy to new branch/tag". I understand that if this option is left unchecked, the new "Release1" branch under /Tags" will be created but my working copy will remain on the previous "Trunk" path. If I do check this option (or use the Switch command) I understand that my working copy will switch to the new "Release1" branch under "/Tags". Where I'm missing a concept is how to make this decision. It doesn't seem like I want to switch my working directory to the recently created tag since by definition (?) I want that tag to be a snapshot of my code as of a point in time. If I don't switch the working directory, I'll continue working off Trunk and when I'm ready to take another snapshot I'll make another tag. And so on... Am I understanding this right or am I stating something incorrectly in the previous paragraph (e.g. the statement about not wanting to switch to the tag since the tag should represent a point in time snapshot) or otherwise missing something regarding how to make this decision?

    Read the article

  • Is Accessing USB from web application for cross browser cross os possible at all ?

    - by Ved
    Hey Guys, I am wondering if there is anyway we can achieve this. I heard different things about Silverlight 4 , Java Script or Active X control but not seen any demo of code for any of them. Does anyone know any web component that is available or how to write one. We really like capture client's USB drive via Web and read/write data on it. This has to work for ANY Operating system in Any web browser. Thanks UPDATED What about WPF in browser mode...I read that I can host my wpf apps inside browser and sort of like smart client. Here is a great example of doing this via silverlight 4 but author mentions about possibility of accessing USB on MAC via 1) Enable executing AppleScripts. This option will let us have the same amount of control on a mac machine as we do on a windows machine. 2) Add an overload to ComAutomationFactory.CreateObject() that calls the “Tell Application” command under the scenes and gets a AppleScript object. This option would work extremely well for Office automation. For any other operating system feature, you’ll have to code OS access twice.  I did not quite understand it. Has any tried this ?

    Read the article

  • Populate asp.net MVC Index page with data from the database

    - by Sunil Ramu
    I have a web application in which I need to fetch data from the database and display in the index page. As you know, asp.net mvc has given options to edit delete etc... I need to populate the page using the conventional DB way and it uses a stored procedure to retrieve results. I dont want to use LINQ. This is my model entity class using System; using System.Collections.Generic; using System.Linq; using System.Web; namespace LogMVCApp.Models { public class Property { public int Id { get; set; } public string LogInId { get; set; } public string Username { get; set; } public string Action { get; set; } public string Information { get; set; } public bool Passed{get; set; } public string LogType { get; set; } } } and I need to retrieve data using something like this... var conString = ConfigurationManager.ConnectionStrings["connection"].ToString(); var conn = new SqlConnection(conString); var command = new SqlCommand("LogInsert", conn){CommandType=CommandType.StoredProcedure};

    Read the article

  • adb doesn't get phone's device name/number

    - by Dona Hertel
    Okay, I have a strange problem I haven't seen listed anywhere. I'm developing an android app and I would like to run it on my Huawei Ascend. I have set up a file in /etc/udev/90-android.rules with the line: SUBSYSTEM=="usb", SYSFS{idVendor}=="12d1", MODE="0666" where '12d1' is the correct vendor ID for this phone (I verified this with 'lsusb' command). When I plug in the phone (it does have debugging on) and restart the adb server I get a connection but the name field does not get set. The output to 'adb devices' is: List of devices attached \n ???????????? device Plugging and unplugging the cable doesn't resolve this. Neither does restarting the adb server. Nor does a total reboot of both my computer or the phone. This is fine as I can get logs and a shell. The problem is that in the eclipse plugin, the device's name is list as "????????????" and so when it tries connect, it quits with an error message of 'device not found' even though the device is listed and 'online'. Is there something else I need to do? Do I need to set the name of the device somehow? cocofan P.S.: The app has 'debuggable' set to true in the manifest file.

    Read the article

  • If setUpBeforeClass() fails, test failures are hidden in PHPUnit's JUnit XML output

    - by Adam Monsen
    If setUpBeforeClass() throws an exception, no failures or errors are reported in the PHPUnit's JUnit XML output. Why? Example test class: <?php class Test extends PHPUnit_Framework_TestCase { public static function setUpBeforeClass() { throw new \Exception('masks all failures in xml output'); } public function testFoo() { $this->fail('failing'); } } Command line: phpunit --verbose --log-junit out.xml Test.php Console output: PHPUnit 3.6.10 by Sebastian Bergmann. E Time: 0 seconds, Memory: 3.25Mb There was 1 error: 1) Test Exception: masks all failures in xml output /tmp/pu/Test.php:6 FAILURES! Tests: 0, Assertions: 0, Errors: 1. JUnit XML output: <?xml version="1.0" encoding="UTF-8"?> <testsuites> <testsuite name="Test" file="/tmp/phpunit-broken/Test.php"/> </testsuites> More info: $ php --version PHP 5.3.10-1ubuntu3.1 with Suhosin-Patch (cli) (built: May 4 2012 02:21:57) Copyright (c) 1997-2012 The PHP Group Zend Engine v2.3.0, Copyright (c) 1998-2012 Zend Technologies with Xdebug v2.1.0, Copyright (c) 2002-2010, by Derick Rethans

    Read the article

  • UnicodeEncodeError: 'ascii' codec can't encode character [...]

    - by user1461135
    I have read the HOWTO on Unicode from the official docs and a full, very detailed article as well. Still I don't get it why it throws me this error. Here is what I attempt: I open an XML file that contains chars out of ASCII range (but inside allowed XML range). I do that with cfg = codecs.open(filename, encoding='utf-8, mode='r') which runs fine. Looking at the string with repr() also shows me a unicode string. Now I go ahead and read that with parseString(cfg.read().encode('utf-8'). Of course, my XML file starts with this: <?xml version="1.0" encoding="utf-8"?>. Although I suppose it is not relevant, I also defined utf-8 for my python script, but since I am not writing unicode characters directly in it, this should not apply here. Same for the following line: from __future__ import unicode_literals which also is right at the beginning. Next thing I pass the generated Object to my own class where I read tags into variables like this: xmldata.getElementsByTagName(tagName)[0].firstChild.data and assign it to a variable in my class. Now what perfectly works are those commands (obj is an instance of the class): for element in obj: print element And this command does work as well: print obj.__repr__() I defined __iter__() to just yield every variable while __repr__() uses the typical printf stuff: "%s" % self.varname Both commands print perfectly and can output the unicode character. What does not work is this: print obj And now I am stuck because this throws the dreaded UnicodeEncodeError: 'ascii' codec can't encode character u'\xfc' in position 47: So what am I missing? What am I doing wrong? I am looking for a general solution, I always want to handle strings as unicode, just to avoid any possible errors and write a compatible program. Edit: I also defined this: def __str__(self): return self.__repr__() def __unicode__(self): return self.__repr__() From documentation I got that this

    Read the article

  • How do repos (SVN, GIT) work?

    - by masfenix
    I read SO nearly everyday and mostly there is a thread about source control. I have a few questions. I am going to use SVN as example. 1) There is a team (small, large dosnt matter). In the morning everyone checks out the code to start working. At noon Person A commits, while person B still works on it. What happens when person B commits? how will person B know that there is an updated file? 2) I am assuming the answer to the first question is "run an update command which tells you", ok so person B finds out that the file they have been working on all morning in changed. When they see the udpated file, it seems like person A has REWRITTEN the file for better performance. What does person B do? Seems like there whole day was a waste of time. Or if they commit their version then its a waste of person A's time? 3) What are branches? thanks, and if anyone knows a laymen terms pdf or something that explains it that would be awesome.

    Read the article

  • Maven3 Issues with building a multi-module enterprise project

    - by Sujit K
    I just migrated from Maven2 to Maven3 and I'm able to build each module individually or all the modules in one shot by calling mvn clean install. However, in Maven2, since we have multi-module enterprise project, we build multiple ear's and each ear is built as its own module with its own child pom. To build an individual ear with its dependents, the below command works fine in Maven2 but not in Maven3. Let me explain the issue in Maven3 a bit later. mvn -pl ear_module -rf first_dependent_module -am clean install In Maven2 when the reactor lists the build order, I see first_dependent_module second_dependent_module ear_module End of the day I have my ear module also part of the reactor which is how it should be. The reason we call -rf is we don't want to delete the target folder at the main ${project.basedir} (so not to delete the output created in target from building the other ear modules). With Maven3, however, this is all I see when the reactor lists the build order: first_dependent_module second_dependent_module Maven3 totally ignores the argument (ear_module) set to -pl flag to be also built after its dependents have been. Not sure what I'm missing here. Any help/tips would be greatly appreciated. P.S: The build I'm making is similar to the one below.... Build specific module in multi-module project Thanks, SK

    Read the article

  • PHP -- automatic SQL injection protection?

    - by ashgromnies
    I took over maintenance of a PHP app recently and I'm not super familiar with PHP but some of the things I've been seeing on the site are making me nervous that it could be vulnerable to a SQL injection attack. For example, see how this code for logging into the administrative section works: $password = md5(HASH_SALT . $_POST['loginPass']); $query = "SELECT * FROM `administrators` WHERE `active`='1' AND `email`='{$_POST['loginEmail']}' AND `password`='{$password}'"; $userInfo = db_fetch_array(db_query($query)); if($userInfo['id']) { $_SESSION['adminLoggedIn'] = true; // user is logged in, other junk happens here, not important The creators of the site made a special db_query method and db_fetch_array method, shown here: function db_query($qstring,$print=0) { return @mysql(DB_NAME,$qstring); } function db_fetch_array($qhandle) { return @mysql_fetch_array($qhandle); } Now, this makes me think I should be able to do some sort of SQL injection attack with an email address like: ' OR 'x'='x' LIMIT 1; and some random password. When I use that on the command line, I get an administrative user back, but when I try it in the application, I get an invalid username/password error, like I should. Could there be some sort of global PHP configuration they have enabled to block these attacks? Where would that be configured? Here is the PHP --version information: # php --version PHP 5.2.12 (cli) (built: Feb 28 2010 15:59:21) Copyright (c) 1997-2009 The PHP Group Zend Engine v2.2.0, Copyright (c) 1998-2009 Zend Technologies with the ionCube PHP Loader v3.3.14, Copyright (c) 2002-2010, by ionCube Ltd., and with Zend Optimizer v3.3.9, Copyright (c) 1998-2009, by Zend Technologies

    Read the article

  • How do you fix loading plugins in eclipse 3.5.1 on linux?

    - by Jay R.
    I have two linux boxes. Both Fedora 11 x64. On one, I downloaded the eclipse-java-galileo-SR1-linux-gtk-x86_64.tar.gz. I unpacked it to /opt/eclipse-3.5.1/ and used the Install New Software... item to install the SVN team provider and the Polarion SVN connectors. Everything works. On the second, I copied the tar.gar for eclipse there, and then tried to follow the same steps. When I get to the install SVN team provided, eclipse downloads it and claims to install it and asks to restart. I restart and there is no SVN support. The software installer knows its there because I can't reinstall it without uninstalling it. So the questions: Why isn't the plugin/feature loading for the SVN Team Support? Is there a checkbox that I forgot about that enables the plugin? Is there a command line option that will force reload all of the features on the disk? I've tried to install other things like findbugs, but I get the same result. I have no messages in the log file indicating an exception or anything like that.

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • Rails wont install at create Makefile stage

    - by mattc
    I am getting this error after running sudo gem install rails /System/Library/Frameworks/Ruby.framework/Versions/1.8/usr/bin/ruby extconf.rb creating Makefile make xcrun cc -I. - I/System/Library/Frameworks/Ruby.framework/Versions/1.8/usr/lib/ruby/1.8/universal-darwin12.0 -I/System/Library/Frameworks/Ruby.framework/Versions/1.8/usr/lib/ruby/1.8/universal-darwin12.0 -I. -DJSON_GENERATOR -D_XOPEN_SOURCE -D_DARWIN_C_SOURCE -fno-common -arch i386 -arch x86_64 -g -O3 -pipe -fno-common -DENABLE_DTRACE -fno-common -pipe -fno-common -c generator.c xcrun: Error: failed to exec real xcrun. (No such file or directory) cc -arch i386 -arch x86_64 -pipe -bundle -undefined dynamic_lookup -o generator.bundle generator.o -L. -L/System/Library/Frameworks/Ruby.framework/Versions/1.8/usr/lib -L. -arch i386 -arch x86_64 -lruby -lpthread -ldl -lobjc i686-apple-darwin11-llvm-gcc-4.2: generator.o: No such file or directory i686-apple-darwin11-llvm-gcc-4.2: generator.o: No such file or directory lipo: can't figure out the architecture type of: /var/tmp//ccHCNNwM.out make: *** [generator.bundle] Error 1 I have Homebrew installed, Xcode 4.4 with command line tools installed, Osx 10.6.2 I run gem env and get this but not sure what I'm looking for: RubyGems Environment: - RUBYGEMS VERSION: 1.8.24 - RUBY VERSION: 1.8.7 (2012-02-08 patchlevel 358) [universal-darwin12.0] - INSTALLATION DIRECTORY: /Library/Ruby/Gems/1.8 - RUBY EXECUTABLE: /System/Library/Frameworks/Ruby.framework/Versions/1.8/usr/bin/ruby - EXECUTABLE DIRECTORY: /usr/bin - RUBYGEMS PLATFORMS: - ruby - universal-darwin-12 - GEM PATHS: - /Library/Ruby/Gems/1.8 - /Users/matthewcleghorn/.gem/ruby/1.8 - /System/Library/Frameworks/Ruby.framework/Versions/1.8/usr/lib/ruby/gems/1.8 - GEM CONFIGURATION: - :update_sources => true - :verbose => true - :benchmark => false - :backtrace => false - :bulk_threshold => 1000 - REMOTE SOURCES: - http://rubygems.org/ Any help greatly appreciated. Thanks.

    Read the article

  • How do you organise multiple git repositories?

    - by dbr
    With SVN, I had a single big repository I kept on a server, and checked-out on a few machines. This was a pretty good backup system, and allowed me easily work on any of the machines. I could checkout a specific project, commit and it updated the 'master' project, or I could checkout the entire thing. Now, I have a bunch of git repositories, for various projects, several of which are on github. I also have the SVN repository I mentioned, imported via the git-svn command.. Basically, I like having all my code (not just projects, but random snippets and scripts, some things like my CV, articles I've written, websites I've made and so on) in one big repository I can easily clone onto remote machines, or memory-sticks/harddrives as backup. The problem is, since it's a private repository, and git doesn't allow checking out of a specific folder (that I could push to github as a separate project, but have the changes appear in both the master-repo, and the sub-repos) I could use the git submodule system, but it doesn't act how I want it too (submodules are pointers to other repositories, and don't really contain the actual code, so it's useless for backup) Currently I have a folder of git-repos (for example, ~/code_projects/proj1/.git/ ~/code_projects/proj2/.git/), and after doing changes to proj1 I do git push github, then I copy the files into ~/Documents/code/python/projects/proj1/ and do a single commit (instead of the numerous ones in the individual repos). Then do git push backupdrive1, git push mymemorystick etc So, the question: How do your personal code and projects with git repositories, and keep them synced and backed-up?

    Read the article

  • C# / Silverlight / WPF / Fast rendering lots of circles

    - by Walt W
    I want to render a lot of circles or small graphics within either silverlight or wpf (around 1000-10000) as fast and as frequently as possible. If I have to go to DX or OGL, that's fine, but I'm wondering about doing this within either of those two frameworks first (read: it's OK if an answer is WPF-only or Silverlight-only). Also, if there is a way to access DX through WPF and render on a surface that way, I would be interested in that as well. So, what's the fastest way to draw a load of circles? They can be as plain as necessary, but they do need to have a radius. Currently I'm using DrawingVisual and a DrawingContext.DrawEllipse() command for each circle, then rendering the visual to a RenderTargetBItmap, but it becomes very slow as the number of circles rises. By the way, these circles move every frame, so caching isn't really an option unless you're going to suggest caching the individual circles . . . But their sizes are dynamic, so I'm not sure that's a great approach.

    Read the article

  • How to associate application with existing file types using WiX installer?

    - by Marek
    related to this: http://stackoverflow.com/questions/138550/how-to-register-file-types-extensions-with-a-wix-installer but not a duplicate. I need to handle existing file types (.jpg files). I do not want to be the default handler for .jpg, I would just like to extend the "Open with" menu with a link to my app. I see HKCR\.jpg\OpenWithList\ and HKCR\.jpg\OpenWithProgIds\ in the registry but I am not sure whether to write to these and how to do it correctly with WiX. Should I use something like this? <ProgId Id='??what here?' Description='Jpeg handled by my App'> <Extension Id='jpg' ContentType='image/jpeg'> <Verb Id='openwithmyapp' Sequence='10' Command='OpenWithMyApp' Target='[!FileId]' Argument='"%1"' /> </Extension> </ProgId> There are many ways how to fail here (like Photo Mechanics did, the HKCR for image file types is a real mess after I have installed this software) How to do this correctly with WiX?

    Read the article

  • Creating a RESTful service in CakePHP

    - by NathanGaskin
    I'm attempting to create a RESTful service in CakePHP but I've hit a bit of a brick wall. I've enabled the default RESTful routing using Router::mapResources('users') and Router::parseExtensions(). This works well if I make a GET request, and returns some nicely formatted XML. So far so good. The problem is if I want to make a POST or PUT request. CakePHP doesn't seem to be able to read the data from the request. At the moment my add(), edit() and delete() actions don't contain any logic, they're simply setting $this-data to the view. I'm testing with the following cURL command: curl -v -d "<user><username>blahblah</username><password>blahblah</password>" http://localhost/users.xml --header 'content-type: text/xml' Which only returns a 404 header. If I remove the --header parameter then it returns the view but no data is set. It feels like I'm missing something obvious here. Any ideas?

    Read the article

  • Resolving the WMI DNS Host Name

    - by Stephen Murby
    I am trying to make a comparison between a machine name i have retrieved from AD, and the DNS Host Name i want to get using WMI from the machine. I currently have: foreach (SearchResult oneMachine in allMachinesCollected) { pcName = oneMachine.Properties["name"][0].ToString(); ConnectionOptions setupConnection = new ConnectionOptions(); setupConnection.Username = USERNAME; setupConnection.Password = PASSWORD; setupConnection.Authority = "ntlmdomain:DOMAIN"; ManagementScope setupScope = new ManagementScope("\\\\" + pcName + "\\root\\cimv2", setupConnection); setupScope.Connect(); ObjectQuery dnsNameQuery = new ObjectQuery("SELECT * FROM Win32_ComputerSystem"); ManagementObjectSearcher dnsNameSearch = new ManagementObjectSearcher(setupScope, dnsNameQuery); ManagementObjectCollection allDNSNames = dnsNameSearch.Get(); string dnsHostName; foreach (ManagementObject oneName in allDNSNames) { dnsHostName = oneName.Properties["DNSHostName"].ToString(); if (dnsHostName == pcName) { shutdownMethods.ShutdownMachine(pcName, USERNAME, PASSWORD); MessageBox.Show(pcName + " has been sent the reboot command"); } } } } But i get a ManagementException dnsHostName = oneName.Properties["DNSHostName"].ToString(); << here saying not found. Any ideas?

    Read the article

  • Installing django on dreamhost (help a newb out)

    - by augustfirst
    I'm trying to get django running on my dreahost account. I've been trying to sort of use two tutorials at once: the one on the dreamhost wiki and the one in the django book. I installed django using the script on the wiki page, but I ran into trouble immediately while trying to work through the django book. It says: To start the server, change into your project directory (cd mysite), if you haven’t already, and run this command: python manage.py runserver This launches the server locally, on port 8000, accessible only to connections from your own computer. Now that it’s running, visit 127.0.0.1:8000 with your Web browser. You’ll see a “Welcome to Django” page shaded in a pleasant pastel blue. It worked! Those instructions seem to assume that you're developing locally, not on a shared server. Where the heck am I supposed to look for the "Welcome to Django" page after starting the server? In my webroot? No dice. Anyway, I tried to blunder ahead through the django book to its hello world tutorial (chapter 3). But once I've edited the view file and the URLconf, I don't get a nice clean "hello world" text. Instead (as you can see) I get an "import error". Any help would be greatly appreciated.

    Read the article

  • Test if Java trusts an SSL certificate

    - by Eric R. Rath
    My java web application uses the standard mail libraries to establish an IMAPS connection to a mail server under my control. The mail server used a valid SSL cert issued by a CA. When the cert expired, I renewed it from the same CA, and put the cert into use. But my web application wouldn't trust the new cert. We had never explicitly trusted the old cert, or managed any trust stores. I talked with someone from the CA, and we tracked it down to a difference in the intermediate certs between the old and new cert. The old one used multiple intermediates, including one tied to a root that must've been trusted by default by our version of Java. The new cert used only one intermediate cert, and it was tied to a root missing from our Java version's default trusted cert store. When we renew this cert again in the future, is there an easy way, given a new crt and intermediate crt file, test if Java will consider that cert valid? I didn't see anything in keytool that looked promising. A code solution is okay, but I'd prefer one based on the Java command-line tools.

    Read the article

  • How do people handle foreign keys on clients when synchronizing to master db

    - by excsm
    Hi, I'm writing an application with offline support. i.e. browser/mobile clients sync commands to the master db every so often. I'm using uuid's on both client and server-side. When synching up to the server, the servre will return a map of local uuids (luid) to server uuids (suid). Upon receiving this map, clients updated their records suid attributes with the appropriate values. However, say a client record, e.g. a todo, has an attribute 'list_id' which holds the foreign key to the todos' list record. I use luids in foreign_keys on clients. However, when that attribute is sent over to the server, it would dirty the server db with luids rather than the suid the server is using. My current solution, is for the master server to keep a record of the mappings of luids to suids (per client id) and for each foreign key in a command, look up the suid for that particular client and use the suid instead. I'm wondering wether others have come across thus problem and if so how they have solved it? Is there a more efficient, simpler way? I took a look at this question "Synchronizing one or more databases with a master database - Foreign keys (5)" and someone seemed to suggest my current solution as one option, composite keys using suids and autoincrementing sequences and another option using -ve ids for client ids and then updating all negative ids with the suids. Both of these other options seem like a lot more work. Thanks, Saimon

    Read the article

  • Hibernate saveorUpdate method problem

    - by umesh awasthi
    Hi all, i am trying to work on with Hibernate (Database side for first time) and some how struck in choosing best possible way to use saveOrUpdate or Save.Update i have a destination POJO class and its other attributes which needs to be updated along with the Destination entity. i am getting an XML file to be imported and i am using the following code to update/save the destination entity along with its attribute classes. try{ getSessionFactory().getCurrentSession().beginTransaction(); getSessionFactory().getCurrentSession().saveOrUpdate(entity); getSessionFactory().getCurrentSession().getTransaction().commit(); } catch(Exception e){ getSessionFactory().getCurrentSession().getTransaction().rollback(); } finally{ getSessionFactory().close(); } everything is working fine untill i am using the same session instance.but later on when i am using the same XML file to update the destination PO for certain attributes it giving me the following error. SEVERE: Duplicate entry 'MNLI' for key 'DESTINATIONID' 9 Jan, 2011 4:58:11 PM org.hibernate.event.def.AbstractFlushingEventListener performExecutions SEVERE: Could not synchronize database state with session org.hibernate.exception.ConstraintViolationException: Could not execute JDBC batch update at org.hibernate.exception.SQLStateConverter.convert(SQLStateConverter.java:94) at org.hibernate.exception.JDBCExceptionHelper.convert(JDBCExceptionHelper.java:66) at org.hibernate.jdbc.AbstractBatcher.executeBatch(AbstractBatcher.java:275) at org.hibernate.jdbc.AbstractBatcher.prepareStatement(AbstractBatcher.java:114) at org.hibernate.jdbc.AbstractBatcher.prepareStatement(AbstractBatcher.java:109) at org.hibernate.jdbc.AbstractBatcher.prepareBatchStatement(AbstractBatcher.java:244) at org.hibernate.persister.entity.AbstractEntityPersister.insert(AbstractEntityPersister.java:2242) at org.hibernate.persister.entity.AbstractEntityPersister.insert(AbstractEntityPersister.java:2678) at org.hibernate.action.EntityInsertAction.execute(EntityInsertAction.java:79) i am using UUID as primary key for the Destination table and in destination table i have a destination id which is unique.but i can understand that in the secodn case hibernate is not able to find if there is already an entry for the same destination in the DB and trying to execute insert statement rather than update. one possible solution is i can user destinationid to check if there is already a destination inplace with the given id and based on the results i can issue save or update command. my question is can this be achieve by any other good way..? Thanks in advance

    Read the article

  • Problems installing PIL after OSX 10.9

    - by user2632417
    I installed Mac OSX 10.9 the day it came out. Afterwards I decided I needed to install PIL. I'd installed it before, but it appeared the update had broken that. When I try to use pip to install PIL, it fails when building _imaging. It appears the root cause is this. /usr/include/sys/cdefs.h:655:2: error: Unsupported architecture Theres also a similar error here: /usr/include/machine/limits.h:8:2: error: architecture not supported and here: /usr/include/machine/_types.h:34:2: error: architecture not supported Then there's a whole list of missing types. /usr/include/sys/_types.h:94:9: error: unknown type name '__int64_t' typedef __int64_t __darwin_blkcnt_t; /* total blocks */ ^ /usr/include/sys/_types.h:95:9: error: unknown type name '__int32_t' typedef __int32_t __darwin_blksize_t; /* preferred block size */ ^ /usr/include/sys/_types.h:96:9: error: unknown type name '__int32_t' typedef __int32_t __darwin_dev_t; /* dev_t */ ^ /usr/include/sys/_types.h:99:9: error: unknown type name '__uint32_t' typedef __uint32_t __darwin_gid_t; /* [???] process and group IDs */ ^ /usr/include/sys/_types.h:100:9: error: unknown type name '__uint32_t' typedef __uint32_t __darwin_id_t; /* [XSI] pid_t, uid_t, or gid_t*/ ^ /usr/include/sys/_types.h:101:9: error: unknown type name '__uint64_t' typedef __uint64_t __darwin_ino64_t; /* [???] Used for 64 bit inodes */ Needless to say I don't know where to go from here. I've got a couple of guesses, but I don't even know how to check. Wrong include probably as a result of a badly configured environment variable Problem with Xcode's installation/ missing command line tools Messed up header files If anyone has any suggestions either to check one of those possibilities or for one of their own I'm all ears.

    Read the article

  • MinGW-gcc PCH not speeding up wxWidget build times. Is my setup correct?

    - by Victor T.
    Hi all, I've been building wxMSW 2.8.11 with the latest stable release of mingw-gcc 4.5.1 and I'm trying to see if the build could be sped up using precompiled headers. My initial attempts at this doesn't seem to work. I basically followed the given instructions here. I created a wxprec.h precompiled header with the following: g++ -O2 -mthreads -DHAVE_W32API_H -D__WXMSW__ -DNDEBUG -D_UNICODE -I..\..\lib\gcc_dll\mswu -I..\..\include -W -Wall -DWXBUILDING -I..\.. \src\tiff -I..\..\src\jpeg -I..\..\src\png -I..\..\src\zlib -I..\..\src \regex -I..\..\src\expat\lib -DwxUSE_BASE=1 -DWXMAKINGDLL -Wno-ctor- dtor-privacy ../../include/wx/wxprec.h That does successfully create a wxprec.h.gch that's about ~1.6meg in size. Now I proceed to build wxmsw using the follow make command from cmd.exe shell: mingw32-make -f makefile.gcc While, the build does succeed I noticed no speedup whatsoever then if pch wasn't used. To make sure gcc was actually using the pch I added -H in the config.gcc and did another rebuild. Indeed, the outputted include list does show a '!' next to the wxprec.h so gcc is supposely using it. What's the reason for pch not working? Did I setup the precompiled headers correctly or am I missing a step? Just for reference comparison, here's the compile times I get when building wxmsw 2.8.11 with the other compilers(visual studio 2010 and C++ Builder 2007). The time savings is pretty significant. | | release, pch | release, nopch | debug, nopch ------------------------------------------------------- | gcc451 | 8min 33sec | 8min 17sec | 8min 49sec | msc_1600 | 2min 23sec | 13min 11sec | -- | bcc593 | 0min 59sec | 2min 29sec | -- Thanks

    Read the article

  • How can I show print statements in debug mode of OPNET Modeler?

    - by Here now
    I'm writing C++ code in OPNET Modeler. I try to simulate my scenario in debugger mode & I need to trace the function that I wrote it. I need to show print statements which I put it in my code. I used in debugger mode: ***ltr function_name()*** then ***c*** But the result looks like: Type 'help' for Command Summary ODB> ltr enqueue_packet() Added trace #0: trace on label (enqueue_packet()) ODB> c |-----------------------------------------------------------------------------| | Progress: Time (1 min. 52 sec.); Events (500,002) | | Speed: Average (82,575 events/sec.); Current (82,575 events/sec.) | | Time : Elapsed (6.1 sec.) | | DES Log: 28 entries | |-----------------------------------------------------------------------------| |-----------------------------------------------------------------------------| | Progress: Time (1 min. 55 sec.); Events (1,000,002) | | Speed: Average (69,027 events/sec.); Current (59,298 events/sec.) | | Time : Elapsed (14 sec.) | | DES Log: 28 entries | |-----------------------------------------------------------------------------| |-----------------------------------------------------------------------------| | Progress: Time (1 min. 59 sec.); Events (1,500,002) | | Speed: Average (51,464 events/sec.); Current (34,108 events/sec.) | | Time : Elapsed (29 sec.) | | DES Log: 28 entries | |-----------------------------------------------------------------------------| |-----------------------------------------------------------------------------| | Simulation Completed - Collating Results. | | Events: Total (1,591,301); Average Speed (48,803 events/sec.) | | Time : Elapsed (33 sec.); Simulated (2 min. 0 sec.) | | DES Log: 29 entries | |-----------------------------------------------------------------------------| |-----------------------------------------------------------------------------| | Reading network model. | |-----------------------------------------------------------------------------| I need to show the print statements in my code. Where it has to be appeared? Is there any step before run the simulation to insure that OPNET debugger using Visual Studio & go through my code??

    Read the article

< Previous Page | 825 826 827 828 829 830 831 832 833 834 835 836  | Next Page >