Search Results

Search found 34826 results on 1394 pages for 'valid html'.

Page 860/1394 | < Previous Page | 856 857 858 859 860 861 862 863 864 865 866 867  | Next Page >

  • mysql fetch error

    - by Luke
    <? $res = $database->userLatestStatus($u); while($row=mysql_fetch_assoc($res)){ $status=$row['status']; echo "$status"; } ?> This is the code on my page, which is throwing up the following error: Warning: mysql_fetch_assoc(): supplied argument is not a valid MySQL result resource.... The database function: function userLatestStatus($u) { $q = "SELECT status FROM ".TBL_STATUS." WHERE userid = '$u' DESC LIMIT 1"; return mysql_query($q, $this->connection); } Any ideas what the problem is?

    Read the article

  • For securing forms, when do I issue the token?

    - by AQuestionADayKeepsTheDrAway
    So, I have a form, to make it a little more secure and potentially help prevent CSRF attacks I want to add a random token value in a hidden field that value is also stored server side in my session data. When should I issue a new token? Per form? Per page load where there is any form? Per session? I can render it invalid as soon as a form is successfully submitted but I'm wondering when to generate one. I ask as if I issue it per form or per page do I not risk the chance of a duplicate token value overwriting the existing (valid) token if a user opens a separate window but submitting the first form (with the now overwritten value)?

    Read the article

  • In a shared .iml file, what should the jdkName be for an IntelliJ IDEA Plugin SDK?

    - by bolinfest
    I work on a team where we commit our .iml files in version control so that everyone can use them. We have an .iml file for a plugin module, which includes the following: <orderEntry type="jdk" jdkName="IDEA IC-117.798" jdkType="IDEA JDK" /> however, that only works for people who are using that version (IC-117.798) of IntelliJ (some are on 12, some are using the ultimate edition, etc.) Is there any sort of variable like $INTELLIJ_SDK that could be used for the value of jdkName so that the .iml file is valid regardless of which version of IntelliJ you are using?

    Read the article

  • Why the data binding in this validation example works in WPF?

    - by MartyIX
    I'm wondering how exactly the XAML sample (MSDN sample) works: <Style x:Key="textBoxInError" TargetType="{x:Type TextBox}"> <Style.Triggers> <Trigger Property="Validation.HasError" Value="true"> <Setter Property="ToolTip" Value="{Binding RelativeSource={x:Static RelativeSource.Self}, Path=(Validation.Errors)[0].ErrorContent}"/> </Trigger> </Style.Triggers> </Style> Questions: (Validation.Errors)[0].ErrorContent - Is this code somehow checked by WPF? Because Validation.Errors may be an empty collection and in ordinary C# code this code may throw an exception. If this data-binding returns null for valid input - the null value is then casted to empty string (in a text control for example)? The index 0 corresponds to the first error message. How can I return more error messages from Validate method? Thank you for responses!

    Read the article

  • Conditional Branching Issues

    - by Zack
    Here is the code: def main_menu print_main_menu user_selected = gets.chomp if user_selected.downcase == "no" main_menu elsif user_selected == "1" || "2" || "3" || "4" || "5" || "6" || "7" user_selected = user_selected.to_i call_option(user_selected) else main_menu end end This code uses calls to allow a user to make a selection from a main menu. Depending on the input, be it a certain number, a certain word, or something else, the respective method is called (in the case of a valid input) or the main menu is printed again (in the case of an invalid input or "no"). My questions are twofold. 1) Is there an efficient way to get rid of the literal string error that appears as a result of this redundant or statement on the elsif line? (the code itself works fine, but this error appears and is frustrating). 2) When an alternate/unspecified input is made by the user, the else branch doesn't execute and main_method doesn't start over. I have no idea why this is happening. Is there something I'm missing here? Thanks

    Read the article

  • VC++ to C# migration guidelines/approaches/Issues

    - by KSH
    Hi all, We are planning to move few of our VC++ Legacy products to C# with .NET platform.. I am in the process of collecting the relavent information before making the proposal to give optimistic and effective approach to clients. Am looking for the following details. Any general guidelines in migration of VC++ to C#.NET What are the issues that a team can face when we take up this activity Are there any existing approaches available ? I believe many might have tried but may not have detailed information, but consolidating this under this would help not only me but anyone who look for these information. Any good / valid resources available on internet? Any suggestions from Microsoft team if any Microsoft people in this group? Architecture, components design approaches, etc. Please help me in getting these information, each penny would help me to gain good understanding.. Thanks in advance to those who will share their wisdom thorough this query.

    Read the article

  • Yet another URL prefix regex question (to be used in C#).

    - by Hamish Grubijan
    Hi, I have seen many regular expressions for Url validation. In my case I want the Url to be simpler, so the regex should be tighter: Valid Url prefixes look like: http[s]://[www.]addressOrIp[.something]/PageName.aspx[?] This describe a prefix. I will be appending ?x=a&y=b&z=c later. I just want to check if the web page is live before accessing it, but even before that I want to make sure that it is properly configured. I want to treat bad url and host is down conditions differently, although when in doubt, I'd rather give a host is down message, because that is an ultimate test anyway. Hopefully that makes sense. I guess what I am trying to say - the regex does not need be too aggressive, I just want it to cover say 95% of the cases. This is C# - centric, so Perl regex extensions are not helpful to me; let's stick to the lowest common denominator. Thanks!

    Read the article

  • .NET Regex - need matching string for parsing...

    - by TomTom
    Hello, I am a regex idiot and never found a good tutorial (links welcome, as well as a pointer to an interactive VS2010 integrated editor). I need to parse strings in the following form: [a/b]:c/d a, b: double with "." as possible separator. CAN be empty c: double with "." as separator d: integer, positive I.e. valid strings are: [/]:0.25/2 [-0.5/0.5]:0.05/2 [/0.1]:0.05/2 ;) Anyone can help? Thanks

    Read the article

  • set the size of the tooltip dialog box depending on the text

    - by xrx215
    How do i set the size of the tooltip dialog box. the tooltip text must be displayed in one line rather than wrapping the text to other line. in firefox tooltip text is showed in one line but in IE the tooltip text is wrapped . i.e text is displayed in 2 lines. asp:Image runat="server" ID="iUrl" Visible="false" ImageUrl="~/Widgets/FMP_Printers/images/status icons/icon_Fault_Enabled.gif" / if (txtUrl.Text.ToUpper().IndexOf("HTTP://") < 0 && txtUrl.Text.ToUpper().IndexOf("HTTPS://") < 0) { iUrl.Visible = true; iUrl.ToolTip = "ghghghghghghghghghghghghghghghghghghghghghghghghghghghghghghghgh"; valid = false; }

    Read the article

  • SQL Server 2003: how can I assign a name to the SUM column ?

    - by Patrick
    hi, how can I assign a column name to the SUM column ? i.e. select OwnerUserId, SUM(PostScore) INTO Experts from ... I get this error: An object or column name is missing or empty. For SELECT INTO statements, verify each column has a name. For other statements, look for empty alias names. Aliases defined as "" or [] are not allowed. Change the alias to a valid name. I guess because the column containing the results of SUM has not name. thanks

    Read the article

  • Create set of random JPGs

    - by Kylar
    Here's the scenario, I want to create a set of random, small jpg's - anywhere between 50 bytes and 8k in size - the actual visual content of the jpeg is irrelevant as long as they're valid. I need to generate a thousand or so, and they all have to be unique - even if they're only different by a single pixel. Can I just write a jpeg header/footer and some random bytes in there? I'm not able to use existing photos or sets of photos from the web. The second issue is that the set of images has to be different for each run of the program. I'd prefer to do this in python, as the wrapping scripts are in Python. I've looked for python code to generate jpg's from scratch, and didn't find anything, so pointers to libraries are just as good.

    Read the article

  • How do i view the index version of a file before it is committed?

    - by lsiden
    I have just performed add --interactive, so the index version of some files is different than the working-directory versions. Instead of doing diff --cached, I want to actually dump the contents of each file in the index, but I can't find a command to do that. I should think that there would be something like "git show INDEX:filename...", but "INDEX" is not a valid object name. I was able to do git ls --cached, then git show , but there should be a more straightforward method to see what you are committing.

    Read the article

  • Implementing an iterator over binary tree using C++ 11

    - by user1459339
    I would like to create an iterator over the binary tree so as to be able to use range-based for loop. I understand I ought to implement the begin() and end() function first. Begin should probably point to the root. According to the specification, however, the end() functions returns "the element following the last valid element". Which element (node) is that? Would it not be illegal to point to some "invalid" place? The other thing is the operator++. What is the best way to return "next" element in tree? I just need some advice to begin with this programming.

    Read the article

  • enable_shared_from_this and inheritance

    - by DeadMG
    I've got a type which inherits from enable_shared_from_this<type>, and another type that inherits from this type. Now I can't use the shared_from_this method because it returns the base type and in a specific derived class method I need the derived type. Is it valid to just construct a shared_ptr from this directly? Edit: In a related question, how can I move from an rvalue of type shared_ptr<base> to a type of shared_ptr<derived>? I used dynamic_cast to verify that it really was the correct type, but now I can't seem to accomplish the actual move.

    Read the article

  • Enableeventvalidation in web user control

    - by Khushi
    Hi, i have a web user control containing a repeater. The repeater contains three buttons. On button click it gives the following error : Invalid postback or callback argument. Event validation is enabled using in configuration or <%@ Page EnableEventValidation="true" % in a page. For security purposes, this feature verifies that arguments to postback or callback events originate from the server control that originally rendered them. If the data is valid and expected, use the ClientScriptManager.RegisterForEventValidation method in order to register the postback or callback data for validation. Since user control does not have page directive, so i changed the enableEventValidation to false, but it restricted the itemcommand event of the repeater. Can someone guide me, how to solve this problem?

    Read the article

  • How can I filter out the "My Computer"-option in a SWT DirectoryDialog?

    - by Superfisi
    Hello *, in our Eclipse RCP application running on Windows XP we use a DirectoryDialog, in which the user should... ahmm... choose a directory! :D The problem is: If the user selects the "My Computer"-option (in German Windows "Arbeitsplatz") the Dialog returns null. The DirectoryDialog provides a method setFilterPath(String path) in which I put the File.pathSeparatorChar (to remain OS-independant). My suggestion was that if there has to be a file separator in the directory the "My Computer"-option would be ignored cause it is null - for example the "OK"-button would be greyed out or sth. like that... but it is also valid to klick "OK". Any suggestions from your side? :D Thanks in advance! Alex

    Read the article

  • Entity Framework: Attached Entities not Saving

    - by blog
    Hello: I can't figure out why calling SaveChanges() on the following code results in no changes to the objects I attached: // delete existing user roles before re-attaching if (accountUser.AccountRoles.Count > 0) { foreach (AccountRole role in accountUser.AccountRoles.ToList()) { accountUser.AccountRoles.Remove(role); } } // get roles to add List<int> roleIDs = new List<int>(); foreach (UserRole r in this.AccountRoles) { roleIDs.Add(r.RoleID); } var roleEntities = from roles in db.AccountRoles where roleIDs.Contains(roles.id) select roles; accountUser.AccountRoles.Attach(roleEntities); db.SaveChanges(); In the debugger, I see that the correct roleEntities are being loaded, and that they are valid objects. However, if I use SQL Profiler I see no UPDATE or INSERT queries coming in, and as a result none of my attached objects are being saved.

    Read the article

  • AJAX Panel not throwing exceptions

    - by Grant
    Hi, i have just noticed something strange in some asp.net markup. I have a standard form with a couple of textboxes and a submit button. When clicked the code behind will attempt to perform some logic and then return. If the input values are not valid it used to throw an exception. The moment i wrapped the controls in an AJAX update panel and try to submit bad data, no exception is thrown and the panel returns like nothing was wrong. Does anyone know how to return this to the previous behavior whilst keeping the update panel?

    Read the article

  • Do not want Form to display over other application windows

    - by Cat
    I am displaying a Form from one process by passing the Show method a window handle from another process. I only want this new Form to display above the passed Form, like a MessageBox. However, this newly launched Form appears above other application windows, despite: Setting Process.WindowStyle.Hidden to the Form-displaying process Overriding the ShowWithoutActivation and CreateParams properties of the Form. Making sure Form.TopMost is not true I have checked that the window handle is valid from the second process. Focus is not stolen, however. Process A: Pass (Form) window handle to a new Process B via the command line Process B: Display a new Form using Form.Show(anotherProcessWindowHandle)

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Problems when trying to submit iphone app

    - by ryug
    I'm a fairly new developer. When I try to submit my iphone app with xcode, I've got error as follows; Code Sign error: The identity 'iPhone Distribution' doesn't match any valid, non-expired certificate/private key pair in the default keychain After searching, I found out that I have to create a Distribution Provisioning Profile. However, my distribution provisioning profile doesn't work, even though my Development Provisioning Profile works perfectly. Could someone please help me with this problem? I'm stuck all day... and please forgive me that my English is not great. Thank you in advance.

    Read the article

  • When can we say that we have mastered something

    - by Thinking
    I donot know if this is a valid question to ask here or not but I have asked this as because i have the doubt In many interviews , the interviewer ask as how much you want ot rate yourself on a scale of 10 in C#, Jave etc. Some says 6 some 7 .... My question is how to judge where I am standing at present? And when can we say that we have mastered a language or a topic. As everything is huge and everyday we learn something.. so there is no end to it... so how can I judge that? Thanks

    Read the article

  • Get result type of function

    - by Robert
    I want to specialize a template function declared as: template<typename Type> Type read(std::istream& is); I then have a lot of static implementations static int read_integer(std::istream& is); a.s.o. Now I'd like to do a macro so that specialization of read is as simple as: SPECIALIZE_READ(read_integer) So I figured I'd go the boost::function_traits way and declare SPECIALIZE_READ as: #define SPECIALIZE_READ(read_function) \ template<> boost::function_traits<read_function>::result_type read(std::istream& is) { \ return read_function(is); \ } but VC++ (2008) compiler complains with: 'boost::function_traits' : 'read_integer' is not a valid template type argument for parameter 'Function' Ideas ?

    Read the article

  • About Attributes member of LUID_AND_ATTRIBUTES used in TOKEN_PRIVILEGES structure

    - by Astaroth
    MSDN article, Enabling and Disabling Privileges in C++, provided the a code example to show how to enable or disable a privilege in an access token. I quote the part in questioned: tp.PrivilegeCount = 1; tp.Privileges[0].Luid = luid; if (bEnablePrivilege) tp.Privileges[0].Attributes = SE_PRIVILEGE_ENABLED; else tp.Privileges[0].Attributes = 0; What is the meaning of zero value for Attributes member? According to the documentation of TOKEN_PRIVILEGES structure, the attributes of a privilege can be a combination of the following values: SE_PRIVILEGE_ENABLED  (it is 0x00000002L in WinNT.h) SE_PRIVILEGE_ENABLED_BY_DEFAULT  (it is 0x00000001L in WinNT.h) SE_PRIVILEGE_REMOVED  (it is 0x00000004L in WinNT.h) SE_PRIVILEGE_USED_FOR_ACCESS  (it is 0x80000000L in WinNT.h) So, we don't see any valid constant with a value of zero. I guess, the zero is equal to SE_PRIVILEGE_REMOVED. Anybody here could explain what the zero value really does?

    Read the article

  • C# method contents validation

    - by user258651
    I need to validate the contents of a C# method. I do not care about syntax errors that do not affect the method's scope. I do care about characters that will invalidate parsing of the rest of the code. For example: method() { /* valid comment */ /* <-- bad for (i..) { } for (i..) { <-- bad } I need to validate/fix any non-paired characters. This includeds /* */, { }, and maybe others. How should I go about this? My first thought was Regex, but that clearly isn't going to get the job done.

    Read the article

< Previous Page | 856 857 858 859 860 861 862 863 864 865 866 867  | Next Page >