Search Results

Search found 34826 results on 1394 pages for 'valid html'.

Page 860/1394 | < Previous Page | 856 857 858 859 860 861 862 863 864 865 866 867  | Next Page >

• SQL Server dynamic pivot table

  - by user972255

  In SQL Server, I have two tables TableA and TableB, based on these I need to generate a report which is kind of very complex and after doing some research I come to a conclusion that I have to go with SQL Pivot table but I dont have any idea about the SQL Pivot feature so, can anyone please help me on this. Please see the details below: Create table TableA ( ProjectID INT NOT NULL, ControlID INT NOT NULL, ControlCode Varchar(2) NOT NULL, ControlPoint Decimal NULL, ControlScore Decimal NULL, ControlValue Varchar(50) ) Sample Data ------------- ProjectID | ControlID | ControlCode | ControlPoint | ControlScore | ControlValue P001 1 A 30.44 65 Invalid P001 2 C 45.30 85 Valid Create table TableB ( ControlID INT NOT NULL, ControlChildID INT NOT NULL, ControlChildValue Varchar(200) NULL ) Sample Data ------------ ControlID | ControlChildID | ControlChildValue 1 100 Yes 1 101 No 1 102 NA 1 103 Others 2 104 Yes 2 105 SomeValue Output should be in a single row for a given ProjectID with all its Control values first & followed by child control values (based on the ControlCode (i.e.) ControlCode_Child (1, 2, 3...) and it should look like this

  Read the article

• mysql fetch error

  - by Luke

  <? $res = $database->userLatestStatus($u); while($row=mysql_fetch_assoc($res)){ $status=$row['status']; echo "$status"; } ?> This is the code on my page, which is throwing up the following error: Warning: mysql_fetch_assoc(): supplied argument is not a valid MySQL result resource.... The database function: function userLatestStatus($u) { $q = "SELECT status FROM ".TBL_STATUS." WHERE userid = '$u' DESC LIMIT 1"; return mysql_query($q, $this->connection); } Any ideas what the problem is?

  Read the article

• In a shared .iml file, what should the jdkName be for an IntelliJ IDEA Plugin SDK?

  - by bolinfest

  I work on a team where we commit our .iml files in version control so that everyone can use them. We have an .iml file for a plugin module, which includes the following: <orderEntry type="jdk" jdkName="IDEA IC-117.798" jdkType="IDEA JDK" /> however, that only works for people who are using that version (IC-117.798) of IntelliJ (some are on 12, some are using the ultimate edition, etc.) Is there any sort of variable like $INTELLIJ_SDK that could be used for the value of jdkName so that the .iml file is valid regardless of which version of IntelliJ you are using?

  Read the article

• How can I assign a DBNull in a better way?

  - by Mike

  Hi, I need to parse value from a datarow and assign it to another datarow.If the input is valid, then I need to parse it to double or else add a dbnull value to the output.I'm doing the following, is there a better way to do it? public double? GetVolume(object data) { string colValue = data == null ? string.Empty : data.ToString(); double volume; if (!Double.TryParse(colValue.ToString(), out volume)) { return null; } return volume; } public void Assign(DataRow theRowInput,DataRow theRowOutput) { double? volume = GetVolume(theRowInput[0]); if(volumne.HasValue) theRowOutput[0] = volume.value; else theRowOutput[0] = DbNull.Value; return theRowOutput; } Thanks, -M

  Read the article

• ruby on rails w/ SQLServer

  - by jaydel

  I've heard from some people that RoR doesn't marry cleanly with SQLServer. We have a series of historical, standardization to use SQLServer but if we can push back with valid reasons we can move to another db. One person on the team wants MySql and another wants Postgres, etc. I'm trying to stay out of the religious wars and really understand what the pain point is with SQLServer. We're running the app server on a linux box, and the database will be on a windows box and the SQLServer that we're supposed to standardize on is 2008, if those details help any... thanks in advance!

  Read the article

• Entity Framework: Attached Entities not Saving

  - by blog

  Hello: I can't figure out why calling SaveChanges() on the following code results in no changes to the objects I attached: // delete existing user roles before re-attaching if (accountUser.AccountRoles.Count > 0) { foreach (AccountRole role in accountUser.AccountRoles.ToList()) { accountUser.AccountRoles.Remove(role); } } // get roles to add List<int> roleIDs = new List<int>(); foreach (UserRole r in this.AccountRoles) { roleIDs.Add(r.RoleID); } var roleEntities = from roles in db.AccountRoles where roleIDs.Contains(roles.id) select roles; accountUser.AccountRoles.Attach(roleEntities); db.SaveChanges(); In the debugger, I see that the correct roleEntities are being loaded, and that they are valid objects. However, if I use SQL Profiler I see no UPDATE or INSERT queries coming in, and as a result none of my attached objects are being saved.

  Read the article

• Enableeventvalidation in web user control

  - by Khushi

  Hi, i have a web user control containing a repeater. The repeater contains three buttons. On button click it gives the following error : Invalid postback or callback argument. Event validation is enabled using in configuration or <%@ Page EnableEventValidation="true" % in a page. For security purposes, this feature verifies that arguments to postback or callback events originate from the server control that originally rendered them. If the data is valid and expected, use the ClientScriptManager.RegisterForEventValidation method in order to register the postback or callback data for validation. Since user control does not have page directive, so i changed the enableEventValidation to false, but it restricted the itemcommand event of the repeater. Can someone guide me, how to solve this problem?

  Read the article

• java - check if string ends with certain pattern

  - by The Learner

  I have string like: This.is.a.great.place.too.work. (or) This/is/a/great/place/too/work/ than my java program should give me that the sentence is valid and it has "work". if i Have : This.is.a.great.place.too.work.hahahha (or) This/is/a/great/place/too/work/hahahah Should not give me that there is a work in the sentance. so I am looking at java strings to find a word at the end of the sentance having . (or),(or)/ before it. How can I achieve that

  Read the article

• enable_shared_from_this and inheritance

  - by DeadMG

  I've got a type which inherits from enable_shared_from_this<type>, and another type that inherits from this type. Now I can't use the shared_from_this method because it returns the base type and in a specific derived class method I need the derived type. Is it valid to just construct a shared_ptr from this directly? Edit: In a related question, how can I move from an rvalue of type shared_ptr<base> to a type of shared_ptr<derived>? I used dynamic_cast to verify that it really was the correct type, but now I can't seem to accomplish the actual move.

  Read the article

• Splitting Nucleotide Sequences in JS with Regexp

  - by TEmerson

  I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

  Read the article

• .NET Regex - need matching string for parsing...

  - by TomTom

  Hello, I am a regex idiot and never found a good tutorial (links welcome, as well as a pointer to an interactive VS2010 integrated editor). I need to parse strings in the following form: [a/b]:c/d a, b: double with "." as possible separator. CAN be empty c: double with "." as separator d: integer, positive I.e. valid strings are: [/]:0.25/2 [-0.5/0.5]:0.05/2 [/0.1]:0.05/2 ;) Anyone can help? Thanks

  Read the article

• How do i view the index version of a file before it is committed?

  - by lsiden

  I have just performed add --interactive, so the index version of some files is different than the working-directory versions. Instead of doing diff --cached, I want to actually dump the contents of each file in the index, but I can't find a command to do that. I should think that there would be something like "git show INDEX:filename...", but "INDEX" is not a valid object name. I was able to do git ls --cached, then git show , but there should be a more straightforward method to see what you are committing.

  Read the article

• how to run frame one after the other

  - by user1758401

  I am developing an application where the valid user gets access to the main application. But a problem arises when I run main class. The LoginFrame and Main(Editor.java) Frame start simultaneously. I want to first validate the user and then direct the user to the main application. I am calling Loginform.java from my main application (i.e Editor.java) java.awt.EventQueue.invokeLater(new Runnable() { public void run() { new Login().setVisible(true); { Editor x = new Editor(); x.setVisible(true); } } });

  Read the article

• Do not want Form to display over other application windows

  - by Cat

  I am displaying a Form from one process by passing the Show method a window handle from another process. I only want this new Form to display above the passed Form, like a MessageBox. However, this newly launched Form appears above other application windows, despite: Setting Process.WindowStyle.Hidden to the Form-displaying process Overriding the ShowWithoutActivation and CreateParams properties of the Form. Making sure Form.TopMost is not true I have checked that the window handle is valid from the second process. Focus is not stolen, however. Process A: Pass (Form) window handle to a new Process B via the command line Process B: Display a new Form using Form.Show(anotherProcessWindowHandle)

  Read the article

• Touchscreen sensitivity

  - by Aashish J Kumar

  I'm trying to make an android app only for tablets, which will draw the lines as and where the user touches the screen. It is very simple and there are lot more apps like this. I have a doubt regarding the touch-screen technology. Is there any possibility that if the user touch the screen soft then the lines will be dull and if the user touch the screen harder then the lines drawn will be thicker? Is it even possible to do such things in tablet? I don't have info about the hardware and technology used in tablets, please guide me with a valid answers and please refer me to any blogs or docs which says about the touch sense technology. Thank you

  Read the article

• AJAX Panel not throwing exceptions

  - by Grant

  Hi, i have just noticed something strange in some asp.net markup. I have a standard form with a couple of textboxes and a submit button. When clicked the code behind will attempt to perform some logic and then return. If the input values are not valid it used to throw an exception. The moment i wrapped the controls in an AJAX update panel and try to submit bad data, no exception is thrown and the panel returns like nothing was wrong. Does anyone know how to return this to the previous behavior whilst keeping the update panel?

  Read the article

• Are there any real life uses for the Java byte primitive type?

  - by Thorbjørn Ravn Andersen

  For some inexplicable reason the byte primitive type is signed in Java. This mean that valid values are -128..127 instead of the usual 0..255 range representing 8 significant bits in a byte (without a sign bit). This mean that all byte manipulation code usually does integer calculations and end up masking out the last 8 bits. I was wondering if there is any real life scenario where the Java byte primitive type fits perfectly or if it is simply a completely useless design decision? EDIT: The sole actual use case was a single-byte placeholder for native code. In other words, not to be manipulated as a byte inside Java code.

  Read the article

• Create set of random JPGs

  - by Kylar

  Here's the scenario, I want to create a set of random, small jpg's - anywhere between 50 bytes and 8k in size - the actual visual content of the jpeg is irrelevant as long as they're valid. I need to generate a thousand or so, and they all have to be unique - even if they're only different by a single pixel. Can I just write a jpeg header/footer and some random bytes in there? I'm not able to use existing photos or sets of photos from the web. The second issue is that the set of images has to be different for each run of the program. I'd prefer to do this in python, as the wrapping scripts are in Python. I've looked for python code to generate jpg's from scratch, and didn't find anything, so pointers to libraries are just as good.

  Read the article

• Implementing an iterator over binary tree using C++ 11

  - by user1459339

  I would like to create an iterator over the binary tree so as to be able to use range-based for loop. I understand I ought to implement the begin() and end() function first. Begin should probably point to the root. According to the specification, however, the end() functions returns "the element following the last valid element". Which element (node) is that? Would it not be illegal to point to some "invalid" place? The other thing is the operator++. What is the best way to return "next" element in tree? I just need some advice to begin with this programming.

  Read the article

• When can we say that we have mastered something

  - by Thinking

  I donot know if this is a valid question to ask here or not but I have asked this as because i have the doubt In many interviews , the interviewer ask as how much you want ot rate yourself on a scale of 10 in C#, Jave etc. Some says 6 some 7 .... My question is how to judge where I am standing at present? And when can we say that we have mastered a language or a topic. As everything is huge and everyday we learn something.. so there is no end to it... so how can I judge that? Thanks

  Read the article

• Include not functioning like I am expecting

  - by bobber205

  The below gives me a fatal error saying that "mymail" was not found. Any ideas why? Looks right to me. mailreq.php include("mail.php"); $r = mymail("test","test"); mail.php function mymail($body, $reqtype) { //blah blah } EDIT: For some reason, this version of php doesn't see <? ?> as valid shorthand tags. I changed it to <?php ?> and it sees the functions now.

  Read the article

• Get result type of function

  - by Robert

  I want to specialize a template function declared as: template<typename Type> Type read(std::istream& is); I then have a lot of static implementations static int read_integer(std::istream& is); a.s.o. Now I'd like to do a macro so that specialization of read is as simple as: SPECIALIZE_READ(read_integer) So I figured I'd go the boost::function_traits way and declare SPECIALIZE_READ as: #define SPECIALIZE_READ(read_function) \ template<> boost::function_traits<read_function>::result_type read(std::istream& is) { \ return read_function(is); \ } but VC++ (2008) compiler complains with: 'boost::function_traits' : 'read_integer' is not a valid template type argument for parameter 'Function' Ideas ?

  Read the article

• c++ link temporary allocations in fuction to custom allocator?

  - by user300713

  Hi, I am currently working on some simple custom allocators in c++ which generally works allready. I also overloaded the new/delete operators to allocate memory from my own allocator. Anyways I came across some scenarios where I don't really know where the memory comes from like this: void myFunc(){ myObj testObj(); ....do something with it } In this case testObj would only be valid inside the function, but where would its memory come from? Is there anyway I could link it to my allocator? Would I have to create to object using new and delete or is there another way? Thanks

  Read the article

• Problems when trying to submit iphone app

  - by ryug

  I'm a fairly new developer. When I try to submit my iphone app with xcode, I've got error as follows; Code Sign error: The identity 'iPhone Distribution' doesn't match any valid, non-expired certificate/private key pair in the default keychain After searching, I found out that I have to create a Distribution Provisioning Profile. However, my distribution provisioning profile doesn't work, even though my Development Provisioning Profile works perfectly. Could someone please help me with this problem? I'm stuck all day... and please forgive me that my English is not great. Thank you in advance.

  Read the article

• Apache redirect when users home directory is completely empty.

  - by Scott M

  I work for an ISP and I have a server with thousands of users 10MB of free storage. They get this free storage with every e-mail account they have with us. An example of a users storage address: http://users.example.com/~username/ One problem I can see is scanning the server for user names to see what accounts are available, basically getting a list of all our customers valid e-mail addresses. This would be very, very bad. So I'm wanting to redirect to our homepage if someone comes across a users account that is empty (I'd say 90% of them are completely empty). I also do not want to simply -Indexes them and use a custom 403 because the few customers that do use them, want +Indexes. I know I can always just tell the customers to put a htaccess file in their directory with Options +indexes if they want directory listing, but that's a last resort. How can I make it pretty much impossible to tell what accounts are on the server but not in use at all?

  Read the article

< Previous Page | 856 857 858 859 860 861 862 863 864 865 866 867  | Next Page >