Search Results

Search found 25792 results on 1032 pages for 'map edit'.

Page 892/1032 | < Previous Page | 888 889 890 891 892 893 894 895 896 897 898 899  | Next Page >

• Latex - Apply an operation to every character in a string

  - by hroest

  Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

  Read the article

• How to print contents from a session variable by looping in a foreach statement

  - by itsover9000

  im trying to write a code where can print and loop through the contents of my session variable by using a foreach statement here is my code <form class="form form-inline" method = "post" action="reportmaker.php"> <select name="rfield"> <option value="">--Select Field--</option> <?php $sc2=mysql_query("SELECT * from searchcolumn s left join report_fields r on s.scol_id=r.field_id where s.category != 'wh'"); foreach($sc2 as $sc){ ?> <option value="<?php echo $sc[advsearch_col]; ?>"><?php echo $sc[advsearch_name]; ?></option> <?php } ?> </select> <button type="submit" value = "submit" id="add" name="add" class="btn pull-right">Add More</button> </form> <?php if(isset($_POST['add'])) { $_SESSION['temp'][]=$_POST['rfield']; } if($_SESSION[temp][]!=""){ foreach($_SESSION[temp][] as $temp) { echo $temp; } } ?> the error that appears with this code is Fatal error: Cannot use [] for reading the line where the error is is this if($_SESSION[temp][]!=""){ i need to print the contents of the session array and this is the only way i know how is there a way to fix this? thanks =========EDIT thanks for the answers guys i finally got it

  Read the article

• Schema to support dynamic properties

  - by Johan Fredrik Varen

  Hi people. I'm working on an editor that enables its users to create "object" definitions in real-time. A definition can contain zero or more properties. A property has a name a type. Once a definition is created, a user can create an object of that definition and set the property values of that object. So by the click of a mouse-button, the user should ie. be able to create a new definition called "Bicycle", and add the property "Size" of type "Numeric". Then another property called "Name" of type "Text", and then another property called "Price" of type "Numeric". Once that is done, the user should be able to create a couple of "Bicycle" objects and fill in the "Name" and "Price" property values of each bike. Now, I've seen this feature in several software products, so it must be a well-known concept. My problem started when I sat down and tried to come up with a DB schema to support this data structure, because I want the property values to be stored using the appropriate column types. Ie. a numeric property value is stored as, say, an INT in the database, and a textual property value is stored as VARCHAR. First, I need a table that will hold all my object definitions: Table obj_defs id | name | ---------------- 1 | "Bicycle" | 2 | "Book" | Then I need a table for holding what sort of properties each object definition should have: Table prop_defs id | obj_def_id | name | type | ------------------------------------ 1 | 1 | "Size" | ? | 2 | 1 | "Name" | ? | 3 | 1 | "Price" | ? | 4 | 2 | "Title" | ? | 5 | 2 | "Author" | ? | 6 | 2 | "ISBN" | ? | I would also need a table that holds each object: Table objects id | created | updated | ------------------------------ 1 | 2011-05-14 | 2011-06-15 | 2 | 2011-05-14 | 2011-06-15 | 3 | 2011-05-14 | 2011-06-15 | Finally, I need a table that will hold the actual property values of each object, and one solution is for this table to have one column for each possible value type, such as this: Table prop_vals id | prop_def_id | object_id | numeric | textual | boolean | ------------------------------------------------------------ 1 | 1 | 1 | 27 | | | 2 | 2 | 1 | | "Trek" | | 3 | 3 | 1 | 1249 | | | 4 | 1 | 2 | 26 | | | 5 | 2 | 2 | | "GT" | | 6 | 3 | 2 | 159 | | | 7 | 4 | 3 | | "It" | | 8 | 5 | 3 | | "King" | | 9 | 6 | 4 | 9 | | | If I implemented this schema, what would the "type" column of the prop_defs table hold? Integers that each map to a column name, varchars that simply hold the column name? Any other possibilities? Would a stored procedure help me out here in some way? And what would the SQL for fetching the "name" property of object 2 look like?

  Read the article

• Strange problem with simple multithreading program in Java

  - by Elizabeth

  Hello, I am just starting play with multithreading programming. I would like to my program show alternately character '-' and '+' but it doesn't. My task is to use synchronized keyword. As far I have: class FunnyStringGenerator{ private char c; public FunnyStringGenerator(){ c = '-'; } public synchronized char next(){ if(c == '-'){ c = '+'; } else{ c = '-'; } return c; } } class ThreadToGenerateStr implements Runnable{ FunnyStringGenerator gen; public ThreadToGenerateStr(FunnyStringGenerator fsg){ gen = fsg; } @Override public void run() { for(int i = 0; i < 10; i++){ System.out.print(gen.next()); } } } public class Main{ public static void main(String[] args) throws IOException { FunnyStringGenerator FSG = new FunnyStringGenerator(); ExecutorService exec = Executors.newCachedThreadPool(); for(int i = 0; i < 20; i++){ exec.execute(new ThreadToGenerateStr(FSG)); } } } EDIT: I also testing Thread.sleep in run method instead for loop.

  Read the article

• Problem with Boost::Asio for C++

  - by Martin Lauridsen

  Hi there, For my bachelors thesis, I am implementing a distributed version of an algorithm for factoring large integers (finding the prime factorisation). This has applications in e.g. security of the RSA cryptosystem. My vision is, that clients (linux or windows) will download an application and compute some numbers (these are independant, thus suited for parallelization). The numbers (not found very often), will be sent to a master server, to collect these numbers. Once enough numbers have been collected by the master server, it will do the rest of the computation, which cannot be easily parallelized. Anyhow, to the technicalities. I was thinking to use Boost::Asio to do a socket client/server implementation, for the clients communication with the master server. Since I want to compile for both linux and windows, I thought windows would be as good a place to start as any. So I downloaded the Boost library and compiled it, as it said on the Boost Getting Started page: bootstrap .\bjam It all compiled just fine. Then I try to compile one of the tutorial examples, client.cpp, from Asio, found (here.. edit: cant post link because of restrictions). I am using the Visual C++ compiler from Microsoft Visual Studio 2008, like this: cl /EHsc /I D:\Downloads\boost_1_42_0 client.cpp But I get this error: /out:client.exe client.obj LINK : fatal error LNK1104: cannot open file 'libboost_system-vc90-mt-s-1_42.lib' Anyone have any idea what could be wrong, or how I could move forward? I have been trying pretty much all week, to get a simple client/server socket program for c++ working, but with no luck. Serious frustration kicking in. Thank you in advance.

  Read the article

• Efficient algorithm for Next button on a MySQL result set

  - by David Grayson

  I have a website that lets people view rows in a table (each row is a picture). There are more than 100,000 rows. You can view different subsets of the rows, and you can view them with different sort orders. While you are viewing one of the rows, you can click the "Next" or "Previous" buttons to go the next/previous row in the list. How would you implement the "Next" and "Previous" features of the website? More specifically, if you have an arbitrary query that returns a list of up to 100,000+ rows, and you know some information about the current row someone is viewing, how do you determine the NEXT row efficiently? Here is the pseudo-code of the solution I came up with when the website was young, and it worked well when there were only 1000 rows, but now that there are 100,000 rows I think it is eating up too much memory. int nextRowId(string query, int currentRowId) { array allRowIds = mysql_query(query); // Takes up a lot of memory! int currentIndex = (index of currentRowId in allRowIds); // Takes time! return allRowIds[currentIndex+1]; } While you are thinking about this problem, remember that the website can store more information about the current row than just its ID (for example, the position of the current row in the result set), and this information can be used as a hint to help determine the ID of the next row. Edit: Sorry for not mentioning this earlier, but this isn't just a static website: rows can often be added to the list, and rows can be re-ordered in the list. (Much rarer, rows can be removed from the list.) I think that I should worry about that kind of thing, but maybe you can convince me otherwise.

  Read the article

• Extracting function declarations from a PHP file

  - by byronh

  I'm looking to create an on-site API reference for my framework and application. Basically, say I have a class file model.class.php: class Model extends Object { ... code here ... // Separates results into pages. // Returns Paginator object. final public function paginate($perpage = 10) { ... more code here ... } } and I want to be able to generate a reference that my developers can refer to quickly in order to know which functions are available to be called. They only need to see the comments directly above each function and the declaration line. Something like this (similar to a C++ header file): // Separates results into pages. // Returns Paginator object. final public function paginate($perpage = 10); I've done some research and this answer looked pretty good (using Reflection classes), however, I'm not sure how I can keep the comments in. Any ideas? EDIT: Sorry, but I want to keep the current comment formatting. Myself and the people who are working on the code hate the verbosity associated with PHPDocumentor. Not to mention a comment-rewrite of the entire project would take years, so I want to preserve just the // comments in plaintext.

  Read the article

• Editable, growable DataGrid that retains values on postback and updates underlying DataTable

  - by jlstrecker

  I'm trying to create an ASP.NET/C# page that allows the user to edit a table of data, add rows to it, and save the data back to the database. For the table of data, I'm using a DataGrid whose cells contain TextBoxes or CheckBoxes. I have a button for adding rows (which works) and a button for saving the data. However, I'm quite stuck on two things: The TextBoxes and CheckBoxes should retain their values on postback. So if the user edits a TextBox and clicks the button to add more rows, the edits should be retained when the page reloads. However, the edits should not be saved to the database at this point. When the user clicks the save button, or anytime before, the DataTable underlying the DataGrid needs to be updated with the values of the TextBoxes and CheckBoxes so that the DataTable can be sent to the database. I have a method that does this, but I can't figure out when to call it. Any help getting this to work, or suggestions of alternative user interfaces that would behave similarly, would be appreciated.

  Read the article

• UnicodeEncodeError: 'ascii' codec can't encode character [...]

  - by user1461135

  I have read the HOWTO on Unicode from the official docs and a full, very detailed article as well. Still I don't get it why it throws me this error. Here is what I attempt: I open an XML file that contains chars out of ASCII range (but inside allowed XML range). I do that with cfg = codecs.open(filename, encoding='utf-8, mode='r') which runs fine. Looking at the string with repr() also shows me a unicode string. Now I go ahead and read that with parseString(cfg.read().encode('utf-8'). Of course, my XML file starts with this: <?xml version="1.0" encoding="utf-8"?>. Although I suppose it is not relevant, I also defined utf-8 for my python script, but since I am not writing unicode characters directly in it, this should not apply here. Same for the following line: from __future__ import unicode_literals which also is right at the beginning. Next thing I pass the generated Object to my own class where I read tags into variables like this: xmldata.getElementsByTagName(tagName)[0].firstChild.data and assign it to a variable in my class. Now what perfectly works are those commands (obj is an instance of the class): for element in obj: print element And this command does work as well: print obj.__repr__() I defined __iter__() to just yield every variable while __repr__() uses the typical printf stuff: "%s" % self.varname Both commands print perfectly and can output the unicode character. What does not work is this: print obj And now I am stuck because this throws the dreaded UnicodeEncodeError: 'ascii' codec can't encode character u'\xfc' in position 47: So what am I missing? What am I doing wrong? I am looking for a general solution, I always want to handle strings as unicode, just to avoid any possible errors and write a compatible program. Edit: I also defined this: def __str__(self): return self.__repr__() def __unicode__(self): return self.__repr__() From documentation I got that this

  Read the article

• Creating a ComboBox with one or more separator items?

  - by Steve

  I'm using Delphi7 and I'd like to have a ComboBox with separator items (Just like in popup menus). I've seen this beautifully implemented in Mozilla Sunbird (I know, it's not Delphi...) the following way: The separator item is a simple gray line drawn in the center of the item If you hover over the separator with the mouse, the selection doesn't appear If the user clicks the separator, it's not selected either AND the combobox doesn't closeup. No. 1 could be implemented using DrawItem. I could live without No. 2 because I have no idea about that. For No. 3 I'm asking for your help. I've figured out that straight after closing up a CBN_CLOSEUP message is sent to the combobox. I thought about hooking the window proc and if CBN_CLOSEUP is sent to a certain combobox then countering it. But I'm unsure if this is the best solution, or maybe there are other, more elegant ways? Whatever the solution is, I'd like to have a standard ComboBox which supports WinXP/Vista/7 theming properly. Thanks! Edit: For a working component please see this thread: Can you help translating this very small C++ component to Delphi?

  Read the article

• Passing jquery JSON from Codeigniter controller to view

  - by dede

  I've been struggling to make it work, but cannot pass the inserted data from the controler to the view in CI using JSON. The input value from the form is successfully inserted into the database, but cannot make it appear in the view. This is my view file ajax_view.php: <script type="text/javascript" src="<?php echo base_url(); ?>js/jquery-1.4.2.min.js"></script> $(document).ready(function(){ $("#submit").click(function(){ var inp = $('#inp').val(); $.post("ajax/ajax_input", { 'send' : inp }, function(data){ alert(data.input_text); }, "json"); }); }); </script> </head> <body> <form id="form1" method="post" action=""> <label for="inp">Text</label> <input type="text" name="inp" id="inp" /> <label for="submit"></label> <input type="submit" name="submit" id="submit" value="Submit" /> And this is the ajax_input method of the ajax.php controller: <?php // Initializing controller ..... // ............................. //ajax method function ajax_input(){ $var_1 = trim($this->input->post('send')); $array = array('input_text' => $var_1); echo json_encode($array); $this->db->insert('ajax',$array); } Trying to debug it with Firebug, it gives me that data.input_text is empty. What am I doing wrong? EDIT: I'm using XAMPP on Win, so is it posible that json configuration is the problem?

  Read the article

• Rails can't find my route but it exists!

  - by DJTripleThreat

  Ok I have events that I want to publish/unpublish with an extra action (nonRESTful) I watched Ryan Bates' railscast on this: http://railscasts.com/episodes/35-custom-rest-actions and it got me most of the way. I think the problem is that my route is nested in an /admin section so even though when I run rake routes and get: publish_admin_event PUT /admin/events/:id/publish(.:format) {:controller=>"event_services", :action=>"publish"} This won't work in my /views/admin/index.html.erb file: <%= link_to 'Publish', publish_admin_event(event), :method => :put %> because it claims that path doesn't exist! And neither will this: <%= link_to 'Publish', {:controller => :event_services, :action => :publish}, {:method => :put, :id => event} %> and says that "No route matches {:controller=>"event_services", :action=>"publish"}" so what gives? (And I've tried restarting my server so that isn't it.) EDIT: This DOES work: <%= link_to 'Publish', "/admin/events/" + event.id.to_s + "/publish", :method => :put %> But I'd rather NOT do this.

  Read the article

• Why doesn't java.util.Set have get(int index)?

  - by Marty Pitt

  I'm sure there's a good reason, but could someone please explain why the java.util.Set interface lacks get(int Index), or any similar get() method? It seems that sets are great for putting things into, but I can't find an elegant way of retrieving a single item from it. If I know I want the first item, I can use set.iterator().next(), but otherwise it seems I have to cast to an Array to retrieve an item at a specific index? What are the appropriate ways of retrieving data from a set? (other than using an iterator) I'm sure the fact that it's excluded from the API means there's a good reason for not doing this -- could someone please enlighten me? EDIT: Some extremely great answers here, and a few saying "more context". The specific scneario was a dbUnit test, where I could reasonalby assert that the returned set from a query had only 1 item, and I was trying to access that item. However, the question is more valid without the scenario, as it remains more focussed : What's the difference between set & list. Thanks to all for the fantastic answers below.

  Read the article

• Record the timestamps of slide changes during a live Powerpoint presentation?

  - by StackedCrooked

  I am planning to implement a lecture capture solution. One of the requirements is to record both the presenter and the slideshow. The presenter is recorded with a videocamera obviously, and the slideshow will probably be captured using a tool like Camtasia. Now during playback three components are visible: the presenter, the slides and a table of contents. Clicking a chapter title in the TOC causes the video to navigate to the corresponding section. This means that a mapping must be made between chapter titles and their timestamps in the video. Usually a change of topic is accompanied with a slide change in the Powerpoint presentation. So the timestamps could be deduced from the slidechanges. However, this requires me to detect slide changes during the live presentation. And I don't know how to do that. Anyone here knows how to do detect slide changes? Is there a Powerpoint API where I can connect event handlers or something like that? I'd greatly appreciate your help! Edit This issue is no longer relevant for my current work so this question will not be updated by me. However, you are still free to help others by posting your answers/insights here.

  Read the article

• Reporting Services "cannot connect to the report server database"

  - by Dano

  We have Reporting Services running, and twice in the past 6 months it has been down for 1-3 days, and suddenly it will start working again. The errors range from not being able to view the tree root in a browser, down to being able to insert parameters on a report, but crashing before the report can generate. Looking at the logs, there is 1 error and 1 warning which seem to correspond somewhat. ERROR:Event Type: Error Event Source: Report Server (SQL2K5) Event Category: Management Event ID: 107 Date: 2/13/2009 Time: 11:17:19 AM User: N/A Computer: ******** Description: Report Server (SQL2K5) cannot connect to the report server database. For more information, see Help and Support Center at http://go.microsoft.com/fwlink/events.asp. WARNING: always comes before the previous error Event code: 3005 Event message: An unhandled exception has occurred. Event time: 2/13/2009 11:06:48 AM Event time (UTC): 2/13/2009 5:06:48 PM Event ID: 2efdff9e05b14f4fb8dda5ebf16d6772 Event sequence: 550 Event occurrence: 5 Event detail code: 0 Process information: Process ID: 5368 Process name: w3wp.exe Account name: NT AUTHORITY\NETWORK SERVICE Exception information: Exception type: ReportServerException Exception message: For more information about this error navigate to the report server on the local server machine, or enable remote errors. During the downtime we tried restarting everything from the server RS runs on, to the database it calls to fill reports with no success. When I came in monday morning it was working again. Anyone out there have any ideas on what could be causing these issues? Edit Tried both suggestions below several months ago to no avail. This issue hasn't arisen since, maybe something out of my control has changed....

  Read the article

• Semantically correct XHTML markup

  - by Dori

  Hello all. Just trying to get the hang of using the semantically correct XHTML markup. Just writing the code for a small navigation item. Where each button has effectivly a title and a descrption. I thought a definition list would therefore be great so i wrote the following <dl> <dt>Import images</dt> <dd>Read in new image names to database</dd> <dt>Exhibition Management</dt> <dd>Create / Delete an exhibition </dd> <dt>Image Management</dt> <dd>Edit name, medium and exhibition data </dd> </dl> But...I want the above to be 3 buttons, each button containing the dt and dd text. How can i do this with the correct code? Normally i would make each button a div and use that for the visual button behaviour (onHover and current page selection stuff). Any advice please Thanks

  Read the article

• "variable tracking" is eating my compile time!

  - by wowus

  I have an auto-generated file which looks something like this... static void do_SomeFunc1(void* parameter) { // Do stuff. } // Continues on for another 4000 functions... void dispatch(int id, void* parameter) { switch(id) { case ::SomeClass1::id: return do_SomeFunc1(parameter); case ::SomeClass2::id: return do_SomeFunc2(parameter); // This continues for the next 4000 cases... } } When I build it like this, the build time is enormous. If I inline all the functions automagically into their respective cases using my script, the build time is cut in half. GCC 4.5.0 says ~50% of the build time is being taken up by "variable tracking" when I use -ftime-report. What does this mean and how can I speed compilation while still maintaining the superior cache locality of pulling out the functions from the switch? EDIT: Interestingly enough, the build time has exploded only on debug builds, as per the following profiling information of the whole project (which isn't just the file in question, but still a good metric; the file in question takes the most time to build): Debug: 8 minutes 50 seconds Release: 4 minutes, 25 seconds

  Read the article

• Should I use IDisposable for purely managed resources?

  - by John Gietzen

  Here is the scenario: I have an object called a Transaction that needs to make sure that only one entity has permission to edit it at any given time. In order to facilitate a long-lived lock, I have the class generating a token object that can be used to make the edits. You would use it like this: var transaction = new Transaction(); using (var tlock = transaction.Lock()) { transaction.Update(data, tlock); } Now, I want the TransactionLock class to implement IDisposable so that its usage can be clear. But, I don't have any unmanaged resources to dispose. however, the TransctionLock object itself is a sort of "unmanaged resource" in the sense that the CLR doesn't know how to properly finalize it. All of this would be fine and dandy, I would just use IDisposable and be done with it. However, my issue comes when I try to do this in the finalizer: ~TransactionLock() { this.Dispose(false); } I want the finalizer to release the transaction from the lock, if possible. How, in the finalizer, do I detect if the parent transaction (this.transaction) has already been finalized? Is there a better pattern I should be using? The Transaction class looks something like this: public sealed class Transaction { private readonly object lockMutex = new object(); private TransactionLock currentLock; public TransactionLock Lock() { lock (this.lockMutex) { if (this.currentLock != null) throw new InvalidOperationException(/* ... */); this.currentLock = new TransactionLock(this); return this.currentLock; } } public void Update(object data, TransactionLock tlock) { lock (this.lockMutex) { this.ValidateLock(tlock); // ... } } internal void ValidateLock(TransactionLock tlock) { if (this.currentLock == null) throw new InvalidOperationException(/* ... */); if (this.currentLock != tlock) throw new InvalidOperationException(/* ... */); } internal void Unlock(TransactionLock tlock) { lock (this.lockMutex) { this.ValidateLock(tlock); this.currentLock = null; } } }

  Read the article

• Replacing a unicode character in UTF-8 file using delphi 2010

  - by Jake Snake

  I am trying to replace character (decimal value 197) in a UTF-8 file with character (decimal value 65) I can load the file and put it in a string (may not need to do that though) SS := TStringStream.Create(ParamStr1, TEncoding.UTF8); SS.LoadFromFile(ParamStr1); //S:= SS.DataString; //ShowMessage(S); However, how do i replace all 197's with a 65, and save it back out as UTF-8? SS.SaveToFile(ParamStr2); SS.Free; -------------- EDIT ---------------- reader:= TStreamReader.Create(ParamStr1, TEncoding.UTF8); writer:= TStreamWriter.Create(ParamStr2, False, TEncoding.UTF8); while not Reader.EndOfStream do begin S:= reader.ReadLine; for I:= 1 to Length(S) do begin if Ord(S[I]) = 350 then begin Delete(S,I,1); Insert('A',S,I); end; end; writer.Write(S + #13#10); end; writer.Free; reader.Free;

  Read the article

• TEXTAREAs scroll by themselves (on IE8) every time you type one character

  - by Justin Grant

  IE8 has a known bug (per connect.microsoft.com) where typing or pasting text into a TEXTAREA element will cause the textarea to scroll by itself. This is hugely annoying and shows up in many community sites, including Wikipedia. The repro is this: open the HTML below with IE8 (or use any long page on wikipedia which will exhibit the same problem until they fix it) size the browser full-screen paste a few pages of text into the TEXTAREA move the scrollbar to the middle position now type one character into the textarea Expected: nothing happens Actual: scrossing happens on its own, and the insertion point ends up near the bottom of the textarea! Below is repro HTML (can also see this live on the web here: http://en.wikipedia.org/w/index.php?title=Text_box&action=edit) <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml" > <body> <div style="width: 80%"> <textarea rows="20" cols="80" style="width:100%;" ></textarea> </div> </body> </html>

  Read the article

• How do I stop js files being cached in IE?

  - by DoctaJonez

  Hello stackers! I've created a page that uses the CKEditor javascript rich edit control. It's a pretty neat control, especially seeing as it's free, but I'm having serious issues with the way it allows you to add templates. To add a template you need to modify the templates js file in the CKEditor templates folder. The documentation page describing it is here. This works fine until I want to update a template or add a new one (or anything else that requires me to modify the js file). Internet Explorer caches the js file and doesn't pick up the update. Emptying the cache allows the update to be picked up, but this isn't an acceptable solution. Whenever I update a template I do not want to tell all of the users across the organisation to empty their IE cache. There must be a better way! Is there a way to stop IE caching the js file? Or is there another solution to this problem?

  Read the article

• 60K+ Sprites on the 360?

  - by Jeffrey Kern

  Hey everyone, Just wondering - throwing ideas in my head - about starting a new XNA project for the 360. I would like it to be retro-old school, and emulating scanlines and color palettes and such. As part of this idea, what I would ideally like to do is manually draw each and every pixel of the screen. So, worst-case scenario I would have to draw about 60K sprites on a 252x240 resolution (I think thats correct). 60K sprites on the screen at a time. So, before I even attempt to code this - would the XBOX 360 be able to keep up with this even? That is a lot of sprites, but they aren't big sprites, and the texture data needed would be non-existant. However, I guess how this project would be implemented would make it or break it, but all I was thinking was coming up with a 2D array and mapping which color value would need to be drawn at that point. Of course, this is watered down talk right now. But what you all suggest? EDIT: Each sprite would represent one pixel. E.g., a sprite at 0,0. Another at 0,1. etc.

  Read the article

• Checkbox alignment in Internet Explorer, Firefox and Chrome

  - by Andrej

  Checkbox alignment with its label (i.e., vertical centering) cross different web browsers makes me crazy. Pasted below is standard html code: <label for="ch"><input id="ch" type="checkbox">My Checkbox</label> I tested different CSS tricks (e.g., link 1, link 2); most solutions works fine in FF, but are completely off in Chrome or IE8. I'm looking for any references or pointers to solve this issue. Thanks in advance. EDIT According to Elq suggestion I modified the HTML <div class="row"> <input type="checkbox" id="ch1" /> <label for="ch1">Test</label> </div> and CSS .row{ display: table-row; } label{ display: table-cell; vertical-align: middle; } Works now in Firefox, Internet Explorer 8, and Chrome on Windows. Fails on Firefox and Chrome on Linux. Also works in Firefox and Safari on Mac, but fails on Chrome.

  Read the article

• How to read time from recorded surveillance camera video?

  - by stressed_geek

  I have a problem where I have to read the time of recording from the video recorded by a surveillance camera. The time shows up on the top-left area of the video. Below is a link to screen grab of the area which shows the time. Also, the digit color(white/black) keeps changing during the duration of the video. http://i55.tinypic.com/2j5gca8.png Please guide me in the direction to approach this problem. I am a Java programmer so would prefer an approach through Java. EDIT: Thanks unhillbilly for the comment. I had looked at the Ron Cemer OCR library and its performance is much below our requirement. Since the ocr performance is less than desired, I was planning to build a character set using the screen grabs for all the digits, and using some image/pixel comparison library to compare the frame time with the character-set which will show a probabilistic result after comparison. So I was looking for a good image comparison library(I would be OK with a non-java library which I can run using the command-line). Also any advice on the above approach would be really helpful.

  Read the article

• Updating entity fields in app engine development server

  - by Joey

  I recently tried updating a field in one of my entities on the app engine local dev server via the sdk console. It appeared to have updated just fine (a simple float). However, when I followed up with a query on the entity, I received an exception: "Items in the mSomeList list must all be Key instances". mSomeList is just another list field I have in that entity, not the one I modified. Is there any reason manually changing a field would adversely throw something off such that the server gets confused? Is this a known bug? I wrote an http handler to alter the field through server code and it works fine if I take that approach. Update: (adding details) I am using the python google app engine server. Basically if I go into the Google App Engine Launcher and press the SDK Console button, then go into one of my entities and edit a field that is a float (i.e. change it from 0 to 3.5, for instance), I get the "Items in the mMyList list must all be Key instance" suddenly when I query the entity like this: query = DataModels.RegionData.gql("WHERE mRegion = :1", region) entry = query.get() the RegionData entity is what has the mMyList member. As mentioned previously, if I do not manually change the field but rather do so through server code, i.e. query = DataModels.RegionData.gql("WHERE mRegion = :1", region) entry = query.get() entry.mMyFloat = 3.5 entry.put() Then it works.

  Read the article

< Previous Page | 888 889 890 891 892 893 894 895 896 897 898 899  | Next Page >