Search Results

Search found 76977 results on 3080 pages for 'create function'.

Page 896/3080 | < Previous Page | 892 893 894 895 896 897 898 899 900 901 902 903  | Next Page >

  • drupal hook_menu_alter9) for adding tabs

    - by EricP
    I want to add some tabs in the "node/%/edit" page from my module called "cssswitch". When I click "Rebuild Menus", the two new tabs are displayed, but they are displayed for ALL nodes when editing them, not just for the node "cssswitch". I want these new tabs to be displayed only when editing node of type "cssswitch". The other problem is when I clear all cache, the tabs completely dissapear from all edit pages. Below is the code I wrote. function cssswitch_menu_alter(&$items) { $node = menu_get_object(); //print_r($node); //echo $node->type; //exit(); if ($node->type == 'cssswitch') { $items['node/%/edit/schedulenew'] = array( 'title' => 'Schedule1', 'access callback'=>'user_access', 'access arguments'=>array('view cssswitch'), 'page callback' => 'cssswitch_schedule', 'page arguments' => array(1), 'type' => MENU_LOCAL_TASK, 'weight'=>4, ); $items['node/%/edit/schedulenew2'] = array( 'title' => 'Schedule2', 'access callback'=>'user_access', 'access arguments'=>array('view cssswitch'), 'page callback' => 'cssswitch_test2', 'page arguments' => array(1), 'type' => MENU_LOCAL_TASK, 'weight'=>3, ); } } function cssswitch_test(){ return 'test'; } function cssswitch_test2(){ return 'test2'; } Thanks for any help.

    Read the article

  • Noobie Jquery Question

    - by piratebill
    I've been working with Jquery fro a grand total of two hours now. Up until this point I have made this really simple FAQ page. <script type="text/javascript" src="jquery.js"></script> <script type="text/javascript"> $(document).ready(function() { $("#void").click(function(event) { event.preventDefault(); }); $('#faq').find('dd').hide().end().find('dt').click(function() { $(this).next().slideToggle(); }); }); </script> <dl id="faq"> <dt><a href="" id="void">Coffee</a></dt> <dd>- black hot drink</dd> <dt><a href="" id="void">Milk</a></dt> <dd>- white cold drink</dd> </dl> The problem is only the first item is working. My questions are, why is only the first entree working and how do I fix it? I've tried using an each() but I am unsure where to put it.

    Read the article

  • Jquery Ajax + PHP

    - by Kris.Mitchell
    I am having problems with jQuery Ajax and PHP I have my php file set up to echo the data I am gathering from a mysql database. I have verified that the database is returning something and that the string at the end of the function actually contains data. What is happening though, is that it looks like the php echo is happening before the ajax call, causing the php data to be displayed at the top of the page, and not below in proper div. I think it might have something to do with timing of the ajax and the php call, but I am not sure. So, why is the data not getting caught by the .ajax and thrown into the div? Thanks for the help! jQuery $(document).ready(function() { $.ajax({ url: "../database_functions.php", type: "GET", data: "cat=jw&sub=pi&sort=no", cache: false, success: function (html) { alert("Success!"); $('#product-list').html(html); } }); }); PHP echo "Hello World";

    Read the article

  • Inversion of control domain objects construction problem

    - by Andrey
    Hello! As I understand IoC-container is helpful in creation of application-level objects like services and factories. But domain-level objects should be created manually. Spring's manual tells us: "Typically one does not configure fine-grained domain objects in the container, because it is usually the responsibility of DAOs and business logic to create/load domain objects." Well. But what if my domain "fine-grained" object depends on some application-level object. For example I have an UserViewer(User user, UserConstants constants) class. There user is domain object which cannot be injected, but UserViewer also needs UserConstants which is high-level object injected by IoC-container. I want to inject UserConstants from the IoC-container, but I also need a transient runtime parameter User here. What is wrong with the design? Thanks in advance! UPDATE It seems I was not precise enough with my question. What I really need is an example how to do this: create instance of class UserViewer(User user, UserService service), where user is passed as the parameter and service is injected from IoC. If I inject UserViewer viewer then how do I pass user to it? If I create UserViewer viewer manually then how do I pass service to it?

    Read the article

  • How to use Transaction in Entity FrameWork?

    - by programmerist
    How to use Transaction in Entity FrameWork? i read some links on Stackoverflow : http://stackoverflow.com/questions/815586/entity-framework-using-transactions-or-savechangesfalse-and-acceptallchanges BUT; i have 3 table so i have 3 entities: CREATE TABLE Personel (PersonelID integer PRIMARY KEY identity not null, Ad varchar(30), Soyad varchar(30), Meslek varchar(100), DogumTarihi datetime, DogumYeri nvarchar(100), PirimToplami float); Go create TABLE Prim (PrimID integer PRIMARY KEY identity not null, PersonelID integer Foreign KEY references Personel(PersonelID), SatisTutari int, Prim float, SatisTarihi Datetime); Go CREATE TABLE Finans (ID integer PRIMARY KEY identity not null, Tutar float); Personel, Prim,Finans my tables. if you look Prim table you can see Prim value float value if i write a textbox not float value my transaction must run. using (TestEntities testCtx = new TestEntities()) { using (TransactionScope scope = new TransactionScope()) { // do someyihng... testCtx.Personel.SaveChanges(); // do someyihng... testCtx.Prim.SaveChanges(); // do someyihng... testCtx.Finans.SaveChanges(); scope .Complete(); success = true; } } How can i do that?

    Read the article

  • Dom Nodes manipulations, how remove tags which wrap my selection?

    - by sanceray3
    Hi, I try to explain you my "problem". I would like to know when I select a part of text, if this text is “wrapped” by html tags, and in function delete them. For example with this sentence : The car is <strong>green</strong>, and the boat is black If I select “green” and click on a button, I would like verify if green is wrapped by <strong>(for that it’s ok), and in function delete <strong> tags without delete containing “green”. I have tried to do it, but when I remove child and recreate one, my new node is empty and if I try to put directly text in document.createTextNode, my new node appears but the <strong> tags stay. // Bouton CLICK $('input[type=button].btn_transform').click(function(){ var selObj = window.getSelection(); var parent=selObj.anchorNode.parentNode; if (parent.nodeName=='STRONG'){ parent.removeChild(selObj.anchorNode); var theText = document.createTextNode(selObj); parent.appendChild(theText); } }); I’m not a DOM manipulation specialist. Could you help me to solve this? Thanks very much for your precious help.

    Read the article

  • std::vector elements initializing

    - by Chameleon
    std::vector<int> v1(1000); std::vector<std::vector<int>> v2(1000); std::vector<std::vector<int>::const_iterator> v3(1000); How elements of these 3 vectors initialized? About int, I test it and I saw that all elements become 0. Is this standard? I believed that primitives remain undefined. I create a vector with 300000000 elements, give non-zero values, delete it and recreate it, to avoid OS memory clear for data safety. Elements of recreated vector were 0 too. What about iterator? Is there a initial value (0) for default constructor or initial value remains undefined? When I check this, iterators point to 0, but this can be OS When I create a special object to track constructors, I saw that for first object, vector run the default constructor and for all others it run the copy constructor. Is this standard? Is there a way to completely avoid initialization of elements? Or I must create my own vector? (Oh my God, I always say NOT ANOTHER VECTOR IMPLEMENTATION) I ask because I use ultra huge sparse matrices with parallel processing, so I cannot use push_back() and of course I don't want useless initialization, when later I will change the value.

    Read the article

  • Java reflection appropriateness

    - by jsn
    This may be a fairly subjective question, but maybe not. My application contains a bunch of forms that are displayed to the user at different times. Each form is a class of its own. Typically the user clicks a button, which launches a new form. I have a convenience function that builds these buttons, you call it like this: buildButton( "button text", new SelectionAdapter() { @Override public void widgetSelected( SelectionEvent e ) { showForm( new TasksForm( args... ) ); } } ); I do this dozens of times, and it's really cumbersome having to make a SelectionAdapter every time. Really all I need for the button to know is what class to instantiate when it's clicked and what arguments to give the constructor, so I built a function that I call like this instead: buildButton( "button text", TasksForm.class, args... ); Where args is an arbitrary list of objects that you could use to instantiate TasksForm normally. It uses reflection to get a constructor from the class, match the argument list, and build an instance when it needs to. Most of the time I don't have to pass any arguments to the constructor at all. The downside is obviously that if I'm passing a bad set of arguments, it can't detect that at compilation time, so if it fails, a dialog is displayed at runtime. But it won't normally fail, and it'll be easy to debug if it does. I think this is much cleaner because I come from languages where the use of function and class literals is pretty common. But if you're a normal Java programmer, would seeing this freak you out, or would you appreciate not having to scan a zillion SelectionAdapters?

    Read the article

  • Filtering a select list via input box & jquery

    - by zSysop
    Hi all, I was wondering if i could get some help with filtering a select list using an input box via jquery. Here's what my js looks like, but it doesnt seem to work. I'm guessing this is because options within a select list are not hide-able. <script type="text/javascript"> $(document).ready(function() { $("#inputFilter").change(function() { var filter = $(this).val(); $("#selectList option").each(function() { var match = $(this).text().search(new RegExp(filter, "i")); if (match > 0) { $(this).show(); // Does not work } else $(this).hide(); }); }); }); </script> and here's my html <input id="inputFilter" /> <select id="selectList"> <option value="1111" text="1111 - London" /> <option value="1112" text="1111 - Paris" /> </select>

    Read the article

  • Returning JSON from JavaScript to Python

    - by Chris Lacy
    I'm writing a simple App Engine app. I have a simple page that allows a user to move a marker on a Google map instance. Each time the user drops the marker, I want to return the long/lat to my Python app. function initialize() { ... // Init map var marker = new GMarker(center, {draggable: true}); GEvent.addListener(marker, "dragend", function() { // I want to return the marker.x/y to my app when this function is called .. }); } To my (admittedly limited) knowledge, I should be: 1). Returning a JSON structure with my required data in the listener callback above 2). In my webapp.RequestHandler Handler class, trying to retrieve the JSON structure during the post method. I would very much like to pass this JSOn data back to the app without causing a page reload (which is what has happened when I've used various post/form.submit methods so far). Can anyone provide me with some psuedo code or an example on how I might achieve what I'm after? Thanks.

    Read the article

  • Codeigniter Inputting session data from model for a simple authentication system

    - by user1616244
    Trying to put together a simple login authentication. Been at this for quite sometime, and I can't find where I'm going wrong. Pretty new to Codeigniter and OOP PHP. I know there are authentication libraries out there, but I'm not interested in using those. Model: function login($username, $password){ if ($this->db->table_exists($username)){ $this->db->where('username', $username); $this->db->where('password', $password); $query = $this->db->get($username); if($query->num_rows >= 1) { return true; $data = array( 'username' => $this->input->post('username'), 'login' => true ); $this->session->set_userdata($data); } } } Controller function __construct(){ parent::__construct(); $this->logincheck(); } public function logincheck(){ if ($this->session->userdata('login')){ redirect('/members'); } } If I just echo from the controller: $this-session-all_userdata(); I get an empty array. So the problem seems to be that the $data array in the model isn't being stored in the session.

    Read the article

  • Javascript/Jquery pop-up window in Asp.Net MVC4

    - by Mark
    Below I have a "button" (just a span with an icon) that creates a pop-up view of a div in my application to allow users to compare information in seperate windows. However, I get and Asp.Net Error as follows: **Server Error in '/' Application. The resource cannot be found. Requested URL: /Home/[object Object]** Does anyone have an Idea of why this is happending? Below is my code: <div class="module_actions"> <div class="actions"> <span class="icon-expand2 pop-out"></span> </div> </div> <script> $(document).ajaxSuccess(function () { var Clone = $(".pop-out").click(function () { $(this).parents(".module").clone().appendTo("#NewWindow"); }); $(".pop-out").click(function popitup(url) { LeftPosition = (screen.width) ? (screen.width - 400) / 1 : 0; TopPosition = (screen.height) ? (screen.height - 700) / 1 : 0; var sheight = (screen.height) * 0.5; var swidth = (screen.width) * 0.5; settings = 'height=' + sheight + ',width=' + swidth + ',top=' + TopPosition + ',left=' + LeftPosition + ',scrollbars=yes,resizable=yes,toolbar=no,status=no,menu=no, directories=no,titlebar=no,location=no,addressbar=no' newwindow = window.open(url, '/Index', settings); if (window.focus) { newwindow.focus() } return false; }); });

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Adding date to multiple fields via datepicker

    - by Andy
    i have a form in drupal with jquery based date module. there are multiple fields with date picker enabled. i want to set the value of all of them (they all have class .date-popup-init) to the value of the first field (#edit-field, the 'from' date) when that field is set. my code so far: <script type="text/javascript"> var DatePicked = function() { var firstdate = $("#edit-field"); var updater = firstdate.datepicker("getDate"); $(".date-popup-init").each(function(){ $(this).datepicker("setDate", updater); }); } $(function() { $("#edit-field").datepicker({ onSelect: DatePicked }); }); </script> this seems to randomly work; it sets the date of some fields to the value of #edit-field, seemingly different fields each time. also, the form adds more datepicker-enabled fields via ajax. is there any way to ensure that all these new fields, when they load, pick up the value of #edit-field as well? disclaimer: last night was my first attempt at javascript of any kind. i have a basic idea now. the above was cobbled through countless google examples.

    Read the article

  • Avoiding repeated subqueries when 'WITH' is unavailable

    - by EloquentGeek
    MySQL v5.0.58. Tables, with foreign key constraints etc and other non-relevant details omitted for brevity: CREATE TABLE `fixture` ( `id` int(11) NOT NULL auto_increment, `competition_id` int(11) NOT NULL, `name` varchar(50) NOT NULL, `scheduled` datetime default NULL, `played` datetime default NULL, PRIMARY KEY (`id`) ); CREATE TABLE `result` ( `id` int(11) NOT NULL auto_increment, `fixture_id` int(11) NOT NULL, `team_id` int(11) NOT NULL, `score` int(11) NOT NULL, `place` int(11) NOT NULL, PRIMARY KEY (`id`) ); CREATE TABLE `team` ( `id` int(11) NOT NULL auto_increment, `name` varchar(50) NOT NULL, PRIMARY KEY (`id`) ); Where: A draw will set result.place to 0 result.place will otherwise contain an integer representing first place, second place, and so on The task is to return a string describing the most recently played result in a given competition for a given team. The format should be "def Team X,Team Y" if the given team was victorious, "lost to Team X" if the given team lost, and "drew with Team X" if there was a draw. And yes, in theory there could be more than two teams per fixture (though 1 v 1 will be the most common case). This works, but feels really inefficient: SELECT CONCAT( (SELECT CASE `result`.`place` WHEN 0 THEN "drew with" WHEN 1 THEN "def" ELSE "lost to" END FROM `result` WHERE `result`.`fixture_id` = (SELECT `fixture`.`id` FROM `fixture` LEFT JOIN `result` ON `result`.`fixture_id` = `fixture`.`id` WHERE `fixture`.`competition_id` = 2 AND `result`.`team_id` = 1 ORDER BY `fixture`.`played` DESC LIMIT 1) AND `result`.`team_id` = 1), ' ', (SELECT GROUP_CONCAT(`team`.`name`) FROM `fixture` LEFT JOIN `result` ON `result`.`fixture_id` = `fixture`.`id` LEFT JOIN `team` ON `result`.`team_id` = `team`.`id` WHERE `fixture`.`id` = (SELECT `fixture`.`id` FROM `fixture` LEFT JOIN `result` ON `result`.`fixture_id` = `fixture`.`id` WHERE `fixture`.`competition_id` = 2 AND `result`.`team_id` = 1 ORDER BY `fixture`.`played` DESC LIMIT 1) AND `team`.`id` != 1) ) Have I missed something really obvious, or should I simply not try to do this in one query? Or does the current difficulty reflect a poor table design?

    Read the article

  • mysql stored funtion usage

    - by shikhar
    I just wrote a stored function to calculate the working days between two dates. This works select CountWeekDays('2010-03-07','2010-04-07') This doesn't work select CountWeekDays(o.order_date,o.created_date) from orders o; Any idea how to make this one work ?? function definition delimiter $$; CREATE FUNCTION CountWeekDays (sdate VARCHAR(50), edate VARCHAR(50)) RETURNS INT BEGIN DECLARE wdays, tdiff, counter, thisday smallint; DECLARE newdate DATE; SET newdate := sdate; SET wdays = 0; if DATEDIFF(edate, sdate) = 0 THEN RETURN 1; END IF; if DATEDIFF(edate, sdate) < 0 THEN RETURN 0; END IF; label1: LOOP SET thisday = DAYOFWEEK(newdate); IF thisday BETWEEN 2 AND 6 THEN SET wdays := wdays + 1; END IF; SET newdate = DATE_ADD(newdate, INTERVAL 1 DAY); IF DATEDIFF(edate, newdate) < 0 THEN LEAVE label1; END IF; END LOOP label1; RETURN wdays; END

    Read the article

  • JSON Array Created in PHP/MySQL incorrectly decoded using JQuery

    - by Zak
    I am attempting to make an AJAX call to a very small PHP script that should return me an array that could be echo'd and decoded using JQuery. Here is what I have: My PHP page called to by AJAX: $web_q=mysql_query("select * from sec_u_g where uid='$id' "); $rs = array(); while($rs[] = mysql_fetch_assoc($web_q)) { } print_r(json_encode($rs)); This outputs: [{"id":"3","uid":"39","gid":"16"},{"id":"4","uid":"39","gid":"4"},{"id":"5","uid":"39","gid":"5"},{"id":"6","uid":"39","gid":"6"},{"id":"7","uid":"39","gid":"7"},{"id":"8","uid":"39","gid":"8"},{"id":"9","uid":"39","gid":"9"},false] I don't understand the "false" at the end for one .. But then I send to to JQuery and use: $.each(json.result, function(i, object) { $.each(object, function(property, value) { alert(property + "=" + value); }); }); This just fails. I try to alert "result" by itself which is set by: $.post("get_ug.php",{id:txt},function(result){ }); My output alerts are as follows: 1) The key is '0' and the value is '[' 2) The key is '1' and the value is 'f' 3) The key is '2' and the value is 'a' 4) The key is '3' and the value is 'l' 5) The key is '4' and the value is 's' 6) The key is '5' and the value is 'e' 7) The key is '6' and the value is ']' 8) The key is '7' and the value is ' ' (<-- Yes the line break is there in the alert) I am exhausted from trying different ideas and scripts. Other than setting a delimiter myself and concatenating my own array and decoding it with a custom script, does anyone have any ideas?? Thank you!!

    Read the article

  • How do I avoid killing the native controls on a html5-video when i've started it programmaticly?

    - by Nils
    OK, so the deal is I've started making a little videoplayer, that works by clicking a div with an image, expanding the div and the image, and then exchanges the image with a html5-videotag. the code is as below. (It's very early on, so i know theres a lot that need improving, as in not using javascript to set styles and so on, but nevertheless, any insigts and tips are welcome, besides the answer to the main question) /*Begin Expander*/ var $videoplayer = $('<video width="640" height="360" preload="none" controls="" tabindex="0" style="position: relative;"><source type="video/mp4" src="/restalive/movies/big_buck_bunny.mp4"></source><source type="video/ogg" src="/restalive/movies/big_buck_bunny.ogv"></source></video>').appendTo('body'); $videoplayer.hide(); $(".ExpandVideo").each(function(i){ var $trigger = $(this); var $image = $trigger.find("img"); $image.css({ "width" : "100%" ,"height" : "auto" }) $trigger.css({ "display" : "block" ,"overflow" : "hidden" ,"width" : "200px" ,"float" : "left" }); $trigger.bind("click", function(e){ $trigger.animate({"width" : "640px"}, "fast", function(){ $image.replaceWith($videoplayer); $videoplayer.show(); $videoplayer.attr("id", "video" + i); var video = document.getElementById("video" + i); video.play(); }) }) }); However, the main problem is that when i've fired of the video like this (video.play()), the native controls stop working, i can no longer pause the video, even though the controls are there, and clickable, the video just starts playing immidiatley again when i trie to pause it. Which is a shame, because i want to use the native controls for simplicity.

    Read the article

  • SWIG: From Plain C++ to working Wrapper

    - by duckworthd
    Hi everyone. I've been trying to create a SWIG wrapper for this tiny little C++ class for the better part of 3 hours with no success, so I was hoping one of you out there could lend me a small hand. I have the following class: #include <stdio.h> class Example { public: Example(); ~Example(); int test(); }; #include "example.h" Along with the implementation: Example::Example() { printf("Example constructor called\n"); } Example::~Example() { printf("Example destructor called\n"); } int Example::test() { printf("Holy shit, I work!\n"); return 42; } I've read through the introduction page ( www.swig.org/Doc1.3/Java.html ) a few times without gaining a whole lot of insight into the situation. My steps were Create an example.i file Compile original alongside example_wrap.cxx (no linking) link resulting object files together Create a little java test file (see below) javac all .java files there and run Well steps 4 and 5 have created a host of problems for me, starting with the basic ( library 'example' not found due to not being in java's path ) to the weird ( library not found even unless LD_LIBRARY_PATH is set to something, even if it's nothing at all). I've included my little testing code below public class test2 { static { String libpath = System.getProperty("java.library.path"); String currentDir = System.getProperty("user.dir"); System.setProperty("java.library.path", currentDir + ":" + libpath); System.out.println(System.getProperty("java.library.path")); System.loadLibrary("example"); } public static void main(String[] args){ System.out.println("It loads!"); } } Well, if anyone has navigated these murky waters of wrapping, I could not be happier than if you could light the way, particularly if you could provide the example.i and bash commands to go along with it.

    Read the article

  • Translate Prototype code into Jquery version

    - by user1055495
    I everybody, I'm working on a SaaS application and I need to use Jquery instead of Prototype due to some extra plugins integration. My code that was wotking a charm with Prototype is not running anymore with Jquery and I'm not used to write in this framework... Is there someone to help me in "translating" this one: Thanks a lot for your help. var rates = new Array(); <% for tva_rate in @tva_rates -%> rates.push(new Array(<%= tva_rate.id %>, '<%=h tva_rate.taux %>', '<%=h tva_rate.compte_id %>' )); <% end -%> function tvaSelected() { tva_id = $('journal_tva_id').getValue(); show = 1; if (tva_id > 0){ rates.each(function(rate) { if (rate[0] == tva_id) { $('journal_taux').setValue(rate[1]); $('journal_compte_tva').setValue(rate[2]); show = 2; } }); } if (show == 1) { $('tva_taux_field').hide(); } else { $('tva_taux_field').show(); } } document.observe('dom:loaded', function() { tvaSelected(); $('journal_tva_id').observe('change', tvaSelected); });

    Read the article

  • SQL problem - select accross multiple tables (user groups)

    - by morpheous
    I have a db schema which looks something like this: create table user (id int, name varchar(32)); create table group (id int, name varchar(32)); create table group_member (foobar_id int, user_id int, flag int); I want to write a query that allows me to so the following: Given a valid user id (UID), fetch the ids of all users that are in the same group as the specified user id (UID) AND have group_member.flag=3. Rather than just have the SQL. I want to learn how to think like a Db programmer. As a coder, SQL is my weakest link (since I am far more comfortable with imperative languages than declarative ones) - but I want to change that. Anyway here are the steps I have identified as necessary to break down the task. I would be grateful if some SQL guru can demonstrate the simple SQL statements - i.e. atomic SQL statements, one for each of the identified subtasks below, and then finally, how I can combine those statements to make the ONE statement that implements the required functionality. Here goes (assume specified user_id [UID] = 1): //Subtask #1. Fetch list of all groups of which I am a member Select group.id from user inner join group_member where user.id=group_member.user_id and user.id=1 //Subtask #2 Fetch a list of all members who are members of the groups I am a member of (i.e. groups in subtask #1) Not sure about this ... select user.id from user, group_member gm1, group_member gm2, ... [Stuck] //Subtask #3 Get list of users that satisfy criteria group_member.flag=3 Select user.id from user inner join group_member where user.id=group_member.user_id and user.id=1 and group_member.flag=3 Once I have the SQL for subtask2, I'd then like to see how the complete SQL statement is built from these subtasks (you dont have to use the SQL in the subtask, it just a way of explaining the steps involved - also, my SQL may be incorrect/inefficient, if so, please feel free to correct it, and point out what was wrong with it). Thanks

    Read the article

  • Handling row selection from a simple grid using jquery and asp.net mvc

    - by Jonn
    Using a simple table and jquery, how would you manually handle selection using jquery? So far, I've managed to add a gridrowselected class on the tr when the click event is called so that I'll know which row is currently selected. But I don't know how to pass the selected data back to the controller (or at least an index I placed on the row). I tried something like this $(function() { $('#ProjectList .gridrow').click(function() { // Get row's index var projectId = $(this).find('input[name$=ProjectId]').val(); // Remove the input if it already exists var parentForm = $(this).parents('form'); parentForm.remove('input[name="selectedRows"][value="' + projectId + '"]'); // If it is selected, create the form. If it's not selected then the input just gets removed (the user must have clicked on it and deselected the row) if ($(this).hasClass('gridrow-selected') === true) { parentForm.append($('<input>', { type: "hidden", name: "selectedRows", value: projectId })); } }); }); which I'm expecting to create a hidden input so that when I post, selectedRows gets passed onto the controller. But all it does is create the input, but the data still doesn't get passed to the controller.

    Read the article

  • Division of text follow the cursor via Javascript/Jquery

    - by webzide
    Dear experts, I wanted have a dynamic division of content follow you with the cursor in the web browser space. I am not a pro at JS so I spent 2 hours to finally debugged a very stupid way to accomplish this. $(document).ready(function () { function func(evt) { var evt = (evt) ? evt : event; var div = document.createElement('div'); div.style.position = "absolute"; div.style.left = evt.clientX + "px"; div.style.top = evt.clientY + "px"; $(div).attr("id", "current") div.innerHTML = "CURSOR FOLLOW TEXT"; $(this).append($(div)); $(this).unbind() $(this).bind('mousemove', function () { $('div').remove("#current"); }); $(this).bind('mousemove', func); } $("body").bind('mousemove', func) }); As you can see this is pretty much Brute force and it slows down the browser quite a bit. I often experience a lag on the browser as a drag my mouse from one place to another. Is there a way to accomplish this easier and faster and more intuitive. I know you can use the cursor image technique but thats something I'm looking to avoid. Thanks in advance.

    Read the article

  • Two Objects created with the same Address in Flex

    - by James
    Hi, I have an issue in flex which is causing a bit of a headache! I am adding objects to an ArrayCollection but in doing so, another ArrayCollection is also picking up these changes even though there is no binding occurring. I can see from the debug that the two ACs have the same address but for the life of me can't figure out why. I have two Array Collections: model.index.rows //The main array collection model.index.holdRows //The array collection that imitates the above This phantom data binding occurs only for the first iteration in the loop and for all others it will just write it the once. The reason this is proving troublesome is that it creates duplicate entries in my datagrid. public override function handleMessage(message:IMessage):void { super.handleMessage(message); if (message is IndexResponse) { var response:IndexResponse = message as IndexResponse; model.index.rows.removeAll(); model.index.indexIsEmpty = response.nullIndex; if (model.index.indexIsEmpty !== true) { //Update the index model from the response. Note: each property of the row object will be shown in the UI as a column in the grid response.index.forEach(function(entry:EntryData, i:int, a:Array):void { var row:Object = { fileID: entry.fileID, dadName: entry.dadName }; entry.tags.forEach(function(tag:Tag, i:int, a:Array):void { row[tag.name] = tag.value; }); model.index.rows.addItem(row); }); if(model.index.indexForNetworkView == true){ model.index.holdRows.source = model.index.holdRows.source.concat(model.index.rows.source); model.index.indexCounter++; model.index.indexForNetworkView = false; controller.indexController.showNetwork(model.index.indexCounter); } model.index.rows.refresh(); controller.networkController.show(); } } Has anyone else who has encountered something simillar propose a solution?

    Read the article

  • Fitting Text into an Image

    - by Abs
    Hello all, I have a function which takes in a font (ttf or otf file) and generates an image of text in different fonts. The problem I have is trying to work out how I can make the text fit in the image regardless of the font-size, type of font, and amount of text. I have tried to make the image rectangle variable so that it contains the text of different fonts without cutting a bit of the text since the image is not long or wide enough. Here is the function that I currently have, I have tried using the number of characters to determine the width of the image, but in some cases for some fonts and sizes, it still gets cut off. function generate_image($save_path, $text, $font_path){ $length = strlen($text) * 15; // Create the image $im = imagecreatetruecolor($length, 40); $white = imagecolorallocate($im, 255, 255, 255); $grey = imagecolorallocate($im, 128, 128, 128); $black = imagecolorallocate($im, 0, 0, 0); imagefilledrectangle($im, 0, 0, $length, 40, $white); $font = $font_path; imagettftext($im, 30, 0, 0, 25, $black, $font, $text); if(imagepng($im, $save_path)){ $status = true; }else{ $status = false; } imagedestroy($im); return $status; } Thank you all for any help

    Read the article

< Previous Page | 892 893 894 895 896 897 898 899 900 901 902 903  | Next Page >