Search Results

Search found 2610 results on 105 pages for 'dna sequence'.

Page 9/105 | < Previous Page | 5 6 7 8 9 10 11 12 13 14 15 16  | Next Page >

  • Sequence Point and Evaluation Order( Preincrement)

    - by Josh
    There was a debate today among some of my colleagues and I wanted to clarify it. It is about the evaluation order and the sequence point in an expression. It is clearly stated in the standard that C/C++ does not have a left-to-right evaluation in an expression unlike languages like Java which is guaranteed to have a sequencial left-to-right order. So, in the below expression, the evaluation of the leftmost operand(B) in the binary operation is sequenced before the evaluation of the rightmost operand(C): A = B B_OP C The following expression according, to CPPReference under the subsection Sequenced-before rules(Undefined Behaviour) and Bjarne's TCPPL 3rd ed, is an UB x = x++ + 1; It could be interpreted as the compilers like BUT the expression below is said to be clearly a well defined behaviour in C++11 x = ++x + 1; So, if the above expression is well defined, what is the "fate" of this? array[x] = ++x; It seems the evaluation of a post-increment and post-decrement is not defined but the pre-increment and the pre-decrement is defined. NOTE: This is not used in a real-life code. Clang 3.4 and GCC 4.8 clearly warns about both the pre- and post-increment sequence point.

    Read the article

  • Playing a sequence of sounds without gaps (iPhone)

    - by Fiire
    I thought maybe the fastest way was to go with Sound Services. It is quite efficient, but I need to play sounds in a sequence, not overlapped. Therefore I used a callback method to check when the sound has finished. This cycle produces around 0.3 seconds in lag. I know this sounds very strict, but it is basically the main axis of the program. EDIT: I now tried using AVAudioPlayer, but I can't play sounds in a sequence without using audioPlayerDidFinishPlaying since that would put me in the same situation as with the callback method of SoundServices. EDIT2: I think that if I could somehow get to join the parts of the sounds I want to play into a large file, I could get the whole audio file to sound continuously. EDIT3: I thought this would work, but the audio overlaps: waitTime = player.deviceCurrentTime; for (int k = 0; k < [colores count]; k++) { player.currentTime = 0; [player playAtTime:waitTime]; waitTime += player.duration; } Thanks

    Read the article

  • Windows shutdown processes termination sequence

    - by jpmartins
    I've seen today an wierd situation. I have a theory, but it would help to know more about the windows shutdown process. If you have some knowlaged about it please share. A machine was shutdown (at this moment I suspect an unexpected mantainace), on that machine there was a long running process that was interrupted. Monitorization confirms that the process did not terminated normally. Loking at the logs for the long running process it seem that was just finishing. That seems higly unprobable since it was running for more than 6 hours (witch is a bit more than the usual 5 hours). The process lanches child processes and waits for results from them, I suspect pour error control on the parent process and that the shutdown as terminated child processes before.

    Read the article

  • What is the purpose of a boot priority sequence or order in BIOS

    - by rbeede
    A BIOS provides multiple options for specifying an order/priority to search for boot devices. Is there really much of a purpose now to have to specify more than one possible boot device? It would seem to me it is only useful when popping in an CD/DVD to install an OS after which the common scenario is to always boot from the hard drive unless something is broken. I'm curious as to why not simply have 1 option/device to set in the BIOS and expect the user to press a key to do alternate boot instead? Is there still a scenario for having the BIOS try multiple devices in a configured order?

    Read the article

  • how to mod rewrite unicode byte sequence for the multibyte hyphen character

    - by ChickenFur
    We have case where some adobe pdf files format the hyphen character as %E2%80%90. See http://forums.adobe.com/message/2807241 this is caused by the Calibri font I guess. So these pdf files have been released and the links don't work So I thought mod rewrite would come to the rescue. I followed this post here mod_ReWrite to remove part of a URL but I can't seem to search for the % characters according to this question. Is there anything else I can do? Here is the rewrite rule I want to use: RewriteRule ^foo%(.+)bar /foo-bar [L,R=301] I also tried this and it doesn't work RewriteRule ^foo%E2%80%90bar /foo-bar [L,R=301] Any Ideas?

    Read the article

  • IBM Bladecentre H Bootup Sequence Control

    - by Spence
    I have a bladecentre with blades, network and a SAN in a single rack. What I'd like to do is control the startup of the bladecentre so that when the rack is powered on that the blades will delay their bootup until the SAN is powered on correctly. Is this even possible? We have an AMM in the chassis if that helps. Basically we are looking into the reboot that occurs after power is restored to a UPS. I sincerely apologise for the noobness of this question, but I am a software guy trying to help :)

    Read the article

  • FFMPEG dropping frames while encoding JPEG sequence at color change

    - by Matt
    I'm trying to put together a slide show using imagemagick and FFMPEG. I use imagemagick to expand a single photo into 30fps video (imagemagick also handles things like putting some text captions on the frames along the way). When I go to let ffmpeg digest it into a video it clips along nicely on the color parts of the video, but when it gets to a black and white section it reports "frame= 2030 fps=102 q=32766.0 Lsize= 5203kB time=00:01:07.60 bitrate= 630.5kbits/s dup=0 drop=703" and drops every frame of video until it hits something with color. As you can imagine this results in entire photos being removed from the slideshow. Here is my latest dump... ffmpeg -y -r 30 -i "teststream/%06d.jpg" -c:v libx264 -r 30 newffmpeg.mp4 ffmpeg version git-2012-12-10-c3bb333 Copyright (c) 2000-2012 the FFmpeg developers built on Dec 10 2012 22:02:04 with gcc 4.6.1 (Ubuntu/Linaro 4.6.1-9ubuntu3) configuration: --enable-gpl --enable-libfaac --enable-libmp3lame --enable-libopencore-amrnb --enable-libopencore-amrwb --enable-librtmp --enable-libtheora --enable-libvorbis --enable-libx264 --enable-nonfree --enable-version3 libavutil 52. 12.100 / 52. 12.100 libavcodec 54. 79.101 / 54. 79.101 libavformat 54. 49.100 / 54. 49.100 libavdevice 54. 3.102 / 54. 3.102 libavfilter 3. 26.101 / 3. 26.101 libswscale 2. 1.103 / 2. 1.103 libswresample 0. 17.102 / 0. 17.102 libpostproc 52. 2.100 / 52. 2.100 Input #0, image2, from 'teststream/%06d.jpg': Duration: 00:12:02.80, start: 0.000000, bitrate: N/A Stream #0:0: Video: mjpeg, yuvj444p, 720x480 [SAR 72:72 DAR 3:2], 25 fps, 25 tbr, 25 tbn, 25 tbc [libx264 @ 0x3450140] using SAR=1/1 [libx264 @ 0x3450140] using cpu capabilities: MMX2 SSE2Fast SSSE3 FastShuffle SSE4.2 [libx264 @ 0x3450140] profile High, level 3.0 [libx264 @ 0x3450140] 264 - core 129 r2 1cffe9f - H.264/MPEG-4 AVC codec - Copyleft 2003-2012 - http://www.videolan.org/x264.html - options: cabac=1 ref=3 deblock=1:0:0 analyse=0x3:0x113 me=hex subme=7 psy=1 psy_rd=1.00:0.00 mixed_ref=1 me_range=16 chroma_me=1 trellis=1 8x8dct=1 cqm=0 deadzone=21,11 fast_pskip=1 chroma_qp_offset=-2 threads=12 lookahead_threads=2 sliced_threads=0 nr=0 decimate=1 interlaced=0 bluray_compat=0 constrained_intra=0 bframes=3 b_pyramid=2 b_adapt=1 b_bias=0 direct=1 weightb=1 open_gop=0 weightp=2 keyint=250 keyint_min=25 scenecut=40 intra_refresh=0 rc_lookahead=40 rc=crf mbtree=1 crf=23.0 qcomp=0.60 qpmin=0 qpmax=69 qpstep=4 ip_ratio=1.40 aq=1:1.00 Output #0, mp4, to 'newffmpeg.mp4': Metadata: encoder : Lavf54.49.100 Stream #0:0: Video: h264 ([33][0][0][0] / 0x0021), yuvj420p, 720x480 [SAR 1:1 DAR 3:2], q=-1--1, 15360 tbn, 30 tbc Stream mapping: Stream #0:0 - #0:0 (mjpeg - libx264) Press [q] to stop, [?] for help Input stream #0:0 frame changed from size:720x480 fmt:yuvj444p to size:720x480 fmt:yuvj422p Input stream #0:0 frame changed from size:720x480 fmt:yuvj422p to size:720x480 fmt:yuvj444pp=584 frame= 2030 fps=102 q=32766.0 Lsize= 5203kB time=00:01:07.60 bitrate= 630.5kbits/s dup=0 drop=703 video:5179kB audio:0kB subtitle:0 global headers:0kB muxing overhead 0.472425% [libx264 @ 0x3450140] frame I:9 Avg QP:20.10 size: 33933 [libx264 @ 0x3450140] frame P:636 Avg QP:24.12 size: 6737 [libx264 @ 0x3450140] frame B:1385 Avg QP:27.04 size: 514 [libx264 @ 0x3450140] consecutive B-frames: 2.5% 15.2% 13.2% 69.2% [libx264 @ 0x3450140] mb I I16..4: 8.3% 80.3% 11.5% [libx264 @ 0x3450140] mb P I16..4: 1.5% 2.5% 0.2% P16..4: 41.7% 18.0% 10.3% 0.0% 0.0% skip:25.9% [libx264 @ 0x3450140] mb B I16..4: 0.0% 0.0% 0.0% B16..8: 26.6% 0.6% 0.1% direct: 0.2% skip:72.3% L0:35.0% L1:60.3% BI: 4.7% [libx264 @ 0x3450140] 8x8 transform intra:64.1% inter:75.1% [libx264 @ 0x3450140] coded y,uvDC,uvAC intra: 51.6% 78.0% 43.7% inter: 10.6% 14.9% 2.1% [libx264 @ 0x3450140] i16 v,h,dc,p: 29% 19% 6% 46% [libx264 @ 0x3450140] i8 v,h,dc,ddl,ddr,vr,hd,vl,hu: 23% 15% 17% 5% 9% 10% 7% 8% 6% [libx264 @ 0x3450140] i4 v,h,dc,ddl,ddr,vr,hd,vl,hu: 31% 18% 11% 5% 9% 10% 6% 6% 4% [libx264 @ 0x3450140] i8c dc,h,v,p: 46% 18% 24% 12% [libx264 @ 0x3450140] Weighted P-Frames: Y:20.1% UV:18.7% [libx264 @ 0x3450140] ref P L0: 59.2% 23.2% 13.1% 4.3% 0.2% [libx264 @ 0x3450140] ref B L0: 88.7% 8.3% 3.0% [libx264 @ 0x3450140] ref B L1: 95.0% 5.0% [libx264 @ 0x3450140] kb/s:626.88 Received signal 2: terminating. One last note: If I remove the -r 30 from the input and output it works flawlessly. I have no idea why the -r 30 is causing it to freak out.

    Read the article

  • Boot sequence unlike reboot

    - by samgoody
    When I turn on the computer it acts very differently than when I reboot it. [WinXP Pro, Intel Core2 6600, 2.4GHZ, 2GB RAM, NVIDA GeForce] Boot: Monitor must be plugged into the motherboard or no image. Screen resolution 800x600. Changes to the resolution cause only the top half of the screen to be usable, and are lost when I shut down the computer. Desktop icons arranged in neat rows on left of desktop. Nothing of note in system tray In Device Manger - Display adapter: Intel(R) Q965/Q963 Express Chipset Family In Device Manger - Monitors, two monitors are listed Hibernate and standby work. Reboot: Monitor must be plugged into the graphics card or no image. Screen resolution - 1280x1024 Desktop icons arranged in the cute circle that I put them in. NVIDIA icon shows in system tray. In Device Manger - Display adapter: NVIDA GeForce 6200LE In Device Manger - Monitors, one monitor is listed Hibernate and standby do not work. When awakened after a hibernation it says: The system could not be restarted from its previous location because the restoration image is corrupt. Delete restoration data & proceed to system boot? Double reboot (inconsistent): Monitor must be plugged into the graphics card. Screen resolution - 1024x768 Odd icon shows in system tray whose tooltip says "Intel Graphics" For a while my morning ritual was to boot, wait, reboot using (alt+ctrl+del - ctrl+u - R), wait. Keeping the monitor plugged into the graphics card. But aside for the inefficiency of this method, I sometimes want to standby and can't. On the other hand, the computer is unusable when set to 800x600. Please help, anyone?

    Read the article

  • Proper end of day sequence to maintain monitor config

    - by WarmBeer
    I've got an HP EliteBook 6930p that travels from home, where it is connected to individual cables, and work where there is a docking station. At both locations I have an external monitor as the secondary monitor and like to have the laptop screen as the primary, i.e. with the task bar. At the end of the day I close the laptop, which is supposed to set it to standby. When I get home I plug in the power cord and the external monitor cord and open the computer. When heading into work I close the computer and unplug everything. Inevitably when I open the computer at the new location the monitors are reversed, i.e. the primary, task bar display is on the external monitor and the laptop shows the secondary, even though when i click identify the laptop has the 1. I then have to disable the secondary display, switch the primary to the laptop and re-enable the secondary. I've tried locking the computer before closing and occasionally that works to keep the setup in place but not always. Any suggestions for how to keep the config in place during transport? ed

    Read the article

  • Adding a new automatic number sequence

    - by Paul
    We write test case documents. In these documents, each test case is numbered. E.g. Foobar-UI-1 to Foobar-UI-23 or Foobar-Device-1 to Foobar-Device-87 I'd like to autonumber these. I don't think I want just a new numbered list format, I want something like the list of figures - where figures (or test case) can be defined anywhere in the doc with other headings and paragraphs between them, and I can insert a "List of figures" table at the beginning. So how do I do "test cases" and a "list of test-cases" table in the same way as figures work out of the box?

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Which command would replace IDENTITY INSERT ON/OFF from SQLServer in Oracle?

    - by rodrigoq
    Hello, I have to migrate this query (simplified here) from T-SQL to ORACLE SET IDENTITY_INSERT table ON INSERT INTO table (id, value) VALUES (1, 2) SET IDENTITY_INSERT table OFF id being an Identity field in SQLServer. I have the same table with a sequence in ORACLE, I couldn't find a snippet that shows how to disable the sequence and set it to start again with the MAX(id) + 1. Any ORACLE expert can help me with this? Thanks, Rodrigo.

    Read the article

  • subprocess.Popen doesn't work when args is sequence

    - by pero
    I'm having a problem with subprocess.Popen when args parameter is given as sequence. For example: import subprocess maildir = "/home/support/Maildir" This works (it prints the correct size of /home/support/Maildir dir): size = subprocess.Popen(["du -s -b " + maildir], shell=True, stdout=subprocess.PIPE).communicate()[0].split()[0] print size But, this doesn't work (try it): size = subprocess.Popen(["du", "-s -b", maildir], shell=True, stdout=subprocess.PIPE).communicate()[0].split()[0] print size What's wrong?

    Read the article

  • Bind a Java Collection to xQuery sequence from xQuery

    - by jtzero
    declare function Error:toString($this as javaObject) as xs:string external; the previous binds a return String() to xs:string. is it possible to return a collection and bind it to an xQuery Sequence, say the following declare function Error:toList($this as javaObject) as squenceType external; so that it can be run through a flwr?

    Read the article

  • XAML C# WPF Best efficient way to do an ordered sequence of animations

    - by toni
    Hi everybody! I would like to do a sequence of animations on a label, for example, first do opacity animations from values 0 to 1 and vice versa and just at the end of opacity animation and not before a foreground animation. I would like to do it in XAML code and then start and finish de animation from C# code. Which is the best and efficient way to do it? All replies are welcome! Thanks in advance.

    Read the article

  • Factory Girl sequence fails under autospec

    - by John
    I have this Factory: Factory.define :email_address do |e| e.sequence(:address) { |n| "factory_#{n}@example.com" } e.validated true end When I run my specs with rake spec, it works fine. When I run autospec, it fails right away, claiming that the email address is being used twice in two different objects (there is a validation which restricts this). Why is it behaving differently under autospec? Thanks, John

    Read the article

  • sequence and merge jpeg images using python ?

    - by DILi
    im doing a project as part of academic programme.Im doing this in linux platform.I have converted a few pdf files in to html and jpeg images using pdftohtml.now i need to sequence the jpeg images depending on some conditions and to merge them .how can i do this using python?.if anyone can provide any such python script which have done any functions similar to this then it will be very helpful.

    Read the article

  • DShow : Enumeration sequence of IEnumMoniker

    - by KenC
    Hello, This is a question about DirectShow IEnumMoniker. Out of some reason, I have to know "what kind of order" IEnumMoniker enumerates items. (I mean, it's alphabetically or...?) The following pages are documents about IEnumMoniker, however, it doesn't mention about this : http://msdn.microsoft.com/en-us/library/ms692852(v=VS.85).aspx http://msdn.microsoft.com/en-us/library/dd407292%28VS.85%29.aspx If anybody has the idea about the enumeration sequence, please let me know. Thanks a lot.

    Read the article

  • Rearranging a sequence

    - by sarah
    I'm have trouble rearranging sequences so the amount of letters in the given original sequence are the same in the random generated sequences. For example: If i have a string 'AAAC' I need that string rearranged randomly so the amount of A's and C's are the same.

    Read the article

< Previous Page | 5 6 7 8 9 10 11 12 13 14 15 16  | Next Page >