Search Results

Search found 406 results on 17 pages for 'vincent davis'.

Page 9/17 | < Previous Page | 5 6 7 8 9 10 11 12 13 14 15 16  | Next Page >

  • Solve the IE select overlap bug

    - by Vincent Robert
    When using IE, you cannot put an absolutely positioned div over a select input element. That's because the select element is considered an ActiveX object and is on top of every HTML element in the page. I already saw people hiding selects when opening a popup div, that leads to pretty bad user experience having controls disappearing. FogBugz actually had a pretty smart solution (before v6) of turning every select into text boxes when a popup was displayed. This solved the bug and tricked the user eye but the behavior was not perfect. Another solution is in FogBugz 6 where they no more use the select element and recoded it everywhere. Last solution I currently use is messing up the IE rendering engine and force it to render the absolutely positioned div as an ActiveX element too, ensuring it can live over a select element. This is achieved by placing an invisible iframe inside the div and styling it with: #MyDiv iframe { position: absolute; z-index: -1; filter: mask(); border: 0; margin: 0; padding: 0; top: 0; left: 0; width: 9999px; height: 9999px; overflow: hidden; } Anyone has a even better solution than this one ? EDIT: The purpose of this question is as much informative as it is a real question. I find the iframe trick to be a good solution but I am still looking for improvement like removing this ugly useless iframe tag that degrade accessibility.

    Read the article

  • Jquery - Loop through Checkboxes and Multiple elements

    - by Vincent
    All, I have a set of elements like this in a form: <input type="checkbox" name="chk[140]"> <input type="hidden" value="3" name="ctcount[140]"> <input type="hidden" value="Apples" name="catname[140]"> <input type="checkbox" name="chk[142]"> <input type="hidden" value="20" name="ctcount[142]"> <input type="hidden" value="Bananas" name="catname[142]"> <input type="checkbox" name="chk[144]"> <input type="hidden" value="200" name="ctcount[144]"> <input type="hidden" value="Strawberries" name="catname[144]"> <input type="checkbox" name="chk[145]"> <input type="hidden" value="0" name="ctcount[145]"> <input type="hidden" value="Carrots" name="catname[145]"> When a user clicks a button, I want the Javascript to: 1. Loop through all the checkboxes 2. For all the checked checkboxes, 2a. Get ctcount value 2b. Get catname value 2c. If ctcount value > 50, alert a message saying "Unable to add item as max limit for 'catname' has reached. 2d. Break the loop after it encountered first ctcount value that is greater than 50. I am new to JQuery..have the following code so far: var checklimit = 50; $('#frmTest input:checkbox:checked').each(function(i) { alert(this.value); }); How do I do this using JQuery? Thanks

    Read the article

  • Call dll - pcshll32.dll using delphi

    - by Davis
    Hi, I need to call hllapi function of pcshll32.dll using delphi. It's works with personal communications of ibm. How can i change the code bellow to delphi ? Thanks !!! The EHLLAPI entry point (hllapi) is always called with the following four parameters: EHLLAPI Function Number (input) Data Buffer (input/output) Buffer Length (input/output) Presentation Space Position (input); Return Code (output) The prototype for IBM Standard EHLLAPI is: [long hllapi (LPWORD, LPSTR, LPWORD, LPWORD); The prototype for IBM Enhanced EHLLAPI is: [long hllapi (LPINT, LPSTR, LPINT, LPINT); Each parameter is passed by reference not by value. Thus each parameter to the function call must be a pointer to the value, not the value itself. For example, the following is a correct example of calling the EHLLAPI Query Session Status function: #include "hapi_c.h" struct HLDQuerySessionStatus QueryData; int Func, Len, Rc; long Rc; memset(QueryData, 0, sizeof(QueryData)); // Init buffer QueryData.qsst_shortname = ©A©; // Session to query Func = HA_QUERY_SESSION_STATUS; // Function number Len = sizeof(QueryData); // Len of buffer Rc = 0; // Unused on input hllapi(&Func, (char *)&QueryData, &Len, &Rc); // Call EHLLAPI if (Rc != 0) { // Check return code // ...Error handling } All the parameters in the hllapi call are pointers and the return code of the EHLLAPI function is returned in the value of the 4th parameter, not as the value of the function.

    Read the article

  • How to debug packet loss ?

    - by Gene Vincent
    I wrote a C++ application (running on Linux) that serves an RTP stream of about 400 kbps. To most destinations this works fine, but some destinations expericence packet loss. The problematic destinations seem to have a slower connection in common, but it should be plenty fast enough for the stream I'm sending. Since these destinations are able to receive similar RTP streams for other applications without packet loss, my application might be at fault. I already verified a few things: - in a tcpdump, I see all RTP packets going out on the sending machine - there is a UDP send buffer in place (I tried sizes between 64KB and 300KB) - the RTP packets mostly stay below 1400 bytes to avoid fragmentation What can a sending application do to minimize the possibility of packet loss and what would be the best way to debug such a situation ?

    Read the article

  • Rotate webpage via code?

    - by Adam Davis
    I'm hoping that there's a relatively simple way to rotate a webpage a little bit, 30 degrees or so, while still leaving it fully functional and usable. I completely control the page, and can modify it to make this easier if needed. I'd rather not re-write the whole thing in SVG, though, but perhaps javascript and canvas will work? Is there a way using CSS, Javascript, or some other cross browser method that would allow me to accomplish this?

    Read the article

  • Zend_Soap_Client - Ignore HTTPS verification

    - by Vincent
    All, I want to use Zend_Soap_Client class to load WSDL from an HTTPS url. Currently, if I call like this, it gives me an error even if the WSDL is perfectly valid: $wsdlUrl = "https://abc.xyz.com/webservices/WeatherService.php?wsdl"; $soapClient = new Zend_Soap_Client($wsdlUrl); The error I receive is: SOAP-ERROR: Parsing WSDL: Couldn't load from 'https://abc.xyz.com/webservices /WeatherService.php?wsdl' : Start tag expected, '<' not found If I browse to the WSDL url in the browser, it loads up the WSDL just fine. I think Zend_Soap_Client is trying to validate the certificate and failing. Is there a way to set the SOAP option to ignore the HTTPS verification and just load the WSDL? Thanks

    Read the article

  • CSS for https urls

    - by Vincent
    Hello, looking for some help with images referenced within the stylesheet. I have no problems with these from non secure locations within the site but only from https. The stylesheet loads fine and displays everything correctly except for the images. example: body { margin: 0; padding: 0; background: url(/img/background_tile.gif) top left repeat-x; text-align: center; background-color: #fff; } All my css files and other image paths inside the code use relative urls to images. How can I make sure they all work fine without hard coding my image paths with https or http? I want the code to work fine with http and https. Thanks

    Read the article

  • What are all the instances of syntactic sugar in Scala?

    - by Jackson Davis
    I decided to create this question to have a single source for all things syntactic sugar in Scala. I feel these details are some of the things most frustrating to starting users and are hard to search for since most/all of them are purely symbols and are thus hard to search for without knowing the name of the concept. TODO: implicit conversions _ syntax for anonymous functions Extractors(Unapply/UnapplySeq) Other things I'm forgetting

    Read the article

  • How to fix issues when MSCRM Plugin Registration fails.

    - by Jeff Davis
    When you register a plug-in in Microsoft CRM all kinds of things can go wrong. Most commonly, the error I get is "An error occurred." When you look for more detail you just get: "Server was unable to process request" and under detail you see "An unexpected error occurred." Not very helpful. However, there are some good answers out there if you really dig. Anybody out there encountered this and how do you fix it?

    Read the article

  • merge() multiple data frames (do.call ?)

    - by Vincent
    Hi everyone, here's my very simple question: merge() only takes two data frames as input. I need to merge a series of data frames from a list, using the same keys for every merge operation. Given a list named "test", I want to do something like: do.call("merge", test). I could write some kind of loop, but I'm wondering if there's a standard or built-in way to do this more efficiently. Any advice is appreciated. Thanks! Here's a subset of the dataset in dput format (note that merging on country is trivial in this case, but that there are more countries in the original data): test <- list(structure(list(country = c("United States", "United States", "United States", "United States", "United States"), NY.GNS.ICTR.GN.ZS = c(13.5054687, 14.7608697, 14.1115876, 13.3389063, 12.9048351), year = c(2007, 2006, 2005, 2004, 2003)), .Names = c("country", "NY.GNS.ICTR.GN.ZS", "year"), row.names = c(NA, 5L), class = "data.frame"), structure(list( country = c("United States", "United States", "United States", "United States", "United States"), NE.TRD.GNFS.ZS = c(29.3459277, 28.352838, 26.9861939, 25.6231246, 23.6615328), year = c(2007, 2006, 2005, 2004, 2003)), .Names = c("country", "NE.TRD.GNFS.ZS", "year"), row.names = c(NA, 5L), class = "data.frame"), structure(list( country = c("United States", "United States", "United States", "United States", "United States"), NY.GDP.MKTP.CD = c(1.37416e+13, 1.31165e+13, 1.23641e+13, 1.16309e+13, 1.0908e+13), year = c(2007, 2006, 2005, 2004, 2003)), .Names = c("country", "NY.GDP.MKTP.CD", "year"), row.names = c(NA, 5L), class = "data.frame"))

    Read the article

  • Pear SOAP and XAMPP on Ubuntu

    - by Vincent
    All, I have installed xampp for linux on ubuntu 9.10. The installation directory is /opt/lampp. The xampp website says PEAR comes with the installation.. I am relatively new to PEAR and want to know the answers for following: Is PEAR installed with xampp or need to be installed separately using synaptic package manager? I browse to /opt/lampp/bin directory and see "pear" there, but when i type it in the command line, it says "The program 'pear' is currently not installed. You can install it by typing: sudo apt-get install php-pear pear: command not found " I want to use PEAR:SOAP package in my PHP code. How to use that? Do I need to set any paths to the pear in my php.ini? Thanks

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Launch Apple's Stocks app, with a particular stock selected

    - by Vincent Gable
    I would like to launch Apple's Stocks app to show information for a particular stock, on a non-jailbroken phone. I'm not interesting in how to get a quote or graph a stock myself, just opening Stocks.app. I was hoping that the Stocks app would have a custom URL format, so opening a URL like stocks://AAPL would do the trick. But I haven't found anything documenting such a scheme, and suspect it doesn't exist. Any other ideas, or is it impossible to integrate with the native Stocks app?

    Read the article

  • Regular expression for checking website url

    - by Linto davis
    I need to check the web address, using regular expression. if user type url as www.test.com http://www.test.com https://www.test.com i have a regular expression like /^(http\:\/\/[a-zA-Z0-9_-]+(?:.[a-zA-Z0-9_-]+)*.[a-zA-Z]{2,4}(?:\/[a-zA-Z0-9_]+)*(?:\/[a-zA-Z0-9_]+.[a-zA-Z]{2,4}(?:\?[a-zA-Z0-9_]+\=[a-zA-Z0-9_]+)?)?(?:\&[a-zA-Z0-9_]+\=[a-zA-Z0-9_]+)*)$/ but it will only allow the second option only. how can i modify the regular expression so that , it should accept 1st and 3rd option too

    Read the article

  • Graceful termination of NSApplication with Core Data and Grand Central Dispatch (GCD)

    - by Vincent Mac
    I have an Cocoa Application (Mac OS X SDK 10.7) that is performing some processes via Grand Central Dispatch (GCD). These processes are manipulating some Core Data NSManagedObjects (non-document-based) in a manner that I believe is thread safe (creating a new managedObjectContext for use in this thread). The problem I have is when the user tries to quit the application while the dispatch queue is still running. The NSApplication delegate is being called before actually quitting. - (NSApplicationTerminateReply)applicationShouldTerminate:(NSApplication *)sender I get an error "Could not merge changes." Which is somewhat expected since there are still operations being performed through the different managedObjectContext. I am then presented with the NSAlert from the template that is generated with a core data application. In the Threading Programming Guide there is a section called "Be Aware of Thread Behaviors at Quit Time" which alludes to using replyToApplicationShouldTerminate: method. I'm having a little trouble implementing this. What I would like is for my application to complete processing the queued items and then terminate without presenting an error message to the user. It would also be helpful to update the view or use a sheet to let the user know that the app is performing some action and will terminate when the action is complete. Where and how would I implement this behavior?

    Read the article

  • JQuery - Nested AJAX

    - by Vincent
    All, I am trying to perform a nested AJAX call using the following code. The nested call doesn't seem to work. Am I doing anything wrong? $.ajax({ type: 'GET', url: "/public/customcontroller/dosomething", cache: false, dataType: "html", success: function(html_input) { $.ajax({ type: 'GET', url: "/public/customcontroller/getjobstatus", cache: false, dataType: "html", success: function(html_input){ alert(html_input); } }); } }); Thanks

    Read the article

  • What is Adobe Flex? Is it just Flash II?

    - by Adam Davis
    Question Alright, I'm confused by all the buzzwords and press release bingo going on. What is the relationship between flash and flex: Replace flash (not really compatible) Enhance flash The next version of flash but still basically compatible Separate technology altogether ??? If I'm starting out in Flash now, should I just skip to Flex? Follow up Ok, so what I'm hearing is that there's three different parts to the puzzle: Flash The graphical editor used to make "Flash Movies", ie it's an IDE that focuses on the visual aspect of "Flash" (Officially Flash CS3?) The official name for the display plugins (ie, "Download Flash Now!") A general reference to the entire technology stack In terms of the editor, it's a linear timeline based editor, best used for animations with complex interactivity. Actionscript The "Flash" programming language Flex An Adobe Flash IDE that focuses on the coding/programming aspect of "Flash" (Flex Builder?) A Flash library that enhances Flash and makes it easier to program for (Flex SDK?) Is not bound to a timeline (as the Flash IDE is) and so "standard" applications are more easily accomplished. Is this correct?

    Read the article

  • Is it possible to transcode audio in C# using DirectSound?

    - by Robert Davis
    I want to transcode a lot of audio from its source format to PCM without resampling or messing with the sample size. I figure if Windows Media Player can play the file and it doesn't use a legacy ACM codecs it must be using DirectSound to do so (this is on Windows XP and Windows Server 2k3). So is it possible to access DirectSound from C# and do so? I've tried searching the web but all the examples have been about playback which I have no interest in doing.

    Read the article

  • Best Practice - Removing item from generic collection in C#

    - by Matt Davis
    I'm using C# in Visual Studio 2008 with .NET 3.5. I have a generic dictionary that maps types of events to a generic list of subscribers. A subscriber can be subscribed to more than one event. private static Dictionary<EventType, List<ISubscriber>> _subscriptions; To remove a subscriber from the subscription list, I can use either of these two options. Option 1: ISubscriber subscriber; // defined elsewhere foreach (EventType event in _subscriptions.Keys) { if (_subscriptions[event].Contains(subscriber)) { _subscriptions[event].Remove(subscriber); } } Option 2: ISubscriber subscriber; // defined elsewhere foreach (EventType event in _subscriptions.Keys) { _subscriptions[event].Remove(subscriber); } I have two questions. First, notice that Option 1 checks for existence before removing the item, while Option 2 uses a brute force removal since Remove() does not throw an exception. Of these two, which is the preferred, "best-practice" way to do this? Second, is there another, "cleaner," more elegant way to do this, perhaps with a lambda expression or using a LINQ extension? I'm still getting acclimated to these two features. Thanks. EDIT Just to clarify, I realize that the choice between Options 1 and 2 is a choice of speed (Option 2) versus maintainability (Option 1). In this particular case, I'm not necessarily trying to optimize the code, although that is certainly a worthy consideration. What I'm trying to understand is if there is a generally well-established practice for doing this. If not, which option would you use in your own code?

    Read the article

  • AOL Contact API and AIM Buddy API

    - by Joe Davis
    I've searched the AOL Developer network and found a Contacts API page that says "coming soon" and is dated last year. I've checked the SDK and APIs and found some AIM Buddy references... I'm looking for documentation on retrieving contact email addresses on behalf of users based on their AOL email login. Am I missing something or is the documentation really difficult to find? Does someone have a useful link?

    Read the article

  • Ruby use method only if condition is true

    - by Vincent
    So I have this code: class Door # ... def info attr = "" return { "width" => @width, "height" => @height, "color" => @color }[attr] if attr != "" end end mydoor = Door.new(100, 100, "red") puts mydoor.info("width") puts mydoor.info The method "info" should return the hash if no argument is provided, otherwise the value of the argument in the hash. How can I achieve that?

    Read the article

  • Updating with Related Entities - Entity Framework v4

    - by Vincent BOUZON
    Hi, I use Entity Framework V4 and i want to update Customer who have Visits. My code : EntityKey key; object originalItem; key = this._modelContainer.CreateEntityKey("Customers", customer); if (this._modelContainer.TryGetObjectByKey(key, out originalItem)) { this._modelContainer.ApplyCurrentValues(key.EntitySetName, customer); } this._modelContainer.SaveChanges(); It works for Scalar Property only. The customers.Visits collection is not updated. Best Regards :)

    Read the article

< Previous Page | 5 6 7 8 9 10 11 12 13 14 15 16  | Next Page >