Search Results

Search found 66534 results on 2662 pages for 'document set'.

Page 913/2662 | < Previous Page | 909 910 911 912 913 914 915 916 917 918 919 920  | Next Page >

• ASP.NET MVC 2 model properties binding order

  - by bniwredyc

  Is there a way to change order in which the default binder binds property values of model? For example I have model class A: class A { public string A1 {get; set;} public string A2 {get; set;} } and action DoSomethig: public ActionResult DoSomething(A model) { ... } I want that A2 property has been bound before the A1 property. Is it possible? Or I need to write custom binder?

  Read the article

• Left outer joins that don't return all the rows from T1

  - by Summer

  Left outer joins should return at least one row from the T1 table if it matches the conditions. But what if the left outer join performs a join successfully, then finds that another criterion is not satisfied? Is there a way to get the query to return a row with T1 values and T2 values set to NULL? Here's the specific query, in which I'm trying to return a list of candidates, and the user's support for those candidates IF such support exists. SELECT c.id, c.name, s.support FROM candidates c LEFT JOIN support s on s.candidate_id = c.id WHERE c.office_id = 5059 AND c.election_id = 92 AND (s.user_id = 2 OR s.user_id IS NULL) --This line seems like the problem ORDER BY c.last_name, c.name The query joins the candidates and support table, but finds that it's a different user who supported this candidate (user_id=3, say). Then the candidate disappears entirely from the result set.

  Read the article

• No image displayed in Fancybox

  - by seansean11

  I am having trouble getting fancybox to display its corresponding images on a website that I'm building http://www.nomadicdrift.com/test/kaniwa#events . It's a custom one page portfolio theme that I set up on the WordPress platform. If you follow the link to the events section you will see 1 figure item in a gallery like position. I have this image set up to work as a fancybox gallery, but when you click on it, it opens up the fancybox interface but does not place a image in the frame, even though it should. So this is the problem...the images do not show up in fancybox and instead I see just the frame. Here is the html that I'm displaying: <figure> <a class="fancybox" data-fancybox-type="Fashion Show de Paris, France" href="http://www.nomadicdrift.com/test/kaniwa/wp-content/uploads/2012/07/NM2.jpg"> <img class="attachment-evento wp-post-image" width="231" height="191" title="NM" alt="NM" src="http://www.nomadicdrift.com/test/kaniwa/wp-content/uploads/2012/07/NM2-231x191.jpg"> </a> <figcaption> <a class="fancybox" data-fancybox-type="Fashion Show de Paris, France" href="http://www.nomadicdrift.com/test/kaniwa/wp-content/uploads/2012/07/CEDESAN.jpg"> </a> <h4>Fashion Show de Paris, France</h4> </figcaption> </figure> I'm not going to bore you with the PHP that I used to get that output because I think the problem lies elsewhere. ***I have tried to set up a simple standard fancybox gallery on the site also, but it gives me thes same problem, leading me to believe that the problem is deeper than the html markup. I have also successfully used this same markup for a one thumbnail fancybox gallery on another site. I thought maybe it was due to some conflict in the .js files I'm using. I tried uninstalling all of my plugins/addons (which aren't too many) one by one and still had the same result. I have all of my personal javascript in the functions.js file, which is where I call the fancybox plugin using the standard $("a.fancybox").fancybox();. I have installed this plugin before on other sites and have searched extensively for an answer, so any help is greatly appreciated. Thanks, Sean

  Read the article

• DataGridView - DefaultCellStyle, rows and columns propriority

  - by angelPL

  Hi! In C#, in DataGridView I want to set the BackColor property for the first row and first column. And the cell from first row and first column, should have property from first column, not row - but it does. For example: (table 3 x 3); 'X' - property for first row, 'Y' - property for first column, 'a' - default property should be: Y X X Y a a Y a a but is: X X X Y a a Y a a There is no matter which property I set first: dataGridView1.Rows[0].DefaultCellStyle.BackColor = Color.Lavender; dataGridView1.Columns[0].DefaultCellStyle.BackColor = Color.Beige; or: dataGridView1.Columns[0].DefaultCellStyle.BackColor = Color.Beige; dataGridView1.Rows[0].DefaultCellStyle.BackColor = Color.Lavender; Sorry for my english...

  Read the article

• How can I create an enum using numbers?

  - by Jordan S

  Is it possible to make an enum using just numbers in C#? In my program I have a variable, Gain, that can only be set to 1, 2, 4, and 8. I am using a propertygrid control to display and set this value. If I were to create an enum like this... private enum GainValues {One, Two, Four, Eight} and I made my gain variable of type GainValues then the drop-down list in the propertygrid would only show the available values for the gain variable. The problem is I want the gain values to read numerically an not as words. But I can not create an enum like this: private enum GainValues {1,2,4,8} So is there another way of doing this? Perhaps creating a custom type?

  Read the article

• Can't modify XNA Vector components

  - by Matt H

  I have a class called Sprite, and ballSprite is an instance of that class. Sprite has a Vector2 property called Position. I'm trying to increment the Vector's X component like so: ballSprite.Position.X++; but it causes this error: Cannot modify the return value of 'WindowsGame1.Sprite.Position' because it is not a variable Is it not possible to set components like this? The tooltip for the X and Y fields says "Get or set ..." so I can't see why this isn't working.

  Read the article

• AllowSetForegroundWindow & SetForegroundWindow: NPAPI plug-in wants to allow a desktop application with no success

  - by David Robert Jones

  Here it's what I have: a web browser plug-in written in C++ and a Windows application written in C#. They communicate through a named pipe. The plug-in instructs the C# application to open a file (suppose that the file is a .txt and it opens in Notepad). Once the C# application is given the command, it opens the file but Notepad doesn't show in the foreground, which isn't acceptable, I must open Notepad in the foreground. I modified the C# application so that it calls the SetForegroundWindow function. This time Notepad didn't open in the foreground, but the taskbar flashes. After reading the documentation for SetForegroundWindow and many articles I think that now I understand what the problem is: the C# application can't bring Notepad to the foreground because it wasn't the the foreground process, the browser was (?). After reading this: "A process that can set the foreground window can enable another process to set the foreground window by calling the AllowSetForegroundWindow function." I decided to modify the plug-in. This time the plug-in calls the AllowSetForegroundWindow function passing ASFW_ANY as a parameter (I know, ASFW_ANY could be risky, but I wanted to make sure that AllowSetForegroundWindow would do it). After I did the modification to the plug-in I tested it and it worked! (Opera 12.02). Then I tested it on Internet Explorer and it worked too. But the problem came when I tested it in Firefox and Chrome. The C# application didn't have the ability to bring Notepad to the foreground. I noticed that for those browsers the AllowSetForegroundWindow function was returning false. So I started investigating and I come to the conclusion that maybe it's because the plugin container that Firefox uses. An idea came to my mind: it worked in Opera 12.02, but they don't have a plugin container, although they did in Opera 12.00. So I downloaded Opera 12.00, I did the test and it failed, which makes me conclude that the plugin container is the culprit. The question is: how can I give to the C# application the ability to set foreground? I don't know how to continue, and I think that I tried all the legitimate ways. The AllowSetForegroundWindow & SetForegroundWindow seems to not apply here.

  Read the article

• how to print not mapped value

  - by IcanMakeIt

  I am using complicated SQL queries, i have to use SqlQuery ... in simple way: MODEL: public class C { public int ID { get; set; } [NotMapped] public float Value { get; set; } } CONTROLLER: IEnumerable<C> results = db.C.SqlQuery(@"SELECT ID, ATAN(-45.01) as Value from C); return View(results.ToList()); VIEW: @model IEnumerable<C> @foreach (var item in Model) { @Html.DisplayFor(modelItem => item.Value) } and the result for item.Value is NULL. So my question is , how can i print the computed value from SQL Query ? Thank you for help.

  Read the article

• MVC Display Template for Generic Type

  - by Kyle

  I am trying to use the model ListModel as a generic list model. I would like to enter on the page @Html.DisplayForModel() However the MVC is not correctly finding the templated file "ListModel.cshtml". It must work differently for generic models. What should I name the templated file in order for it to correctly be located? public class ListModel<T> { public IEnumerable<T> Models {get;set;} public string NextPage {get;set;} } I would expect it to look for "Shared/DisplayTemplates/ListModel.ascx" but it doesn't. Does anyone know?

  Read the article

• Cannot convert to string [on hold]

  - by user3598883

  I am trying to transfer information from form1 to form2 and I am getting the error of "Cannot implicitly convert type form1.employee to 'string' Some coding i have used for this transfer process is as follows: (everything is set to public) I'll Also add that I ONLY have it set to FirstName.FirstName because it seems tog et it to work if I remove one one of the FirstName then It tells me it cannot convert to string public void Enter_Click(object sender, EventArgs e) Form2 frm2 = new Form2(); Employee FirstName = new Employee(); if (Directions.Text == "Please Enter Employee First Name") { FirstName.FirstName = Info.Text; Directions.Text = "Please Enter Employee Last Name"; } frm2.FN.Text = FirstName; public class Employee { public string FirstName; }

  Read the article

• WinXP Parallels Guest with OS X host -- communication between the two?

  - by Justin

  The setup: Windows XP guest OS running inside Parallels 5 on a OS X 10.6.2 host. I have a win32 application that runs in windows that communicates with other programs by sending out keystrokes to the program in focus. I can run this software inside parallels just fine, but I need a way for it to communicate (via keystrokes) with native OS X applications. For instance, the windows software sends out a continuous stream of a's and w's, based on the program input from an external source. On the other side, I have a Mac version of VLC media player with hotkeys set up for a and w for the two functions I would like to manipulate from the windows software. How can I set up a link between the guest and host OS's with Parallels that lets a windows program send keystrokes to a mac program?

  Read the article

• Common optimization rules

  - by mafutrct

  This is a dangerous question, so let me try to phrase it correctly. Premature optimization is the root of all evil, but if you know you need it, there is a basic set of rules that should be considered. This set is what I'm wondering about. For instance, imagine you got a list of a few thousand items. How do you look up an item with a specific, unique ID? Of course, you simply use a Dictionary to map the ID to the item. And if you know that there is a setting stored in a database that is required all the time, you simply cache it instead of issuing a database request hundred times a second. I guess there are a few even more basic ideas. I am specifically not looking for "don't do it, for experts: don't do it yet" or "use a profiler" answers, but for really simple, general hints. If you feel this is an argumentative question, you probably misunderstood my intention.

  Read the article

• Show parts of the result of an SQL statement using PHP

  - by mouthpiec

  I have an SQL query which returns a set of data (around 40-50 tuples). I would like to display the results 5 at a time on an HTML page using PHP. I already managed to have the right SELECT statement, but i am having problems to display the results 5 by 5 using a "more" button. Can you please help? Note that every time i call the query, the data is being randomized, so it is not possible to set limits and call the query again. I have to find the method to store the results somewhere, and then show them 5 by 5.

  Read the article

• change selects value onchange of another select

  - by Syom

  i start learning jquery few days ago, and i like it very much. but now i have a problem, that can't solve alone. i have two selects <select id="select1"> <option value="1">1day</option> <option value="2">2day</option> <option value="3">3day</option> </select> <select id="select2"> <option value="1">1day</option> <option value="2">2day</option> <option value="3">3day</option> </select> i need to set #select2 the same value with #select1, when #select1 changes i've red some questions about select tag here, but i need to set "selected" attribute to that option, which have the same value. how can i do it? Thanks

  Read the article

• NoSuchMethodException while using JAVA Reflection

  - by Appps

  Hi I'm trying to use reflection to invoke a method and update the setter value of that method. But I'm getting NoSuchMethodException while ivoking that method. com.test.Test.setAddress1(java.lang.Double) .But I've this method defined in my Class. Is the problem with my code. Can someone please help me? Thanks in advance. I've my code below. Class[] doubleArrayParamTypes = new Class[ 1 ]; doubleArrayParamTypes[ 0 ] = Double.class; Class class=Class.forName( "com.test.Test"); Object voObject = class.newInstance(); String data="TestData"; performMapping(class,"setAddress1",doubleArrayParamTypes ,voObject,data); /* Reflection to set the data */ private void performMapping(Class class,String methodName,Class[] clazz,Object voObject,Object data) { class.getMethod( "set" + methodName, clazz ).invoke( voObject, data ); }

  Read the article

• How to bind WPF TreeView to a List<Drink> programmatically?

  - by Joan Venge

  So I am very new to WPF and trying to bind or assign a list of Drink values to a wpf treeview, but don't know how to do that, and find it really hard to find anything online that just shows stuff without using xaml. struct Drink { public string Name { get; private set; } public int Popularity { get; private set; } public Drink ( string name, int popularity ) : this ( ) { this.Name = name; this.Popularity = popularity; } } List<Drink> coldDrinks = new List<Drink> ( ){ new Drink ( "Water", 1 ), new Drink ( "Fanta", 2 ), new Drink ( "Sprite", 3 ), new Drink ( "Coke", 4 ), new Drink ( "Milk", 5 ) }; } } How can I do this in code? For example: treeview1.DataItems = coldDrinks; and everything shows up in the treeview.

  Read the article

• finding the numbers in a given range?

  - by Jamis

  Hi Friends, kindly tel me the concept to write a perl program behind this ? 167 GATCAAAATACTTGCTGGA 185 192 TAGTAGATAGATAGATAGTAGTAG 228 in a fileA i ve a range from 167 to 185 as given as above and also 192 to 228 in another fileB i ve set of numbers 2 3 4 5 6 7 8 168 169 179 185 193 1000 now from the above set of numbers in file B, i need to find out which are the numbers present between the range of 167 to 185 and print those numbers in the output. so, output will be 168,169,179,185, 193 what will be the concept behind writing this program?

  Read the article

• Issue with a JPA query

  - by boyd4715

  I am trying to execute the following JPA query: public static final String UPDATE_INVENTORY_CUSTOMER_FOR_AMS_MAPPING = "UPDATE Inventory inventory SET" + " inventory.customer.id = :" + DataAccessConstants.PARAM_CUSTOMER_ID + " ,inventory.lastUpdateUserId = :" + DataAccessConstants.PARAM_USER_ID + " where inventory.amsConsignorName = :" + DataAccessConstants.PARAM_AMS_CONSIGNOR_NAME + " and inventory.amsConsignorOrgCd = :" + DataAccessConstants.PARAM_AMS_CONSIGNOR_ORG_CD + " and inventory.amsConsignorTypeName = :" + DataAccessConstants.PARAM_AMS_CONSIGNOR_TYPE + " and inventory.status.code in (:" + DataAccessConstants.PARAM_STATUS + ")"; but it is seeing the following: update ATL_INVENTORY, set CONSIGNOR_ID=?, LAST_UPDATE_USER_ID=? where AMS_CONSIGNOR_NAME=? and AMS_CONSIGNOR_ORG_CD=? and AMS_CONSIGNOR_TYPE_NAME=? and (CODE in (? , ? , ? , ?)) Any ideal as to why there is a comma after the table name?

  Read the article

• Word Wrap in Vim (preserving indentation)

  - by sixtyfootersdude

  I was just looking at this post which describes how to wrap entire words in vim. The accepted solution was this: :set formatoptions=l :set lbr Which takes this text (tabs are shown as \t): *Inside of window *Outside of window |---------------------------------------| |\t\tthis is a like of text that will wr|ap here |\t\tcan you see the wrap | | | |---------------------------------------| This accomplishes a behavior like this (tabs are shown as \t): *Inside of window *Outside of window |---------------------------------------| |\t\tthis is a like of text that will | |wrap here | |\t\tcan you see the wrap | | | |---------------------------------------| I would however like to redefine this function. I would like the wrapped line to have the same number of tabs in front of it that the line above has plus one. Ie: *Inside of window *Outside of window |---------------------------------------| |\t\tthis is a like of text that will | |\t\t\twrap here | |\t\tcan you see the wrap | | | |---------------------------------------| Any ideas?

  Read the article

• Defautlt Contoller in CodeIgniter

  - by gregavola

  Hello everyone, I am wondering if there is any other configuration options for a default controller. For example - if I have a controller called "site" and I set the default controller in the following file: application/config/routes.php to: $route['default_controller'] = "site"; I should be able to go to http://localhost and that brings up the index(); function in the site controller. However, if I try to do go to http://localhost/index.php/index2 to load the index2(); function I get a 404 error. If i change the URL to http://localhost/index.php/site/index2 it works fine - but I thought already set the default controller. Is there any way around this? Any thoughts?

  Read the article

• GWT - Retrieve size of a widget that is not displayed

  - by Garagos

  I need to set the size of an absolutePanel regarding to its child size, but the getOffset* methods return 0 because (i think) the child as not been displayed yet. A Quick example: AbsolutePanel aPanel = new AbsolutePanel(); HTML text = new HTML(/*variable lenght text*/); int xPosition = 20; // actually variable aPanel.add(text, xPosition, 0); aPanel.setSize(xPosition + text .getOffsetWidth() + "px", "50px"); // 20px 50px I could also solve my problem by using the AbsolutePanel size to set the child position and size: AbsolutePanel aPanel = new AbsolutePanel(); aPanel.setSize("100%", "50px"); HTML text = new HTML(/*variable lenght text*/); int xPosition = aPanel.getOffsetWidth() / 3; // Once again, getOffsetWidth() returns 0; aPanel.add(text, xPosition, 0); In both case, i have to find a way to either: retrieve the size of a widget that has not been displayed be notified when a widget is displayed

  Read the article

• User control event or method override where custom properties are valid?

  - by Curtis White

  I have an ASP.NET user control that is used in another use control. The parent user control uses data-binding to bind to a custom property of the child user control. What method can I override or page event where I am ensured that the property state is set? I think in a page it is PageLoaded versus the Page_Load override? I am looking for this in the user control because my property is always null even though it is set. Thanks.

  Read the article

• Deserialize Xml with empty elements in C#

  - by user204086

  Trying to deserialize some xml snippits into objects. The problem is that I'm getting an invalid format on every empy element tag. I can deserialize the object no problem when all of the elements have values. Or the empty elements are ommitted. Xml Snippit: <foo><propOne>1</propOne><propTwo /></foo> C# Class: [Serialilbe()] public class foo { public foo(){} [XmlElementAttribute(IsNullable = true)] public int? propOne {get;set;} [XmlElementAttribute(IsNullable = true)] public int? propTwo {get;set;} } Is there a setting on the class I can make to adjust the parsing? or Is there an easy way I can apply xsl to remove these elements? or Should I use regEx to remove the empty elements be fore desrializing? or an even better way?

  Read the article

• variables in batch scripts

  - by richzilla

  I'm trying to set up a batch file to automatically deploy a php app to a web server. Basically, what I want is an entirely automated process: I would just give it a revision number from the repository and it would then export the files, upload via ftp and then update deployment info at the repo host (codebase). However, I'm starting from scratch here. How would I set up a batch file to accept a variable when it was run? For example, the command myfile.bat /revision 42 should deploy revision 42 to my server. If anyone can point me in the right direction I'd appreciate it.

  Read the article

• Memory leak in Mozilla when unloading stylesheets

  - by KaptajnKold

  I'm working with Mozilla v1.7.12 on a constrained device (a Motorola set-top box) trying to resolve some memory leaks. When I dynamically load a stylesheet which refers to some large images, I can see that the amount of consumed memory increases in correspondance with the size of the images. This is what I would expect. Then, when I remove the stylesheet from the DOM, I would expect the memory to be freed. However, this does not happen. This is a problem, because the web application I'm working on needs to be able to dynamically load and and unload stylesheets potentially many times in the lifetime of the page. My question therefore is this: Is what I'm seeing expected behavior or is it a known bug? Is there a way to work around this? I should point out that I've set the expires header to -1 on all the images in the stylesheet.

  Read the article

< Previous Page | 909 910 911 912 913 914 915 916 917 918 919 920  | Next Page >