Search Results

Search found 33140 results on 1326 pages for 'skip list'.

Page 916/1326 | < Previous Page | 912 913 914 915 916 917 918 919 920 921 922 923  | Next Page >

  • Switching from LinqToXYZ to LinqToObjects

    - by spender
    In answering this question, it got me thinking... I often use this pattern: collectionofsomestuff //here it's LinqToEntities .Select(something=>new{something.Name,something.SomeGuid}) .ToArray() //From here on it's LinqToObjects .Select(s=>new SelectListItem() { Text = s.Name, Value = s.SomeGuid.ToString(), Selected = false }) Perhaps I'd split it over a couple of lines, but essentially, at the ToArray point, I'm effectively enumerating my query and storing the resulting sequence so that I can further process it with all the goodness of a full CLR to hand. As I have no interest in any kind of manipulation of the intermediate list, I use ToArray over ToList as there's less overhead. I do this all the time, but I wonder if there is a better pattern for this kind of problem?

    Read the article

  • ICC vs GCC - Optimization and CPU architecture

    - by Rayne
    Hi all, I'm interested in knowing how GCC differs from Intel's ICC in terms of the optimization levels and catering to specific processor architecture. I'm using GCC 4.1.2 20070626 and ICC v11.1 for Linux. How does ICC's optimization levels (O1 to O3) differ from GCC, if they differ at all? The ICC is able to cater specifically to different architectures (IA-32, intel64 and IA-64). I've read that GCC has the -march compiler option which I think is similar, but I can't find a list of the options to use. I'm using Intel Xeon X5570, which is 64-bit. Are there any other GCC compiler options I could use that would cater my applications for 64-bit Intel CPUs? Thank you. Regards, Rayne

    Read the article

  • AJAX: how to get progress feedback in web apps, and to avoid timeouts on long requests?

    - by David Dombrowsky
    This is a general design question about how to make a web application that will receive a large amount of uploaded data, process it, and return a result, all without the dreaded spinning beach-ball for 5 minutes or a possible HTTP timeout. Here's the requirements: make a web form where you can upload a CSV file containing a list of URLs when the user clicks "submit", the server fetches the file, and checks each URL to see if its alive, and what the title tag of the page is. the result is a downloadable CSV file containing the URL, and the result HTTP code the input CSV can be very large ( 100000 rows), so the fetch process might take 5-30 minutes. My solution so far is to have a spinning javascript loop on the client site, which queries the server every second to determine the overall progress of the job. This seems kludgy to me, and I'm hesitant to accept this as the best solution. I'm using perl, template toolkit, and jquery, but any solution using any web technology would be acceptable.

    Read the article

  • SugarCRM - how to make users see only child users?

    - by John
    Hello, I want to change the behaviour of Sugar CRM community version. Here's what sugar currently does: 1) Admin logs into Sugar. 2) Admin clicks on Admin tab. 3) Admin creates a new user named George with admin access 4) Under user information section, Admin makes George report to Admin (in the database, it will show users.report_to_id is the admin's user_id) 5) Admin saves and logs out 6) George logs in with his password 7) George goes to admin tab. 8) George goes to list users page and sees all users, including Admin, the person he is supposed to report to. I want to change step 8 such that George is not allowed to see the user he reports to. Additionally, he is not allowed to see his grand parent user, great grand parent user, great great grand parent user etc... George should only be able to see users that he creates. How can I achieve this? Is this even possible?

    Read the article

  • C# "Enum" Serialization - Deserialization to Static Instance

    - by Walt W
    Suppose you have the following class: class Test : ISerializable { public static Test Instance1 = new Test { Value1 = "Hello" ,Value2 = 86 }; public static Test Instance2 = new Test { Value1 = "World" ,Value2 = 26 }; public String Value1 { get; private set; } public int Value2 { get; private set; } public void GetObjectData(SerializationInfo info, StreamingContext context) { //Serialize an indicator of which instance we are - Currently //I am using the FieldInfo for the static reference. } } I was wondering if it is possible / elegant to deserialize to the static instances of the class? Since the deserialization routines (I'm using BinaryFormatter, though I'd imagine others would be similar) look for a constructor with the same argument list as GetObjectData(), it seems like this can't be done directly . . Which I would presume means that the most elegant solution would be to actually use an enum, and then provide some sort of translation mechanism for turning an enum value into an instance reference. How might one go about this?

    Read the article

  • append a numpy array to a numpy array

    - by Fraz
    I just started programming in python and am very new to numpy packages.. so still trying to get a hang of it. I have a an numpy_array so something like [ a b c] And then I want to append it into anotehr numpyarray (Just like we create a list of lists) How do we create an array of numpy arrays containing numpy arrays I tried to do the following without any luck >>> M = np.array([]) >>> M array([], dtype=float64) >>> M.append(a,axis=0) Traceback (most recent call last): File "<stdin>", line 1, in <module> AttributeError: 'numpy.ndarray' object has no attribute 'append' >>> a array([1, 2, 3])

    Read the article

  • Diagramming in Silverlight MVVM- connecting shapes

    - by silverfighter
    Hi, have I have a quesition regarding MVVM pattern in the uses case of diagramming. What I have so far is a list of Items which are my Shapes. ObservableCollection<ItemsViewModels> Items; and a Collection of Connection of Items ObservableCollection<ConnectionViewModel> Each ItemViewModel has an ID and a ConnectionViewModel has two ID to connect the Items. My ItemsViewModel Collection is bound to a itemscontrol which is layout on a Canvas. With the ElementMouseDragBehavior I am able to drag my Items around. Now comes my big question =) How can I visualize my connections that I will be able to move the items around and the items stay connected with a line either straign or bezier. I don't know how to abstract that with the mvvm pattern. Thanks for any help...

    Read the article

  • Python-daemon doesn't kill its kids

    - by Brian M. Hunt
    When using python-daemon, I'm creating subprocesses likeso: import multiprocessing class Worker(multiprocessing.Process): def __init__(self, queue): self.queue = queue # we wait for things from this in Worker.run() ... q = multiprocessing.Queue() with daemon.DaemonContext(): for i in xrange(3): Worker(q) while True: # let the Workers do their thing q.put(_something_we_wait_for()) When I kill the parent daemonic process (i.e. not a Worker) with a Ctrl-C or SIGTERM, etc., the children don't die. How does one kill the kids? My first thought is to use atexit to kill all the workers, likeso: with daemon.DaemonContext(): workers = list() for i in xrange(3): workers.append(Worker(q)) @atexit.register def kill_the_children(): for w in workers: w.terminate() while True: # let the Workers do their thing q.put(_something_we_wait_for()) However, the children of daemons are tricky things to handle, and I'd be obliged for thoughts and input on how this ought to be done. Thank you.

    Read the article

  • ActionScript rotated sprite's startDrag bounds

    - by TheDarkIn1978
    when assigning a bounds to a draggable sprite, it doesn't seem to take rotation of the sprite into consideration. the code below adds a sprite to the display list, rotates it 45º, and adds a MouseEvent.MOUSE_DOWN event to allow dragging. the startDrag() method's second parameter simply returns the bounds of the stage as a rectangle. however, because of the sprite's rotation, its corners can be dragged past the bounds of the stage. any thoughts? var mySprite:Sprite = new Sprite(); mySprite.graphics.beginFill(0x0000FF, 1); mySprite.graphics.drawRect(0, 0, 200, 200); mySprite.graphics.endFill(); mySprite.rotation = 45; addChild(mySprite); mySprite.addEventListener(MouseEvent.MOUSE_DOWN, dragSprite, false, 0, true); function dragSprite(evt:MouseEvent):void { evt.target.startDrag(false, spriteBounds()); }

    Read the article

  • Hide header and footer when printing from Internet Explorer using Javascript or CSS

    - by molasses
    When I print a webpage from Internet Explorer it will automatically add a header and footer including the website title, URL, date, and page number. Is it possible to hide the header and footer programatically using Javascript or CSS? Requirements: works in IE 6 (no other browser support necessary as its for an Intranet) may use ActiveX, Java Applet, Javascript, CSS preferably not something that the user needs to install (eg. http://www.meadroid.com/scriptx). feel free to list other third party available plug-ins though as I think this may be the only option don't require the user to manually update their browser settings don't render the pages as PDF or Word document or any other format don't write to the registry (security prevents this) Thanks

    Read the article

  • Detect Installed Application URI Handler on Webkit browsers

    - by Punit Raizada
    Guys, I have a question mainly related to the Iphone web browser but I am hoping the same solution would work on other browsers that are webkit based. I have a application (Iphone + Android) that registers a handler for custom URI (appuri://) on the Phone. I am able to launch the application by making a link to "appuri://act/launch" from my web pages. This works only if my application is installed on the device. If the device does not have the app installed then a message comes up "Safari was not able to open ....". What I want to do is detect if the URI Scheme is supported from the browser and then prompt my own message saying "please download the app ..blah blah blah" if the handler for the URI scheme is not found. Is there a way I can detect or find the list of URL Scheme handlers on the Phone from the Web Browser ?

    Read the article

  • Asp.net RenderControl method not rendering autopostback for dropdownlist

    - by Tanya
    Hi all, i am bit confused as to why asp.net does not render a dropdownlist with the autopostback property set to true when using the RenderControl method. eg Dim sw As New IO.StringWriter Dim tw As New HtmlTextWriter(sw) Dim table As New Table table.Rows.Add(New TableRow) Dim tr As TableRow = table.Rows(0) tr.Cells.Add(New TableCell) Dim tc As TableCell = tr.Cells(0) Dim ddlMyValues As New DropDownList ddlMyValues.ID = "ddl1" ddlMyValues.Items.Add("Test1") ddlMyValues.Items.Add("Test2") ddlMyValues.Items.Add("Test3") ddlMyValues.AutoPostBack = True tc.Controls.Add(ddlMyValues) table.RenderControl(tw) Debug.WriteLine(sw.ToString) my output renders the dropdown list without the onchange="javascript:setTimeout('__doPostBack(\ddl1\',\'\')', 0)" that is generated by asp.net when using the dropdownlist normally. Is there a work around to this?

    Read the article

  • Edit, select value from UITableView on the iPhone

    - by Anthony D
    I have a UITableView with a list of names, representing server configurations. I want the user to be able to select a server configuration, add a server config, edit a server config, or just cancel out of the view and return to the main view. I'm having a hard time trying to figure out how to achieve all of that functionality in this view. To select, the user should be able to just tap the server config name and a check will appear next to the name then the user is taken back to the main view automatically (or use a save button instead?). To edit the server config, I would also like the user to be able to tap the server config name and be taken to a detail screen where changes can be made. How can I accomplish both since I want both to be done by tapping the server name (row)? Right now the cancel button seems out of place since the screen is accessed via a UINavigationController. Any suggestions?

    Read the article

  • Asp.net override Membership settings at runtime (asp.net mvc)

    - by minal
    I had an application that hooked onto 1 single database. The app now needs to hook into multiple databases. What we want to do is, using the same application/domain/hostname/virtual dir give the user the option on the login screen to select the "App/Database" they want to connect into. Each database has the App tables/data/procs/etc as well as the aspnet membership/roles stuff. When the user enters the username/password and selects (select list) the application, I want to validate the user against the selected applications database. Presently the database connection string for membership services is saved in the web.config. Is there any way I can override this at login time? Also, I need the "remember me" function to work smoothly as well. How does this work when the user comes back to the app in 5 hours... This process should be able to identify the user and application and log in appropriately.

    Read the article

  • Which programming languages aren't considered high-level?

    - by hilo
    In informatics theory I hear and read about high-level and low-level languages all time. Yet I don't understand why this is still relevant as there aren't any (relevant) low-level languages except assembler in use today. So you get: Low-level Assembler Definitely not low-level C BASIC FORTRAN COBOL ... High-level C++ Ruby Python PHP ... And if assembler is low-level, how could you put for example C into the same list. I mean: C is extremely high-level compared to assembler. Same even for COBOL, Fortran, etc. So why does everybody keep mentioning high and low-level languages if assembler is really the only low-level language.

    Read the article

  • SharePoint SPListItem.ContentType.Name - "Message" vs "Discussion" ?

    - by Christopher
    I am writing a C# code to find all of our SharePoint Sites that have emails contained in the Email List page. It appears that some of our email messages are SPListItem.ContentType.Name = "Message" and some of our email messages are SPListItem.ContentType.Name = "Discussion" Aside from the confusion, this is forcing my to cycle through mylist.Folders and mylist.Items in two separate loops, so that I don't miss any of the emails. Is this normal? Any idea why this could be happening? There are threads that contains messages of both types.

    Read the article

  • The Zen of Python distils the guiding principles for Python into 20 aphorisms but lists only 19. What's the twentieth?

    - by Jeff Walden
    From PEP 20, The Zen of Python: Long time Pythoneer Tim Peters succinctly channels the BDFL's guiding principles for Python's design into 20 aphorisms, only 19 of which have been written down. What is this twentieth aphorism? Does it exist, or is the reference merely a rhetorical device to make the reader think? (One potential answer that occurs to me is that "You aren't going to need it" is the remaining aphorism. If that were the case, it would both exist and act to make the reader think, and it would be characteristically playful, thus fitting the list all the better. But web searches suggest this to be an extreme programming mantra, not intrinsically Pythonic wisdom, so I'm stumped.)

    Read the article

  • Why do I lose my javascript from the browser cache after a full page postback?

    - by burak ozdogan
    Hi, I have an external javascript file which I include to my page on the code behind (as seen below). My problem is, when I my page makes a postback (not partial one), I check the loaded scripts by using FireBug, and I cannot see the javascript file in the list after the post back. I asusmed once it is included to page on the first load, browser will be caching it so that I do not need to re-include it. What am I doing wrong? The way I include the script is here: protected override void OnInit(EventArgs e) { if (this.Page.IsPostBack==false) { if (this.Page.ClientScript.IsClientScriptIncludeRegistered("ctlPalletDetail")==false) { string guidParamToHackBrowserCaching = System.Guid.NewGuid().ToString(); this.Page.ClientScript.RegisterClientScriptInclude("ctlPalletDetail", ResolveUrl(String.Format("~/clientScripts/ctlLtlRequestDetail.js?par={0}",guidParamToHackBrowserCaching))); } } base.OnInit(e); }

    Read the article

  • Maintaining both sides of self-referential many-to-many relationship in Grails domain object

    - by Ali G
    I'm having some problems getting a many-to-many relationship working in grails. Is there anything obviously wrong with the following: class Person { static hasMany = [friends: Person] static mappedBy = [friends: 'friends'] String name List friends = [] String toString() { return this.name } } class BootStrap { def init = { servletContext -> Person bob = new Person(name: 'bob').save() Person jaq = new Person(name: 'jaq').save() jaq.friends << bob println "Bob's friends: ${bob.friends}" println "Jaq's friends: ${jaq.friends}" } } I'd expect Bob to be friends with Jaq and vice-versa, but I get the following output at startup: Running Grails application.. Bob's friends: [] Jaq's friends: [Bob] (I'm using Grails 1.2.0)

    Read the article

  • String search and write into file in jython

    - by kdev
    hi Everyone , i wish to write a program that can read a file and if a particular str_to_find is found in a bigger string say AACATGCCACCTGAATTGGATGGAATTCATGCGGGACACGCGGATTACACCTATGAGCAGAAATACGGCCTGCGCGATTACCGTGGCGGTGGACGTTCTTCCGCGCGTGAAACCGCGATGCGCGTAGCGGCAGGGGCGATCGCCAAGAAATACCTGGCGGAAAAGTTCGGCATCGAAATCCGCGGCTGCCTGACCCAGATGGGCGACATTCCGCTGGAGATTAAAGACTGGCGTCAGGTTGAGCTTAATCCGTTTTC then write that line and the above line of it into the file and keep repeating it for all the match found. Please suggest i have written the program for printing that particular search line but i dont know how to write the above line. Thanks everyone for your help. import re import string file=open('C:/Users/Administrator/Desktop/input.txt','r') output=open('C:/Users/Administrator/Desktop/output.txt','w') count_record=file.readline() str_to_find='AACCATGC' while count_record: if string.find(list,str_to_find) ==0: output.write(count_record) file.close() output.close()

    Read the article

  • Using LLBL as Model in MVC

    - by Quentin J S
    I have settled on trying to use ASP.NET MVC but the first part I want to replace is the Model. I am using LLBL Pro for the model. I have a table called "Groups" that is a simple look up table. I want to take thhe results of the table and populate a list in MVC. Something that should be very simple... or so I thought.... I've tried all kinds of things as I was getting errors like: The model item passed into the dictionary is of type 'System.Collections.Generic.List1[glossary.EntityClasses.GroupEntity]', but this dictionary requires a model item of type 'System.Collections.Generic.IEnumerable1[glossary.CollectionClasses.GroupCollection]'. private GroupCollection gc = new GroupCollection(); public ActionResult Index() { gc.GetMulti(null); return View( gc.?????? ); } This is all I am trying to do, I've tried lots of variations, but my goal is simply to take the data and display it.

    Read the article

  • Visual Studio / Visual Source Safe / Integrated Security / IIS 7

    - by Jason
    Using Visual Source Safe with IIS integration (the working dir is the IIS site) Visual Studio, pointed to the IIS site would load up the Web project. It would be under VSS control (have to check out files, etc). Recently, we had to switch to Integrated Security for our database connections from the web app. This means changing the impersonation of the IIS app pool (and anon authentication) to the impersonated account. Since I did this -- my project loads in Visual Studio, but it acts as if I'm not me, and the files aren't under source control anymore. I'm going to assume it's something with the pass-through from IIS to the VSS (as if you'll remember you had to add IIS_USERS to the VSS list of users). Even trying to add the impersonated account didn't work. Any ideas?

    Read the article

  • RadGrid cannot pass sortExpression to ObjectDataSourceControl

    - by Jeff
    I have a Telerik RadGrid that bound to a datasource object. They are configured to support custom paging, sorting. For paging, only the data of a page is retrieved from the database. Before sorting, it works fine. The select method of the datasource is like public List<xxx> Select(string sortExpression, int maximumRows, int startRowIndex) {} Before sorting the sortExpression is empty, which is expected. But after use click sort, in the OnSortCommand event handler of Radgrid, the SortExpression is correct, indicating RadGrid has caputre user's sorting correctly. protected void OnSort(object source, GridSortCommandEventArgs e) { Console.WriteLine(e.SortExpression); // correct } But what is strange is that the RadGrid does not pass parameter to DataSource correctly this time. sortExpression is still empty, maximumRows became int.Max, and startRowIndex is 0. The the sorting in still render correctly, but grid ask datasource to get all data and do the sorting locally. Is this bug of RadGrid or my configuration is wrong?

    Read the article

  • Rails migration to add boolean column to Postgres on Heroku

    - by pmc255
    I'm trying to execute a simple Rails migration to add a boolean column to an existing table. Here's the add_column call: add_column :users, :soliciting, :boolean, :null => false, :default => false However, after the migration runs (successfully, with no errors), I don't see the new column. If I go into the console and list the columns on the User table, for example, with this command: >> User.columns.each { |c| puts "#{c.name} : #{c.type}" } All the other columns show up, but not the one I just added with the migration. What's even more strange is that looking up a random user object yields the Postgres version of booleans (Ruby strings) >> User.find(1).soliciting => "t" However, the existing boolean columns all show up with standard Ruby boolean values of true and false. What's going on here? Is the migration actually complete? Why doesn't the column show up, yet is accessible in the model objects?

    Read the article

< Previous Page | 912 913 914 915 916 917 918 919 920 921 922 923  | Next Page >