Search Results

Search found 8975 results on 359 pages for 'element'.

Page 92/359 | < Previous Page | 88 89 90 91 92 93 94 95 96 97 98 99  | Next Page >

  • How to extract block of XML from a log file on Linux

    - by dragonmantank
    I have a log file that looks like the following: 2010-05-12 12:23:45 Some sort of log entry 2010-05-12 01:45:12 Request XML: <RootTag> <Element>Value</Element> <Element>Another Value</Element> </RootTag> 2010-05-12 01:45:32 Response XML: <ResponseRoot> <Element>Value</Element> </ResponseRoot> 2010-05-12 01:45:49 Another log entry What I want to do is extract the Request and Response XML (and ultimately dump them into their own single files). I had a similar parser that used egrep but the XML was all on one line, not multiple ones like above. The log files are also somewhat large, hitting 500-600 megs a log. Smaller logs I would read in via a PHP script and use regex matching, but the amount of memory required for such a large file would more than likely kill the script. Is there an easy way using the built-in tools on a Linux box (CentOS in this case) to extract multiple lines or am I going to have to bite the bullet and use Perl or PHP to read in the entire file to extract it?

    Read the article

  • myXmlDataDoc.DataSet.ReadXml problem

    - by alex
    Hi: I am using myXmlDataDoc.DataSet.ReadXml(xml_file_name, XmlReadMode.InferSchema); to populate the tables within the dataset created by reading in a xml schema using: myStreamReader = new StreamReader(xsd_file_name); myXmlDataDoc.DataSet.ReadXmlSchema(myStreamReader); The problems I am facing is when it comes to read the xml tag: The readXml function puts the element in a different table and everything in the tables are 0s. Here is the print out of the datatable: TableName: test_data 100 2 1 TableName: parameters 1 0 2 0 3 0 4 0 5 0 6 0 7 0 8 0 9 0 10 0 11 0 12 0 In my xsd file, I represent an array using this: <xs:element name="test_data"> <xs:complexType> <xs:complexContent> <xs:extension base="test_base"> <xs:sequence> <xs:element name="a" type="xs:unsignedShort"/> <xs:element name="b" type="xs:unsignedShort"/> <xs:element name="c" type="xs:unsignedInt"/> <xs:element name="parameters" minOccurs="0" maxOccurs="12" type="xs:unsignedInt"/> </xs:sequence> </xs:extension> </xs:complexContent> </xs:complexType> And here is my xml file: 100 2 1 1 2 3 4 5 6 7 8 9 10 11 12 I am expecting after the readXml function call, the "parameters" is part of the test_data table. TableName: test_data 100 2 1 1 2 3 4 5 6 7 8 9 10 11 12 Does anyone knows what's wrong? Thanks

    Read the article

  • wpf treeview does not show child objects

    - by gangt
    I have an object with child object(s) and I load it using linq. And I assign it to a treeView's itemssource. treeView.DisplayMemberPath = "Name"; treeView.ItemsSource = tasks; It shows only the parent nodes (task.name), I couldn't figure out how to add children (TaskItems.name). All the examples show HierarchicalData in xaml. I need to do it in code-behind, just like the above code. Is it possible? public class Task { public int Id; public string Name; public bool IsActive; public List<TaskItem> TaskItems = new List<TaskItem>(); } public class TaskItem { public int TaskId; public string Name; public string Value; } -------------- var tasks1 = from t in xd.Descendants("taskheader") select new Task { Id = (int)t.Element("id"), Name = t.Element("name").Value, IsActive = t.Element("isactive").Value == "1", TaskItems = t.Elements("taskdetail").Select(e => new TaskItem { TaskId = (int)e.Element("taskid"), Name = (string)e.Element("name"), Value = (string)e.Element("value"), }).ToList() }; -------------- List<Task> tasks = new List<Task>(); tasks = tasks1;

    Read the article

  • UITableViewCell checkmarks

    - by burki
    Hi! When you select a cell in the UITableView, the - (void)tableView:(UITableView *)table didSelectRowAtIndexPath:(NSIndexPath *)indexPath is called. There some of the NSManagedObjects will be updated with the right values and the row will be deselected. Well, it works all right, but you can't see any selection of the tableviewcell. I found out that the access on core data causes the problem, that means, if i comment out the lines with the commands of updating the NSManagedObjects, it all works like I want, with a smooth selection and deselection. Can anybody help? Thanks. - (void)tableView:(UITableView *)table didSelectRowAtIndexPath:(NSIndexPath *)indexPath { //[table deselectRowAtIndexPath:indexPath animated:YES]; NSMutableSet *favoriteGroups = [NSMutableSet setWithSet:element.favoriteGroup]; NSMutableSet *elements = [NSMutableSet setWithSet:[(FavoriteGroup *)[fetchedResultsController objectAtIndexPath:indexPath] element]]; UITableViewCell *checkedCell = [table cellForRowAtIndexPath:indexPath]; if (checkedCell.accessoryType == UITableViewCellAccessoryCheckmark) { [elements removeObject:element]; [favoriteGroups removeObject:[fetchedResultsController objectAtIndexPath:indexPath]]; [[table cellForRowAtIndexPath:indexPath] setAccessoryType:UITableViewCellAccessoryNone]; } else { [elements addObject:element]; [favoriteGroups addObject:[fetchedResultsController objectAtIndexPath:indexPath]]; [[table cellForRowAtIndexPath:indexPath] setAccessoryType:UITableViewCellAccessoryCheckmark]; } element.favoriteGroup = favoriteGroups; FavoriteGroup *favoriteGroup = [self.fetchedResultsController objectAtIndexPath:indexPath]; favoriteGroup.element = elements; [self.tableView deselectRowAtIndexPath:indexPath animated:YES]; }

    Read the article

  • If a table has two xml columns, will inserting records be a lot slower?

    - by Lieven Cardoen
    Is it a bad thing to have two xml columns in one table? + How much slower are these xml columns in terms of updating/inserting/reading data? In profiler this kind of insert normally takes 0 ms, but sometimes it goes up to 160ms: declare @p8 xml set @p8=convert(xml,N'<interactions><interaction correct="false" score="0" id="0" gapid="0" x="61" y="225"><feedback/><element id="0" position="0" elementtype="1"><asset/></element></interaction><interaction correct="false" score="0" id="1" gapid="1" x="64" y="250"><feedback/><element id="0" position="0" elementtype="1"><asset/></element></interaction><interaction correct="false" score="0" id="2" gapid="2" x="131" y="250"><feedback/><element id="0" position="0" elementtype="1"><asset/></element></interaction></interactions>') declare @p14 xml set @p14=convert(xml,N'<contentinteractions/>') exec sp_executesql N'INSERT INTO [dbo].[PackageSessionNodes]([dbo].[PackageSessionNodes].[PackageSessionId], [dbo].[PackageSessionNodes].[TreeNodeId],[dbo].[PackageSessionNodes].[Duration], [dbo].[PackageSessionNodes].[Score],[dbo].[PackageSessionNodes].[ScoreMax], [dbo].[PackageSessionNodes].[Interactions],[dbo].[PackageSessionNodes].[BrainTeaser], [dbo].[PackageSessionNodes].[DateCreated], [dbo].[PackageSessionNodes].[CompletionStatus], [dbo].[PackageSessionNodes].[ReducedScore], [dbo].[PackageSessionNodes].[ReducedScoreMax], [dbo].[PackageSessionNodes].[ContentInteractions]) VALUES (@ins_dboPackageSessionNodesPackageSessionId, @ins_dboPackageSessionNodesTreeNodeId, @ins_dboPackageSessionNodesDuration, @ins_dboPackageSessionNodesScore, @ins_dboPackageSessionNodesScoreMax, @ins_dboPackageSessionNodesInteractions, @ins_dboPackageSessionNodesBrainTeaser, @ins_dboPackageSessionNodesDateCreated, @ins_dboPackageSessionNodesCompletionStatus, @ins_dboPackageSessionNodesReducedScore, @ins_dboPackageSessionNodesReducedScoreMax, @ins_dboPackageSessionNodesContentInteractions) ; SELECT SCOPE_IDENTITY() as new_id This is the table: CREATE TABLE [dbo].[PackageSessionNodes]( [PackageSessionNodeId] [int] IDENTITY(1,1) NOT NULL, [PackageSessionId] [int] NOT NULL, [TreeNodeId] [int] NOT NULL, [Duration] [int] NULL, [Score] [float] NOT NULL, [ScoreMax] [float] NOT NULL, [Interactions] [xml] NOT NULL, [BrainTeaser] [bit] NOT NULL, [DateCreated] [datetime] NULL, [CompletionStatus] [int] NOT NULL, [ReducedScore] [float] NOT NULL, [ReducedScoreMax] [float] NOT NULL, [ContentInteractions] [xml] NOT NULL, CONSTRAINT [PK_PackageSessionNodes] PRIMARY KEY CLUSTERED ( [PackageSessionNodeId] ASC )WITH (PAD_INDEX = OFF, STATISTICS_NORECOMPUTE = OFF, IGNORE_DUP_KEY = OFF, ALLOW_ROW_LOCKS = ON, ALLOW_PAGE_LOCKS = ON) ON [PRIMARY] ) ON [PRIMARY] GO ALTER TABLE [dbo].[PackageSessionNodes] WITH CHECK ADD CONSTRAINT [FK_PackageSessionNodes_PackageSessions] FOREIGN KEY([PackageSessionId]) REFERENCES [dbo].[PackageSessions] ([PackageSessionId]) ON UPDATE CASCADE ON DELETE CASCADE GO ALTER TABLE [dbo].[PackageSessionNodes] CHECK CONSTRAINT [FK_PackageSessionNodes_PackageSessions] GO ALTER TABLE [dbo].[PackageSessionNodes] WITH CHECK ADD CONSTRAINT [FK_PackageSessionNodes_TreeNodes] FOREIGN KEY([TreeNodeId]) REFERENCES [dbo].[TreeNodes] ([TreeNodeId]) GO ALTER TABLE [dbo].[PackageSessionNodes] CHECK CONSTRAINT [FK_PackageSessionNodes_TreeNodes] GO ALTER TABLE [dbo].[PackageSessionNodes] ADD CONSTRAINT [DF_PackageSessionNodes_Score] DEFAULT ((-1)) FOR [Score] GO ALTER TABLE [dbo].[PackageSessionNodes] ADD CONSTRAINT [DF_PackageSessionNodes_ScoreMax] DEFAULT ((-1)) FOR [ScoreMax] GO ALTER TABLE [dbo].[PackageSessionNodes] ADD CONSTRAINT [DF_PackageSessionNodes_DateCreated] DEFAULT (getdate()) FOR [DateCreated] GO ALTER TABLE [dbo].[PackageSessionNodes] ADD CONSTRAINT [DF_PackageSessionNodes_ReducedScore] DEFAULT ((-1)) FOR [ReducedScore] GO ALTER TABLE [dbo].[PackageSessionNodes] ADD CONSTRAINT [DF_PackageSessionNodes_ReducedScoreMax] DEFAULT ((-1)) FOR [ReducedScoreMax] GO

    Read the article

  • java: how to parse html-like xml

    - by Yang
    I have an html-like xml, basically it is html. I need to get the elements in each . Each element looks like this: <line tid="744476117"> <attr>1414</attr> <attr>31</attr><attr class="thread_title">title1</attr><attr>author1</attr><attr>date1</attr></line> My code is as below, it does recognize that there are 50 in the file, but it gives me NULLPointException when parsing NodeList fstNmElmntLst = fstElmnt.getElementsByTagName("attr"); Any idea why this is happening? The same code has been used for other applications without problems. DocumentBuilderFactory dbf = DocumentBuilderFactory.newInstance(); DocumentBuilder db = dbf.newDocumentBuilder(); InputSource is = new InputSource(); is.setCharacterStream(new StringReader(cleanxml)); Document doc = db.parse(is); doc.getDocumentElement().normalize(); System.out.println("Root element " + doc.getDocumentElement().getNodeName()); NodeList nodeLst = doc.getElementsByTagName("line"); for (int s = 0; s < nodeLst.getLength(); s++) { System.out.println(nodeLst.getLength()); Node fstNode = nodeLst.item(s); if (fstNode.getNodeType() == Node.ELEMENT_NODE) { Element fstElmnt = (Element) fstNode; NodeList fstNmElmntLst = fstElmnt.getElementsByTagName("attr"); Element fstNmElmnt = (Element) fstNmElmntLst.item(0); NodeList fstNm = fstNmElmnt.getChildNodes(); System.out.println("attr : " + ((Node) fstNm.item(0)).getNodeValue()); } }

    Read the article

  • My UL child label elements disappear in IE on accordion menu opening

    - by Scott B
    I've got an app that's working pretty flawlessly in Chrome and FF, however, when I view it in IE, all is well until I click on a header element to activate it (jQuery accordion). What happens then is that I see a brief flash where the content is there, then suddenly the entire left column disappears. This column is generated by a floated label element with a class of ".left" as seen below... <ul class="menu collapsible"> <li class='expand sectionTitle'><a href='#'>General Settings</a> <ul class='acitem'> <li class="section"> <label class="left">This item if floated left with a defined width of 190px via css. This is the item that's disappearing after a brief display</label> <input class="input" value="input element here" /> <label class="description">This element has a margin-left:212px; set via css in order to be positioned to the right of the label element as if in an adjacent table cell. When I add a max-width property to this element, it disappears in IE too!</label> </li> </ul> </li> </ul> As you can see from the comments in the code above (for the two label elements) the description label disappears once I set a max-width on it. It shows up fine otherwise.

    Read the article

  • Strange offset space between <button> as parent container and <div> as child.

    - by Maxja
    I need to decorate a standard html button. The base element I took <button> instead of <input>, cos I decided that the element must be a parent container. And there is child element <div> in it. This <div> element will be been the core element for decoration, and should occupy the entire space of the parent element - button. <button> <div>*decoration goes here*</div> </button> And within Cascading Style Sheets it might be looks like this: css button { margin: 0; border: 0; padding: 0; width: *150*px; height: *50*px; position: relative; } div { margin: 0; border: 0; padding: 0; width: 100%; height: 100%; background: *black*; position: absolute; top: 0; left: 0; } html <button type="button"> <div>*decoration goes here*</div> </button> So, Opera(10) is doing well, webkits Chrome(6) and Safari(4) is doing also well, but Internet Explorer(8) is bad - DOM Inspector shows some strange Offset space in top and left, FireFox(3) is also bad - DOM Inspector shows that <div> get some negative value in css-property right: and bottom:. Even if this property will set to zero(0) DOM-Inspector still shows same negative value. I almost broke my brain. Help me, solve this problem, please!

    Read the article

  • CakePHP update multiple elements in one div

    - by sw3n
    The idea is that I've 3 ajax links and each link is coupled to one single element (a form). The element will be loaded in one div. Each time when you click on a different link, the element that is requested before must be removed and the new one must come in there. So it has to update the DIV. The problem is, that it request the element, but it does not remove the other one. So when you click one the first link, it shows the first element, click on the second link and it puts the second element beneath them, and with the third one will happen exactly the same. If you clicked all the 3 links, it shows 3 forms right under each other. Some Code: Controller: function view($id) { // content could come from a database, xml, etc. $content = array ( array($this->render(null, 'ajax', '/elements/ga')), array($this->render(null, 'ajax', '/elements/ex')), array($this->render(null, 'ajax', '/elements/both')) ); $this->set('google', $content[$id][0]); // use ajax layout $this->render('/pages/form', 'ajax'); } View code: echo $ajax-link( 'Google', array( 'controller' = 'analytics', 'action' = 'view', 0 ), array( 'update' = 'dynamic1')); echo ' | '; echo $ajax-link( 'Exact', array( 'controller' = 'analytics', 'action' = 'view', 1 ), array( 'update' = 'dynamic1', 'loading' = 'Effect.BlindDownUp(\'dynamic1\')')); echo ' | '; echo $ajax-link( 'Beide', array( 'controller' = 'analytics', 'action' = 'view', 2 ), array( 'update' = 'dynamic1', 'loading' = 'Effect.BlindDown(\'dynamic1\')' )); echo $ajax-div('dynamic1'); echo $google; echo $ajax-divEnd('dynamic1');

    Read the article

  • XSLT Type Checking

    - by mo
    Hi Folks Is it possible to check an elements ComplexType? i have this (simplified): complexType Record complexType Customer extension of Record complexType Person extension of Record <xsl:template match="/"> <records> <xsl:apply-templates /> </records> </xsl:template> <xsl:template match="!!! TYPECHECK FOR RECORD !!!" name="Record"> <record><xsl:value-of select="." /></record> </xsl:template> is it possible to check elementstype incl. inheritence? i dont know the elements name only that they are a subtype of Record. schema 1: complexType name="Customer" extension base="Record" element name="customers" element name="customer" type="Customer" schema 2: complexType name="Person" extension base="Record" element name="persons" element name="person" type="Person" schema ?: complexType name="UnknownType" extension base="Record" element name="unknowns" element name="unknown" type="UnknownType" xml 1: <customers> <customer /> <customer /> </customers> xml 2: <persons> <person /> <person /> </persons> xml ?: <?s> <? /> <? /> </?s> the xml input ist custom so i have to match by the type (i think)

    Read the article

  • What's wrong (or right) with this JS Object Pattern?

    - by unsane1
    Here's an example of the pattern I'm using in my javascript objects these days (this example relies on jQuery). http://pastie.org/private/ryn0m1gnjsxdos9onsyxg It works for me reasonably well, but I'm guessing there's something wrong, or at least sub-optimal about it, I'm just curious to get people's opinions. Here's a smaller, inline example of it: sample = function(attach) { // set internal reference to self var self = this; // public variable(s) self.iAmPublic = true; // private variable(s) var debug = false; var host = attach; var pane = { element: false, display: false } // public function(s) self.show = function() { if (!pane.display) { position(); $(pane.element).show('fast'); pane.display = true; } } self.hide = function() { if (pane.display) { $(pane.element).hide('fast'); pane.display = false; } } // private function(s) function init () { // do whatever stuff is needed on instantiation of this object // like perhaps positioning a hidden div pane.element = document.createElement('div'); return self; } function position() { var h = { 'h': $(host).outerHeight(), 'w': $(host).outerWidth(), 'pos': $(host).offset() }; var p = { 'w': $(pane.element).outerWidth() }; $(pane.element).css({ top: h.pos.top + (h.h-1), left: h.pos.left + ((h.w - p.w) / 2) }); } function log () { if (debug) { console.log(arguments); } } // on-instantiation let's set ourselves up return init(); } I'm really curious to get people's thoughts on this.

    Read the article

  • Outputting array contents as nested list in PHP

    - by Mamadou
    I have the array $tab[1,2,3,4,5,6,7,8,9,10] and I would like to display it like this: <ul> <li> <a href=""/>FIRST ELEMENT OF THE TAB ==> 1</a> <a href=""/>2ND ELEMENT OF THE TAB ==> 2</a> </li> <li> <a href=""/>3THIRD ELEMENT==> 3</a> <a href=""/>FORTH ELEMENT OF THE TAB ==> 4</a> </li> <li> <a href=""/>FIFTH ELEMENT==> 5</a> <a href=""/>SIXTITH ELEMENT OF THE TAB ==> 6</a> </li> </ul> How can I achieve this in PHP? I am thinking of creating a sub array with array_slice.

    Read the article

  • comparision of strings

    - by EmiLazE
    i am writing a program, that simulates game mastermind. but i am struggling on how to compare guessed pattern to key pattern. the game conditions are a little bit changed: patterns consist of letters. if an element of guessed pattern is equal to element of key pattern, and also index is equal, then print b. if an element of guessed pattern is equal to element of key pattern, but index is not, then print w. if an element of guessed pattern is not equal to element of key pattern, print dot. in feedback about guessed pattern, 'b's come first, 'w's second, '.'s last. my problem is that i cannot think of a way totally satisfies the answer. for (i=0; i<patternlength; i++) { for (x=0; x<patternlength; x++) { if (guess[i]==key[x] && i==x) printf("b"); if (guess[i]==key[x] && i!=x) printf("w"); if (guess[i]!=key[x]) printf("."); } }

    Read the article

  • Ubuntu 12.04 LTS installation problem

    - by Zxy
    I am trying to install Ubuntu 12.04 LTS on my PC using WUBI. However, I keep getting this error: An error occured: *Error executing command >>command=C:\\System32\bcdedit.exe /set {2708afc0-9ffa-11e1-bc51-d167219ffa25} device partition=E: >>retval=1 >>stderr=An error has occured setting the element data. The request is not supported. >>stdout= For more information, please see the logfile:* Logfile: 06-11 10:57 DEBUG TaskList: ## Finished choose_disk_sizes 06-11 10:57 DEBUG TaskList: ## Running expand_diskimage... 06-11 10:59 DEBUG TaskList: ## Finished expand_diskimage 06-11 10:59 DEBUG TaskList: ## Running create_swap_diskimage... 06-11 10:59 DEBUG TaskList: ## Finished create_swap_diskimage 06-11 10:59 DEBUG TaskList: ## Running modify_bootloader... 06-11 10:59 DEBUG TaskList: New task modify_bcd 06-11 10:59 DEBUG TaskList: ### Running modify_bcd... 06-11 10:59 DEBUG WindowsBackend: modify_bcd Drive(C: hd 51255.1171875 mb free ntfs) 06-11 10:59 ERROR TaskList: Error executing command >>command=C:\Windows\System32\bcdedit.exe /set {2708afc0-9ffa-11e1-bc51-d167219ffa25} device partition=E: >>retval=1 >>stderr=An error has occurred setting the element data. The request is not supported. >>stdout= Traceback (most recent call last): File "\lib\wubi\backends\common\tasklist.py", line 197, in __call__ File "\lib\wubi\backends\win32\backend.py", line 697, in modify_bcd File "\lib\wubi\backends\common\utils.py", line 66, in run_command Exception: Error executing command >>command=C:\Windows\System32\bcdedit.exe /set {2708afc0-9ffa-11e1-bc51-d167219ffa25} device partition=E: >>retval=1 >>stderr=An error has occurred setting the element data. The request is not supported. >>stdout= 06-11 10:59 DEBUG TaskList: # Cancelling tasklist 06-11 10:59 DEBUG TaskList: New task modify_bcd 06-11 10:59 ERROR root: Error executing command >>command=C:\Windows\System32\bcdedit.exe /set {2708afc0-9ffa-11e1-bc51-d167219ffa25} device partition=E: >>retval=1 >>stderr=An error has occurred setting the element data. The request is not supported. >>stdout= Traceback (most recent call last): File "\lib\wubi\application.py", line 58, in run File "\lib\wubi\application.py", line 132, in select_task File "\lib\wubi\application.py", line 158, in run_installer File "\lib\wubi\backends\common\tasklist.py", line 197, in __call__ File "\lib\wubi\backends\win32\backend.py", line 697, in modify_bcd File "\lib\wubi\backends\common\utils.py", line 66, in run_command Exception: Error executing command >>command=C:\Windows\System32\bcdedit.exe /set {2708afc0-9ffa-11e1-bc51-d167219ffa25} device partition=E: >>retval=1 >>stderr=An error has occurred setting the element data. The request is not supported. >>stdout= 06-11 10:59 DEBUG TaskList: New task modify_bcd 06-11 10:59 DEBUG TaskList: New task modify_bcd 06-11 10:59 DEBUG TaskList: ## Finished modify_bootloader 06-11 10:59 DEBUG TaskList: # Finished tasklist*

    Read the article

  • Using the jQuery UI Library in a MVC 3 Application to Build a Dialog Form

    - by ChrisD
    Using a simulated dialog window is a nice way to handle inline data editing. The jQuery UI has a UI widget for a dialog window that makes it easy to get up and running with it in your application. With the release of ASP.NET MVC 3, Microsoft included the jQuery UI scripts and files in the MVC 3 project templates for Visual Studio. With the release of the MVC 3 Tools Update, Microsoft implemented the inclusion of those with NuGet as packages. That means we can get up and running using the latest version of the jQuery UI with minimal effort. To the code! Another that might interested you about JQuery Mobile and ASP.NET MVC 3 with C#. If you are starting with a new MVC 3 application and have the Tools Update then you are a NuGet update and a <link> and <script> tag away from adding the jQuery UI to your project. If you are using an existing MVC project you can still get the jQuery UI library added to your project via NuGet and then add the link and script tags. Assuming that you have pulled down the latest version (at the time of this publish it was 1.8.13) you can add the following link and script tags to your <head> tag: < link href = "@Url.Content(" ~ / Content / themes / base / jquery . ui . all . css ")" rel = "Stylesheet" type = "text/css" /> < script src = "@Url.Content(" ~ / Scripts / jquery-ui-1 . 8 . 13 . min . js ")" type = "text/javascript" ></ script > The jQuery UI library relies upon the CSS scripts and some image files to handle rendering of its widgets (you can choose a different theme or role your own if you like). Adding these to the stock _Layout.cshtml file results in the following markup: <!DOCTYPE html> < html > < head >     < meta charset = "utf-8" />     < title > @ViewBag.Title </ title >     < link href = "@Url.Content(" ~ / Content / Site . css ")" rel = "stylesheet" type = "text/css" />     <link href="@Url.Content("~/Content/themes/base/jquery.ui.all.css")" rel="Stylesheet" type="text/css" />     <script src="@Url.Content("~/Scripts/jquery-1.5.1.min.js")" type="text/javascript"></script>     <script src="@Url.Content("~/Scripts/modernizr-1.7.min . js ")" type = "text/javascript" ></ script >     < script src = "@Url.Content(" ~ / Scripts / jquery-ui-1 . 8 . 13 . min . js ")" type = "text/javascript" ></ script > </ head > < body >     @RenderBody() </ body > </ html > Our example will involve building a list of notes with an id, title and description. Each note can be edited and new notes can be added. The user will never have to leave the single page of notes to manage the note data. The add and edit forms will be delivered in a jQuery UI dialog widget and the note list content will get reloaded via an AJAX call after each change to the list. To begin, we need to craft a model and a data management class. We will do this so we can simulate data storage and get a feel for the workflow of the user experience. The first class named Note will have properties to represent our data model. namespace Website . Models {     public class Note     {         public int Id { get ; set ; }         public string Title { get ; set ; }         public string Body { get ; set ; }     } } The second class named NoteManager will be used to set up our simulated data storage and provide methods for querying and updating the data. We will take a look at the class content as a whole and then walk through each method after. using System . Collections . ObjectModel ; using System . Linq ; using System . Web ; namespace Website . Models {     public class NoteManager     {         public Collection < Note > Notes         {             get             {                 if ( HttpRuntime . Cache [ "Notes" ] == null )                     this . loadInitialData ();                 return ( Collection < Note >) HttpRuntime . Cache [ "Notes" ];             }         }         private void loadInitialData ()         {             var notes = new Collection < Note >();             notes . Add ( new Note                           {                               Id = 1 ,                               Title = "Set DVR for Sunday" ,                               Body = "Don't forget to record Game of Thrones!"                           });             notes . Add ( new Note                           {                               Id = 2 ,                               Title = "Read MVC article" ,                               Body = "Check out the new iwantmymvc.com post"                           });             notes . Add ( new Note                           {                               Id = 3 ,                               Title = "Pick up kid" ,                               Body = "Daughter out of school at 1:30pm on Thursday. Don't forget!"                           });             notes . Add ( new Note                           {                               Id = 4 ,                               Title = "Paint" ,                               Body = "Finish the 2nd coat in the bathroom"                           });             HttpRuntime . Cache [ "Notes" ] = notes ;         }         public Collection < Note > GetAll ()         {             return Notes ;         }         public Note GetById ( int id )         {             return Notes . Where ( i => i . Id == id ). FirstOrDefault ();         }         public int Save ( Note item )         {             if ( item . Id <= 0 )                 return saveAsNew ( item );             var existingNote = Notes . Where ( i => i . Id == item . Id ). FirstOrDefault ();             existingNote . Title = item . Title ;             existingNote . Body = item . Body ;             return existingNote . Id ;         }         private int saveAsNew ( Note item )         {             item . Id = Notes . Count + 1 ;             Notes . Add ( item );             return item . Id ;         }     } } The class has a property named Notes that is read only and handles instantiating a collection of Note objects in the runtime cache if it doesn't exist, and then returns the collection from the cache. This property is there to give us a simulated storage so that we didn't have to add a full blown database (beyond the scope of this post). The private method loadInitialData handles pre-filling the collection of Note objects with some initial data and stuffs them into the cache. Both of these chunks of code would be refactored out with a move to a real means of data storage. The GetAll and GetById methods access our simulated data storage to return all of our notes or a specific note by id. The Save method takes in a Note object, checks to see if it has an Id less than or equal to zero (we assume that an Id that is not greater than zero represents a note that is new) and if so, calls the private method saveAsNew . If the Note item sent in has an Id , the code finds that Note in the simulated storage, updates the Title and Description , and returns the Id value. The saveAsNew method sets the Id , adds it to the simulated storage, and returns the Id value. The increment of the Id is simulated here by getting the current count of the note collection and adding 1 to it. The setting of the Id is the only other chunk of code that would be refactored out when moving to a different data storage approach. With our model and data manager code in place we can turn our attention to the controller and views. We can do all of our work in a single controller. If we use a HomeController , we can add an action method named Index that will return our main view. An action method named List will get all of our Note objects from our manager and return a partial view. We will use some jQuery to make an AJAX call to that action method and update our main view with the partial view content returned. Since the jQuery AJAX call will cache the call to the content in Internet Explorer by default (a setting in jQuery), we will decorate the List, Create and Edit action methods with the OutputCache attribute and a duration of 0. This will send the no-cache flag back in the header of the content to the browser and jQuery will pick that up and not cache the AJAX call. The Create action method instantiates a new Note model object and returns a partial view, specifying the NoteForm.cshtml view file and passing in the model. The NoteForm view is used for the add and edit functionality. The Edit action method takes in the Id of the note to be edited, loads the Note model object based on that Id , and does the same return of the partial view as the Create method. The Save method takes in the posted Note object and sends it to the manager to save. It is decorated with the HttpPost attribute to ensure that it will only be available via a POST. It returns a Json object with a property named Success that can be used by the UX to verify everything went well (we won't use that in our example). Both the add and edit actions in the UX will post to the Save action method, allowing us to reduce the amount of unique jQuery we need to write in our view. The contents of the HomeController.cs file: using System . Web . Mvc ; using Website . Models ; namespace Website . Controllers {     public class HomeController : Controller     {         public ActionResult Index ()         {             return View ();         }         [ OutputCache ( Duration = 0 )]         public ActionResult List ()         {             var manager = new NoteManager ();             var model = manager . GetAll ();             return PartialView ( model );         }         [ OutputCache ( Duration = 0 )]         public ActionResult Create ()         {             var model = new Note ();             return PartialView ( "NoteForm" , model );         }         [ OutputCache ( Duration = 0 )]         public ActionResult Edit ( int id )         {             var manager = new NoteManager ();             var model = manager . GetById ( id );             return PartialView ( "NoteForm" , model );         }         [ HttpPost ]         public JsonResult Save ( Note note )         {             var manager = new NoteManager ();             var noteId = manager . Save ( note );             return Json ( new { Success = noteId > 0 });         }     } } The view for the note form, NoteForm.cshtml , looks like so: @model Website . Models . Note @using ( Html . BeginForm ( "Save" , "Home" , FormMethod . Post , new { id = "NoteForm" })) { @Html . Hidden ( "Id" ) < label class = "Title" >     < span > Title < /span><br / >     @Html . TextBox ( "Title" ) < /label> <label class="Body">     <span>Body</ span >< br />     @Html . TextArea ( "Body" ) < /label> } It is a strongly typed view for our Note model class. We give the <form> element an id attribute so that we can reference it via jQuery. The <label> and <span> tags give our UX some structure that we can style with some CSS. The List.cshtml view is used to render out a <ul> element with all of our notes. @model IEnumerable < Website . Models . Note > < ul class = "NotesList" >     @foreach ( var note in Model )     {     < li >         @note . Title < br />         @note . Body < br />         < span class = "EditLink ButtonLink" noteid = "@note.Id" > Edit < /span>     </ li >     } < /ul> This view is strongly typed as well. It includes a <span> tag that we will use as an edit button. We add a custom attribute named noteid to the <span> tag that we can use in our jQuery to identify the Id of the note object we want to edit. The view, Index.cshtml , contains a bit of html block structure and all of our jQuery logic code. @ {     ViewBag . Title = "Index" ; } < h2 > Notes < /h2> <div id="NoteListBlock"></ div > < span class = "AddLink ButtonLink" > Add New Note < /span> <div id="NoteDialog" title="" class="Hidden"></ div > < script type = "text/javascript" >     $ ( function () {         $ ( "#NoteDialog" ). dialog ({             autoOpen : false , width : 400 , height : 330 , modal : true ,             buttons : {                 "Save" : function () {                     $ . post ( "/Home/Save" ,                         $ ( "#NoteForm" ). serialize (),                         function () {                             $ ( "#NoteDialog" ). dialog ( "close" );                             LoadList ();                         });                 },                 Cancel : function () { $ ( this ). dialog ( "close" ); }             }         });         $ ( ".EditLink" ). live ( "click" , function () {             var id = $ ( this ). attr ( "noteid" );             $ ( "#NoteDialog" ). html ( "" )                 . dialog ( "option" , "title" , "Edit Note" )                 . load ( "/Home/Edit/" + id , function () { $ ( "#NoteDialog" ). dialog ( "open" ); });         });         $ ( ".AddLink" ). click ( function () {             $ ( "#NoteDialog" ). html ( "" )                 . dialog ( "option" , "title" , "Add Note" )                 . load ( "/Home/Create" , function () { $ ( "#NoteDialog" ). dialog ( "open" ); });         });         LoadList ();     });     function LoadList () {         $ ( "#NoteListBlock" ). load ( "/Home/List" );     } < /script> The <div> tag with the id attribute of "NoteListBlock" is used as a container target for the load of the partial view content of our List action method. It starts out empty and will get loaded with content via jQuery once the DOM is loaded. The <div> tag with the id attribute of "NoteDialog" is the element for our dialog widget. The jQuery UI library will use the title attribute for the text in the dialog widget top header bar. We start out with it empty here and will dynamically change the text via jQuery based on the request to either add or edit a note. This <div> tag is given a CSS class named "Hidden" that will set the display:none style on the element. Since our call to the jQuery UI method to make the element a dialog widget will occur in the jQuery document ready code block, the end user will see the <div> element rendered in their browser as the page renders and then it will hide after that jQuery call. Adding the display:hidden to the <div> element via CSS will ensure that it is never rendered until the user triggers the request to open the dialog. The jQuery document load block contains the setup for the dialog node, click event bindings for the edit and add links, and a call to a JavaScript function called LoadList that handles the AJAX call to the List action method. The .dialog() method is called on the "NoteDialog" <div> element and the options are set for the dialog widget. The buttons option defines 2 buttons and their click actions. The first is the "Save" button (the text in quotations is used as the text for the button) that will do an AJAX post to our Save action method and send the serialized form data from the note form (targeted with the id attribute "NoteForm"). Upon completion it will close the dialog widget and call the LoadList to update the UX without a redirect. The "Cancel" button simply closes the dialog widget. The .live() method handles binding a function to the "click" event on all elements with the CSS class named EditLink . We use the .live() method because it will catch and bind our function to elements even as the DOM changes. Since we will be constantly changing the note list as we add and edit we want to ensure that the edit links get wired up with click events. The function for the click event on the edit links gets the noteid attribute and stores it in a local variable. Then it clears out the HTML in the dialog element (to ensure a fresh start), calls the .dialog() method and sets the "title" option (this sets the title attribute value), and then calls the .load() AJAX method to hit our Edit action method and inject the returned content into the "NoteDialog" <div> element. Once the .load() method is complete it opens the dialog widget. The click event binding for the add link is similar to the edit, only we don't need to get the id value and we load the Create action method. This binding is done via the .click() method because it will only be bound on the initial load of the page. The add button will always exist. Finally, we toss in some CSS in the Content/Site.css file to style our form and the add/edit links. . ButtonLink { color : Blue ; cursor : pointer ; } . ButtonLink : hover { text - decoration : underline ; } . Hidden { display : none ; } #NoteForm label { display:block; margin-bottom:6px; } #NoteForm label > span { font-weight:bold; } #NoteForm input[type=text] { width:350px; } #NoteForm textarea { width:350px; height:80px; } With all of our code in place we can do an F5 and see our list of notes: If we click on an edit link we will get the dialog widget with the correct note data loaded: And if we click on the add new note link we will get the dialog widget with the empty form: The end result of our solution tree for our sample:

    Read the article

  • jqGrid multi-checkbox custom edittype solution

    - by gsiler
    For those of you trying to understand jqGrid custom edit types ... I created a multi-checkbox form element, and thought I'd share. This was built using version 3.6.4. If anyone has a more efficient solution, please pass it on. Within the colModel, the appropriate edit fields look like this: edittype:'custom' editoptions:{ custom_element:MultiCheckElem, custom_value:MultiCheckVal, list:'Check1,Check2,Check3,Check4' } Here are the javascript functions (BTW, It also works – with some modifications – when the list of checkboxes is in a DIV block): //———————————————————— // Description: // MultiCheckElem is the "custom_element" function that builds the custom multiple check box input // element. From what I have gathered, jqGrid calls this the first time the form is launched. After // that, only the "custom_value" function is called. // // The full list of checkboxes is in the jqGrid "editoptions" section "list" tag (in the options // parameter). //———————————————————— function MultiCheckElem( value, options ) { //———- // for each checkbox in the list // build the input element // set the initial "checked" status // endfor //———- var ctl = ''; var ckboxAry = options.list.split(','); for ( var i in ckboxAry ) { var item = ckboxAry[i]; ctl += '<input type="checkbox" '; if ( value.indexOf(item + '|') != -1 ) ctl += 'checked="checked" '; ctl += 'value="' + item + '"> ' + item + '</input><br />&nbsp;'; } ctl = ctl.replace( /<br />&nbsp;$/, '' ); return ctl; } //———————————————————— // Description: // MultiCheckVal is the "custom_value" function for the custom multiple check box input element. It // appears that jqGrid invokes this function the first time the form is submitted and, the rest of // the time, when the form is launched (action = set) and when it is submitted (action = 'get'). //———————————————————— function MultiCheckVal(elem, action, val) { var items = ''; if (action == 'get') // the form has been submitted { //———- // for each input element // if it's checked, add it to the list of items // endfor //———- for (var i in elem) { if (elem[i].tagName == 'INPUT' && elem[i].checked ) items += elem[i].value + ','; } // items contains a comma delimited list that is returned as the result of the element items = items.replace(/,$/, ''); } else // the form is launched { //———- // for each input element // based on the input value, set the checked status // endfor //———- for (var i in elem) { if (elem[i].tagName == 'INPUT') { if (val.indexOf(elem[i].value + '|') == -1) elem[i].checked = false; else elem[i].checked = true; } } // endfor } return items; }

    Read the article

  • JavaScript recursion does not work properly

    - by misha-moroshko
    Hi, Could anyone say why the following recursive function does not work for me ? It should collect recursively all radio buttons in a given element. But, it does not found any for some reason !? Thanks !! <?xml version="1.0" encoding="Windows-1255"?> <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"> <head> <script type="text/javascript"> function AllInputs(radioElement) { this.radioInputs = ((arguments.length == 1) ? [radioElement] : []); } AllInputs.prototype.toString = function() { return "[object AllInputs: radioInputs: " + this.radioInputs.length + "]"; } AllInputs.prototype.add = function(otherAllInputs) { this.radioInputs = this.radioInputs.concat(otherAllInputs.radioInputs); } function getAllInputsOfElement(element) { if (element.tagName.toLowerCase() == "input") { if (element.getAttribute("type").toLowerCase() == "radio") { return new AllInputs(element); } else { return new AllInputs(); } } else { var result = new AllInputs(); for (i = 0; i < element.children.length; i++) { result.add(getAllInputsOfElement(element.children[i])); } return result; } } function main() { alert(getAllInputsOfElement(document.getElementById("MyTable"))); } </script> </head> <body onload="main()"> <table id="MyTable"> <tr><td>Day</td></tr> <tr><td> <input type="radio" name="DayOfTheWeek" value="1" /><label>Monday</label> <input type="radio" name="DayOfTheWeek" value="2" /><label>Tuesday</label> <input type="radio" name="DayOfTheWeek" value="3" /><label>Wednesday</label> </td></tr> </table> </body> </html>

    Read the article

  • Inline-editing: onBlur prevents onClick from being triggered (jQuery)

    - by codethief
    Hello StackOverflow community! I'm currently working on my own jQuery plugin for inline-editing as those that already exist don't fit my needs. Anyway, I'd like to give the user the following (boolean) options concerning the way editing is supposed to work: submit_button reset_on_blur Let's say the user would like to have a submit button (submit_button = true) and wants the inline input element to be removed as soon as it loses focus (reset_on_blur = true). This leads to an onClick handler being registered for the button and an onBlur handler being registered for the input element. Every time the user clicks the button, however, the onBlur handler is also triggered and results in the edit mode being left, i.e. before the onClick event occurs. This makes submitting impossible. FYI, the HTML in edit mode looks like this: <td><input type="text" class="ie-input" value="Current value" /><div class="ie-content-backup" style="display: none;">Backup Value</div><input type="submit" class="ie-button-submit" value="Save" /></td> So, is there any way I could check in the onBlur handler if the focus was lost while activating the submit button, so that edit mode isn't left before the submit button's onClick event is triggered? I've also tried to register a $('body').click() handler to simulate blur and to be able to trace back which element has been clicked, but that didn't work either and resulted in rather strange bugs: $('html').click(function(e) { // body doesn't span over full page height, use html instead // Don't reset if the submit button, the input element itself or the element to be edited inline was clicked. if(!$(e.target).hasClass('ie-button-submit') && !$(e.target).hasClass('ie-input') && $(e.target).get(0) != element.get(0)) { cancel(element); } }); jEditable uses the following piece of code. I don't like this approach, though, because of the delay. Let alone I don't even understand why this works. ;) input.blur(function(e) { /* prevent canceling if submit was clicked */ t = setTimeout(function() { reset.apply(form, [settings, self]); }, 500); }); Thanks in advance!

    Read the article

  • How to stream XML data using XOM?

    - by Jonik
    Say I want to output a huge set of search results, as XML, into a PrintWriter or an OutputStream, using XOM. The resulting XML would look like this: <?xml version="1.0" encoding="UTF-8"?> <resultset> <result> [child elements and data] </result> ... ... [1000s of result elements more] </resultset> Because the resulting XML document could be big (tens or hundreds of megabytes, perhaps), I want to output it in a streaming fashion (instead of creating the whole Document in memory and then writing that). The granularity of outputting one <result> at a time is fine, so I want to generate one <result> after another, and write it into the stream. Assume there's already a method that helps with iterating the results and generating Element objects: public nu.xom.Element getNextResult(); So I'd simply like to do something like this pseudocode (automatic flushing enabled, so don't worry about that) : open stream/writer write declaration write start tag for <resultset> while more results: write next <result> element write end tag for <resultset> close stream/writer I've been looking at Serializer, but the necessary methods, writeStartTag(Element), writeEndTag(Element), write(DocType) are protected, not public! Is there no other way than to subclass Serializer to be able to use those methods, or to manually write the start and end tags directly into the stream as Strings, bypassing XOM altogether? (The latter wouldn't be too bad in this simple example, but in the general case it would get quite ugly.) Am I missing something or is XOM just not made for this? With dom4j I could do this easily using XMLWriter - it has constructors that take a Writer or OutputStream, and methods writeOpen(Element), writeClose(Element), writeDocType(DocumentType) etc. Compare to XOM's Serializer where the only public write method is the one that takes a whole Document. Please refrain from answering if you're not familiar with XOM! I specifically want to know if and how you can do this kind of streaming with that library. (This is related to my question about the best dom4j replacement where XOM is a strong contender.)

    Read the article

  • jQuery: Sort div's according to content of different sub divs

    - by rayne
    I'm trying to create a somewhat complex sorting feature which neither uses divs nor lists. Unfortunately two hours of googling didn't help me. Here is the basic setup of my HTML: <div id="all_elements"> <!-- one element --> <div class="element"> <div class="wrapper"> <a href="/" title="links"> <img src="/img/image.jpg" border="0" alt="image" class="image" /></a> <div class="details"> <h3><a href="/" title="title">Name (Sort Argument 1)</a></h3> <div class="title"><a href="/" title="title">Title (Sort Argument 2)</a></div> <div class="year">2010 (Sort Argumentt 3)</div> <div class="country">Great Britain (Sort Argument 4)</div> </div><!-- details --> </div><!-- wrapper --> </div><!-- element --> </div> <!--all_elements--> The setup is a bit complex, but basically .element is the element that needs to be sorted alphabetically according to either the contents of h3, div.title, div.year or div.country. So the user will be able to view the contents of the site either sorted by name, by year, by country or by title. I have this jQuery snippet from a website, but all my attempts on trying to tell it to use the contents of e.g. h3 to sort have failed. Right now it sorts pretty much randomly. jQuery.fn.sort = function() { return this.pushStack([].sort.apply(this, arguments), []); }; function sortAscending(a, b) { return a.innerHTML > b.innerHTML ? 1 : -1; }; function sortDescending(a, b) { return a.innerHTML < b.innerHTML ? 1 : -1; }; $(document).ready(function() { $("#sort").toggle( function() { $('#all_elements .element').sort(sortDescending).appendTo('#all_elements'); $(this).text("Sort Asc"); }, function() { $('#all_elements .element').sort(sortAscending).appendTo('#all_elements'); $(this).text("Sort Desc"); }); }); How can I customize the function to sort the contents of my h3 or divs?

    Read the article

  • XSL transformation and special XML entities escaping

    - by Tomas R
    I have an XML file which is transformed with XSL. Some elements have to be changed, some have to be left as is - specifically, text with entities &quot;, &amp;, &apos;, &lt;, &gt; should be left as is, and in my case &quot; and &apos; are changed to " and ' accordingly. Test XML: <?xml version="1.0" encoding="UTF-8" ?> <root> <element> &quot; &amp; &apos; &lt; &gt; </element> </root> transformation file: <?xml version="1.0" encoding="UTF-8"?> <xsl:stylesheet xmlns:xsl="http://www.w3.org/1999/XSL/Transform" version="1.0"> <xsl:output method="xml" encoding="UTF-8" omit-xml-declaration="no" indent="no" /> <xsl:template match="element"> <xsl:copy> <xsl:value-of disable-output-escaping="no" select="." /> </xsl:copy> </xsl:template> </xsl:stylesheet> result: <?xml version="1.0" encoding="UTF-8"?> <element> " &amp; ' &lt; &gt; </element> desired result: <?xml version="1.0" encoding="UTF-8"?> <element> &quot; &amp; &apos; &lt; &gt; </element> I have 2 questions: why does some of those entities are transformed and other not? how can I get a desired result?

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • Writing to a xml file in java

    - by user243680
    import java.io.*; import javax.xml.parsers.*; import javax.xml.transform.*; import javax.xml.transform.dom.*; import javax.xml.transform.stream.*; import org.w3c.dom.*; public class CreatXMLFile { public static void main(String[] args) throws Exception { BufferedReader bf = new BufferedReader(new InputStreamReader(System.in)); // System.out.print("Enter number to add elements in your XML file: "); // String str = bf.readLine(); int no=2; // System.out.print("Enter root: "); String root = "SMS"; DocumentBuilderFactory documentBuilderFactory =DocumentBuilderFactory.newInstance(); DocumentBuilder documentBuilder =documentBuilderFactory.newDocumentBuilder(); Document document = documentBuilder.newDocument(); Element rootElement = document.createElement(root); document.appendChild(rootElement); // for (int i = 1; i <= no; i++) // System.out.print("Enter the element: "); // String element = bf.readLine(); String element ="Number"; System.out.print("Enter the Number: "); String data = bf.readLine(); Element em = document.createElement(element); em.appendChild(document.createTextNode(data)); rootElement.appendChild(em); String element1 ="message"; System.out.print("Enter the SMS: "); String data1 = bf.readLine(); Element em1 = document.createElement(element1); em1.appendChild(document.createTextNode(data1)); rootElement.appendChild(em1); TransformerFactory transformerFactory = TransformerFactory.newInstance(); Transformer transformer = transformerFactory.newTransformer(); DOMSource source = new DOMSource(document); StreamResult result = new StreamResult(System.out); transformer.transform(source, result); } } i am working on the above code and it gives the following output run: Enter the Number: 768678 Enter the SMS: ytu <?xml version="1.0" encoding="UTF-8" standalone="no"?><SMS><Number>768678</Number><message>ytu</message></SMS>BUILD SUCCESSFUL (total time: 8 seconds) Now i want to write the output generated(<?xml version="1.0" encoding="UTF-8" standalone="no"?><SMS><Number>768678</Number><message>ytu</message></SMS>) to a XML file on the hard disk.How do i do it?

    Read the article

  • Is there a way to enforce/preserve order of XML elements in an XML Schema?

    - by MarcoS
    Let's consider the following XML Schema: <?xml version="1.0" encoding="UTF-8"?> <schema targetNamespace="http://www.example.org/library" elementFormDefault="qualified" xmlns="http://www.w3.org/2001/XMLSchema" xmlns:lib="http://www.example.org/library"> <element name="library" type="lib:libraryType"></element> <complexType name="libraryType"> <sequence> <element name="books" type="lib:booksType"></element> </sequence> </complexType> <complexType name="booksType"> <sequence> <element name="book" type="lib:bookType" maxOccurs="unbounded" minOccurs="1"></element> </sequence> </complexType> <complexType name="bookType"> <attribute name="title" type="string"></attribute> </complexType> </schema> and a corresponding XML example: <?xml version="1.0" encoding="UTF-8"?> <lib:library xmlns:lib="http://www.example.org/library" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:schemaLocation="http://www.example.org/library src/library.xsd "> <lib:books> <lib:book title="t1"/> <lib:book title="t2"/> <lib:book title="t3"/> </lib:books> </lib:library> Is there a way to guarantee that the order of <lib:book .../> elements is preserved? I want to be sure that any parser reading the XML will return books in the specified oder, that is first the book with title="t1", then the book with title="t2", and finally the book with title="t3". As far as I know XML parsers are not required to preserve order. I wonder whether one can enforce this through XML Schema? One quick solution for me would be adding an index attribute to the <lib:book .../> element, and delegate order preservation to the application reading the XML. Comments? Suggestions?

    Read the article

  • Handling HumanTask attachments in Oracle BPM 11g PS4FP+ (II)

    - by ccasares
    Retrieving uploaded attachments -UCM- As stated in my previous blog entry, Oracle BPM 11g 11.1.1.5.1 (aka PS4FP) introduced a new cool feature whereby you can use Oracle WebCenter Content (previously known as Oracle UCM) as the repository for the human task attached documents. For more information about how to use or enable this feature, have a look here. The attachment scope (either TASK or PROCESS) also applies to UCM-attachments. But even with this other feature, one question might arise when using UCM attachments. How can I get them from within the process? The first answer would be to use the same getTaskAttachmentContents() XPath function already explained in my previous blog entry. In fact, that's the way it should be. But in Oracle BPM 11g 11.1.1.5.1 (PS4FP) and 11.1.1.6.0 (PS5) there's a bug that prevents you to do that. If you invoke such function against a UCM-attachment, you'll get a null content response (bug#13907552). Even if the attachment was correctly uploaded. While this bug gets fixed, next I will show a workaround that lets me to retrieve the UCM-attached documents from within a BPM process. Besides, the sample will show how to interact with WCC API from within a BPM process.Aside note: I suggest you to read my previous blog entry about Human Task attachments where I briefly describe some concepts that are used next, such as the execData/attachment[] structure. Sample Process I will be using the following sample process: A dummy UserTask using "HumanTask2" Human Task, followed by an Embedded Subprocess that will retrieve the attachments payload. In this case, and here's the key point of the sample, we will retrieve such payload using WebCenter Content WebService API (IDC): and once retrieved, we will write each of them back to a file in the server using a File Adapter service: In detail:  We will use the same attachmentCollection XSD structure and same BusinessObject definition as in the previous blog entry. However we create a separate variable, named attachmentUCM, based on such BusinessObject. We will still need to keep a copy of the HumanTask output's execData structure. Therefore we need to create a new variable of type TaskExecutionData (different one than the other used for non-UCM attachments): As in the non-UCM attachments flow, in the output tab of the UserTask mapping, we'll keep a copy of the execData structure: Now we get into the embedded subprocess that will retrieve the attachments' payload. First, and using an XSLT transformation, we feed the attachmentUCM variable with the following information: The name of each attachment (from execData/attachment/name element) The WebCenter Content ID of the uploaded attachment. This info is stored in execData/attachment/URI element with the format ecm://<id>. As we just want the numeric <id>, we need to get rid of the protocol prefix ("ecm://"). We do so with some XPath functions as detailed below: with these two functions being invoked, respectively: We, again, set the target payload element with an empty string, to get the <payload></payload> tag created. The complete XSLT transformation is shown below. Remember that we're using the XSLT for-each node to create as many target structures as necessary.  Once we have fed the attachmentsUCM structure and so it now contains the name of each of the attachments along with each WCC unique id (dID), it is time to iterate through it and get the payload. Therefore we will use a new embedded subprocess of type MultiInstance, that will iterate over the attachmentsUCM/attachment[] element: In each iteration we will use a Service activity that invokes WCC API through a WebService. Follow these steps to create and configure the Partner Link needed: Login to WCC console with an administrator user (i.e. weblogic). Go to Administration menu and click on "Soap Wsdls" link. We will use the GetFile service to retrieve a file based on its dID. Thus we'll need such service WSDL definition that can be downloaded by clicking the GetFile link. Save the WSDL file in your JDev project folder. In the BPM project's composite view, drag & drop a WebService adapter to create a new External Reference, based on the just added GetFile.wsdl. Name it UCM_GetFile. WCC services are secured through basic HTTP authentication. Therefore we need to enable the just created reference for that: Right-click the reference and click on Configure WS Policies. Under the Security section, click "+" to add the "oracle/wss_username_token_client_policy" policy The last step is to set the credentials for the security policy. For the sample we will use the admin user for WCC (weblogic/welcome1). Open the composite.xml file and select the Source view. Search for the UCM_GetFile entry and add the following highlighted elements into it:   <reference name="UCM_GetFile" ui:wsdlLocation="GetFile.wsdl">     <interface.wsdl interface="http://www.stellent.com/GetFile/#wsdl.interface(GetFileSoap)"/>     <binding.ws port="http://www.stellent.com/GetFile/#wsdl.endpoint(GetFile/GetFileSoap)"                 location="GetFile.wsdl" soapVersion="1.1">       <wsp:PolicyReference URI="oracle/wss_username_token_client_policy"                            orawsp:category="security" orawsp:status="enabled"/>       <property name="weblogic.wsee.wsat.transaction.flowOption"                 type="xs:string" many="false">WSDLDriven</property>       <property name="oracle.webservices.auth.username"                 type="xs:string">weblogic</property>       <property name="oracle.webservices.auth.password"                 type="xs:string">welcome1</property>     </binding.ws>   </reference> Now the new external reference is ready: Once the reference has just been created, we should be able now to use it from our BPM process. However we find here a problem. The WCC GetFile service operation that we will use, GetFileByID, accepts as input a structure similar to this one, where all element tags are optional: <get:GetFileByID xmlns:get="http://www.stellent.com/GetFile/">    <get:dID>?</get:dID>   <get:rendition>?</get:rendition>   <get:extraProps>      <get:property>         <get:name>?</get:name>         <get:value>?</get:value>      </get:property>   </get:extraProps></get:GetFileByID> and we need to fill up just the <get:dID> tag element. Due to some kind of restriction or bug on WCC, the rest of the tag elements must NOT be sent, not even empty (i.e.: <get:rendition></get:rendition> or <get:rendition/>). A sample request that performs the query just by the dID, must be in the following format: <get:GetFileByID xmlns:get="http://www.stellent.com/GetFile/">   <get:dID>12345</get:dID></get:GetFileByID> The issue here is that the simple mapping in BPM does create empty tags being a sample result as follows: <get:GetFileByID xmlns:get="http://www.stellent.com/GetFile/"> <get:dID>12345</get:dID> <get:rendition/> <get:extraProps/> </get:GetFileByID> Although the above structure is perfectly valid, it is not accepted by WCC. Therefore, we need to bypass the problem. The workaround we use (many others are available) is to add a Mediator component between the BPM process and the Service that simply copies the input structure from BPM but getting rid of the empty tags. Follow these steps to configure the Mediator: Drag & drop a new Mediator component into the composite. Uncheck the creation of the SOAP bindings and use the Interface Definition from WSDL template and select the existing GetFile.wsdl Double click in the mediator to edit it. Add a static routing rule to the GetFileByID operation, of type Service and select References/UCM_GetFile/GetFileByID target service: Create the request and reply XSLT mappers: Make sure you map only the dID element in the request: And do an Auto-mapper for the whole response: Finally, we can now add and configure the Service activity in the BPM process. Drag & drop it to the embedded subprocess and select the NormalizedGetFile service and getFileByID operation: Map both the input: ...and the output: Once this embedded subprocess ends, we will have all attachments (name + payload) in the attachmentsUCM variable, which is the main goal of this sample. But in order to test everything runs fine, we finish the sample writing each attachment to a file. To that end we include a final embedded subprocess to concurrently iterate through each attachmentsUCM/attachment[] element: On each iteration we will use a Service activity that invokes a File Adapter write service. In here we have two important parameters to set. First, the payload itself. The file adapter awaits binary data in base64 format (string). We have to map it using XPath (Simple mapping doesn't recognize a String as a base64-binary valid target): Second, we must set the target filename using the Service Properties dialog box: Again, note how we're making use of the loopCounter index variable to get the right element within the embedded subprocess iteration. Final blog entry about attachments will handle how to inject documents to Human Tasks from the BPM process and how to share attachments between different User Tasks. Will come soon. Again, once I finish will all posts on this matter, I will upload the whole sample project to java.net.

    Read the article

< Previous Page | 88 89 90 91 92 93 94 95 96 97 98 99  | Next Page >