Search Results

Search found 5154 results on 207 pages for 'expression evaluation'.

Page 92/207 | < Previous Page | 88 89 90 91 92 93 94 95 96 97 98 99  | Next Page >

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Casting in mixed type calculations in C?

    - by yCalleecharan
    Hi, If I define these variables: double x0, xn, h; int n; and I have this mathematical expression: h = (xn - x0)/n; Is it necessary that I cast n into double prior doing the division for maximum accuracy like in h = (xn - x0)/ (double) n; I wrote a program to check the above but both expressions give the same answers. I understand that C will promote the integer to double type as variables xn and x0 are of type double but strangely enough in a book, the second expression with casting was emphasized. Thanks a lot...

    Read the article

  • How to choose programaticaly the column to be queried by Linq using PropertyInfo???

    - by Richard77
    Hello, I would like to control how linq querries my database programaticaly. For instance, I'd like to query the column X, column Y, or column Z, depending on some conditions. First of all, I've created an array of all the properties inside my class called myPropertyInfo. Type MyType = (typeOf(MyClass)); PropertyInfo[] myPropertyInfo = myType.GetProperties( BindingFlags.Public|BindingFlags.Instance); The myPropertyInfo array allows me to access each property details (Name, propertyType, etc) through the index*[i]* Now, how can I use the above information to control how linq queries my DB? Here's a sample of a querry I'd like to exploit. var myVar = from tp in db.MyClass select tp.{expression}; Expression using myPropertyInfo[i] to choose which property(column) to query. I'm not sure if that's the way of doing it, but if there's another way to do so, I'll be glad to learn. Thanks for helping.

    Read the article

  • Lambda "if" statement?

    - by AndyC
    I have 2 objects, both of which I want to convert to dictionarys. I use toDictionary<(). The lambda expression for one object to get the key is (i = i.name). For the other, it's (i = i.inner.name). In the second one, i.name doesn't exist. i.inner.name ALWAYS exists if i.name doesn't. Is there a lambda expression I can use to combine these two? Basically to read as: "if i.name exists then set id to i.name, else set id to i.inner.name". Many thanks.

    Read the article

  • How to make validation for a textbox that accept only comma(,) & digit in asp.net application?

    - by prateeksaluja20
    I am working on a website. I am using C# 2008. I want to make a text box that accept only numbers & comma(,). for example-919981424199,78848817711,47171111747 or there may be a single number like 919981424199. I was able to do one thing My text box only containing number by using this Regular Expression validation.in its property-Validation Expression i wrote "[0-9]+". This is working but now my requirement is to send bulk SMS & each number is separated by (,). I tried a lot but not getting the ans. so please help me to sort out this problem.

    Read the article

  • How to create a NSPredicate to find entries with leading numerical value?

    - by Toastor
    Hello, I'm using NSPredicates to fetch entities based on a name attribute. Creating a predicate for names beginning with letters was easy (@"name BEGINSWITH %@", searchLetter), however now I'd like to fetch all entities with a name that begins with a numerical value, or rather a non-alphabetical number. What would be the appropriate predicate expression here? Right now I don't want to get too deep into predicate programming, as this is all I need right now and time flies. So, please, don't point me to the Predicate Programming Guide, I just need that expression.. :) Thanks alot guys!

    Read the article

  • Looking for another regex explanation

    - by Sam
    In my regex expression, I was trying to match a password between 8 and 16 character, with at least 2 of each of the following: lowercase letters, capital letters, and digits. In my expression I have: ^((?=.*\d)(?=.*[a-z])(?=.*[A-Z])(?=.*\d)(?=.*[a-z])(?=.*[A-Z]).{8,16})$ But I don't understand why it wouldn't work like this: ^((?=\d)(?=[a-z])(?=[A-Z])(?=\d)(?=[a-z])(?=[A-Z]){8,16})$ Doesnt ".*" just meant "zero or more of any character"? So why would I need that if I'm just checking for specific conditions? And why did I need the period before the curly braces defining the limit of the password? And one more thing, I don't understand what it means to "not consume any of the string" in reference to "?=".

    Read the article

  • Best ASP.NET E-Commerce Framework (aspDotNetStoreFront, AbleCommerce, BVCommerce, MediaChase,...)

    - by EfficionDave
    I need a full-featured asp.net E-Commerce solution for a project. It needs to be easily extensible as I need to extend it to integrate with a custom Flash based personalization engine. It should also have a great administrative back-end that handles inventory tracking, report, labels, shipping, ... so that the client can really use it as the basis for their business. I've used quite a few different E-Commerce systems including OSCommerce, Zen Cart, Catalook, and eTailer. While I was impressed with Zen Cart and eTailer, this project is big enough that I want to try a more serious, commercial offering. I'm particularly interested in thoughts on aspdotnetstorefront, BVCommerce, AbleCommerce, and MediaChase. [UPDATE] I've done quite a bit of evaluation since I posted this question and will give some of my findings below: BVCommerce - The price point is nice, the product seems fairly well regarded, and I've heard good things about customizing/extending it, it just doesn't seem like it's going to meet my needs as an Top Tier ECommerce solution. After viewing the tutorial videos, the Admin interface just seems too basic and outdated. aspDotNetStorefront - The integration with DotNetNuke was it's biggest selling point for me but after reading peoples opinions, it's integration seems quite weak. It's sounds like there's a significant learning curve and the architecture just doesn't sound like it's as clean as it should be. AbleCommerce - After a rather thorough evaluation, I have selected AbleCommerce for at least my next project. The Admin interface is beautiful and has a nice list of features. The E-Commerce portion of the user side is very well done, highly skin-able (using Master Pages and a couple other techniques), and the checkout workflow has all the features I need while still being very clean. Source to the API can be bought for $500 but you generally won't need it. There are some 3rd party modules available but there's not currently a large market for these. The biggest glaring weakness of AbleCommerce I've found is their CMS capabilities are very limited and not at all well suited for a non-technical user to make most site content updates. But I have a good solution for that that I plan adapting into AbleCommerce. They will automatically generate a site for you to play with to your heart's content for 30 days. It is defniitely worth checking out.

    Read the article

  • Visual Studio Express 2010 license

    - by Mark
    Can I use Visual C++ 2010 Express compiler for commercial use? As far as I know, it was always permitted prior to 2010 version, but now when I start IDE, it writes "For Evaluation Purposes Only". I can't find the full license file anywhere (not in installed files, not in Google), so I'm in doubt, should I use it, or should I downgrade to MSVC++2008 version.

    Read the article

  • minimax depth first search game tree

    - by Arvind
    Hi I want to build a game tree for nine men's morris game. I want to apply minimax algorithm on the tree for doing node evaluations. Minimax uses DFS to evaluate nodes. So should I build the tree first upto a given depth and then apply minimax or can the process of building the tree and evaluation occur together in recursive minimax DFS? Thank you Arvind

    Read the article

  • Are there Any free XSL-FO editors?

    - by Russell
    I am looking for a free WYSIWYG editor of XSL-FO. Specifically, I would like to be able to design the FO file through a visual editor. I am aware of some that are available for purchase and evaluation, however I was wondering if there are any free editors available? Thanks

    Read the article

  • Need good RDLC examples/samples

    - by Sachin
    I am in evaluation phase of report tool. I prefer RDLC for the same. But I need some examples/samples available in the wild which can guide us on using the RDLC off the shelf. I would be looking for examples from as simple as list of data and as complex as using matrix, calculation, grouping, etc. This will help us to make a reference point if anytime we get stuck up somewhere.

    Read the article

  • IAR MSP430 compiler internal error while compiling

    - by michael
    IAR C/C++ Compiler for MSP430 5.10.1 [Evaluation] (5.10.1.20144) I get an illegal state internal error when attempting to compile the FreeRTOS 5.4 Task.c file (everything else compiles fine) Internal Error: [CoreUtil/General]: Illegal state The kick start version of IAR (MSP430 version) works fine. Any thoughts?

    Read the article

  • GPL license and eiffel studio

    - by Michael Jenneson
    On https://www2.eiffel.com/download/download_info.aspx?id=eiffelstudio&info=false&mirrors=eiffelstudio you can download the IDE "eiffelstudio". They have GPL as their license but they also specify that "The GPL version is for the purpose of developing open-source software only! If you want to evaluate EiffelStudio for commercial software development, please download our Enterprise Evaluation Edition." However as far as i know this is directly against the gpl. Can they really specify such restrictions while adhering to the GPL?

    Read the article

  • Selecting a user-defined scalar function that takes as a parameter another field

    - by ghills
    I have a table a with a list of id's, and a user-defined function foo(id) that takes the id and returns a VARCHAR(20). What I am trying to do is: SELECT id, foo(id) AS 'text field' FROM a However, instead of calling the function for each ID number, like I desired, the text comes back the same for every row. I have tested the foo() function manually with the returned ID's and it does not have that problem, so I realize I must not understand something about the evaluation of the query.

    Read the article

  • How to shorthand array declaration in a method call?

    - by Paul Sasik
    Hi all, This is hopefully a softball syntax question: I need to call a method with an empty Object array for evaluation and set initial state. In C# I would just do this: func(new Object[]{}); In VB.NET I am forced to do this: Dim ctrls() As Control = {} func(ctrls) Is there a way to shorthand the call in VB.NET and have everything happen in one line of code? P.S. VB-bashing will earn bonus points. ;-)

    Read the article

  • Clojure Box: Problem with classpath (noob question)

    - by Rainer
    Hello, I'm stuck with "Programming Clojure" on page 37 on a Windows 7 machine. After downloading the "examples" dir into "C:/clojure", I typed: user (require 'examples.introduction) and I got ; Evaluation aborted. java.io.FileNotFoundException: Could not locate examples/ introduction__init.class or examples/introduction.clj on classpath: (NO_SOURCE_FILE:0) My .emacs file looks like this: (setq swank-clojure-extra-classpaths (list "C:/Clojure")) The files in C:/Clojure are there (I triplechecked) Any help will be appreciated.

    Read the article

  • Visual Studio 2010 and WinCE 5.0

    - by koloko
    Is it possible to use a platform builder 5.0 SDK in visual studio 2010 for a C++ project. I want to compile code for a specific ARM WinCE 5.0 environment and I have VS2010 at the moment. The Microsoft website recommends visual studio 2005. I'm currently downloading the VS2005 evaluation but I'm also a bit worried about installing this on a machine that already has vs2010 installed. Any advise would be greatly received.

    Read the article

  • Does anyone know how to make a custom search in Bugzilla?

    - by Mugen
    I'm trying to make a search in Bugzilla which is used during our evaluation. The search basically lists how many defects were logged by each employee. Does anyone know how we can do this in Bugzilla? (The advanced search page has options for "Advanced Searching Using Boolean Charts: ". I think it could probably be using that? )

    Read the article

  • Discovering a functional algorithm from a mutable one

    - by Garrett Rowe
    This isn't necessarily a Scala question, it's a design question that has to do with avoiding mutable state, functional thinking and that sort. It just happens that I'm using Scala. Given this set of requirements: Input comes from an essentially infinite stream of random numbers between 1 and 10 Final output is either SUCCEED or FAIL There can be multiple objects 'listening' to the stream at any particular time, and they can begin listening at different times so they all may have a different concept of the 'first' number; therefore listeners to the stream need to be decoupled from the stream itself. Pseudocode: if (first number == 1) SUCCEED else if (first number >= 9) FAIL else { first = first number rest = rest of stream for each (n in rest) { if (n == 1) FAIL else if (n == first) SUCCEED else continue } } Here is a possible mutable implementation: sealed trait Result case object Fail extends Result case object Succeed extends Result case object NoResult extends Result class StreamListener { private var target: Option[Int] = None def evaluate(n: Int): Result = target match { case None => if (n == 1) Succeed else if (n >= 9) Fail else { target = Some(n) NoResult } case Some(t) => if (n == t) Succeed else if (n == 1) Fail else NoResult } } This will work but smells to me. StreamListener.evaluate is not referentially transparent. And the use of the NoResult token just doesn't feel right. It does have the advantage though of being clear and easy to use/code. Besides there has to be a functional solution to this right? I've come up with 2 other possible options: Having evaluate return a (possibly new) StreamListener, but this means I would have to make Result a subtype of StreamListener which doesn't feel right. Letting evaluate take a Stream[Int] as a parameter and letting the StreamListener be in charge of consuming as much of the Stream as it needs to determine failure or success. The problem I see with this approach is that the class that registers the listeners should query each listener after each number is generated and take appropriate action immediately upon failure or success. With this approach, I don't see how that could happen since each listener is forcing evaluation of the Stream until it completes evaluation. There is no concept here of a single number generation. Is there any standard scala/fp idiom I'm overlooking here?

    Read the article

< Previous Page | 88 89 90 91 92 93 94 95 96 97 98 99  | Next Page >