Search Results

Search found 9273 results on 371 pages for 'complex strings'.

Page 93/371 | < Previous Page | 89 90 91 92 93 94 95 96 97 98 99 100  | Next Page >

  • Why doesen't the number 2 work in this for-loop?

    - by Emil
    Hello. I have a function that runs trough each element in an array. It's hard to explain, so I'll just paste in the code here: NSLog(@"%@", arraySub); for (NSString *string in arrayFav){ int favoriteLoop = [string intValue] + favCount; NSLog(@"%d", favoriteLoop); id arrayFavObject = [array objectAtIndex:favoriteLoop]; [arrayFavObject retain]; [array removeObjectAtIndex:favoriteLoop]; [array insertObject:arrayFavObject atIndex:0]; [arrayFavObject release]; id arraySubFavObject = [arraySub objectAtIndex:favoriteLoop]; [arraySubFavObject retain]; [arraySub removeObjectAtIndex:favoriteLoop]; [arraySub insertObject:arraySubFavObject atIndex:0]; [arraySubFavObject release]; id arrayLengthFavObject = [arrayLength objectAtIndex:favoriteLoop]; [arrayLengthFavObject retain]; [arrayLength removeObjectAtIndex:favoriteLoop]; [arrayLength insertObject:arrayLengthFavObject atIndex:0]; [arrayLengthFavObject release]; } NSLog(@"%@", arraySub); The array arrayFav contains these strings: "3", "8", "2", "10", "40". Array array contains 92 strings with a name. Array arraySub contains numbers 0 to 91, representing a filename with a title from the array array. Array arrayLength contains 92 strings representing the size of each file from array arraySub. Now, the first NSLog shows, as expected, the numbers 0 to 91. The NSLog-s in the loop shows the numbers 3, 8, 2, 10, 40, also as expected. But here's the odd part: the last NSLog shows these numbers: 40, 10, 0, 8, 3, 1, 2, 4, 5, 6, 7, 9, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 that is 40, 10, 0, 8, 3, and so on. It was not supposed to be a zero in there, it was supposed to be a 2.. Do you have any idea at why this is happening or a way to fix it? Thank you.

    Read the article

  • Create Class objects based on type signature

    - by Andreas_D
    Class.forName(boolean.class.getName()); This doesn't work in Java - the virtual machine slaps you with a ClassNotFoundException. I was in need for something like that because I wanted to reflect methods based on Strings that included the method signatures, like public void doSomething(boolean yesWeCan, java.lang.String[] presidents); At the end I came up with a custom 'ClassFactory' which translates the type Strings to class objects. This factory includes a lot of handlers for primitive and array type values. The handler for array type objects is something like: if (isArrayOfObjects) { return Class.forName("L["+typeName.replace("[]", "")+";"); } My question is - have I missed something in the Java 1.5+ API that might do the trick?

    Read the article

  • C++ string array from ifstream

    - by David Beck
    I have a program that I need to read in an array of strings from a file. The array must be C type strings (char * or char[]). Using the following code, I get a bad access error: for (i = 0; i < MAX_WORDS && !inputFile.eof(); i++) { inputFile >> words[i]; } words is declared as: char *words[MAX_WORDS];

    Read the article

  • Pass variable number of variables to a class in PHP

    - by user325282
    I need to pass a variable number of strings to instantiate different classes. I can always do a switch on the size of the array: switch(count($a)) { case 1: new Class(${$a[0]}); break; case 2: new Class(${$a[0]}, ${$a[1]}); break; etc... There has to be a better way to do this. If I have an array of strings ("variable1", "variable2", 'variable3", ...), how can I instantiate a Class without manually accounting for every possibility?

    Read the article

  • File System Types in .Net

    - by Avi
    I don't get the abstractions and the terminology :-( For example, DirectoryInfo.FullName is defined as the full path of the directory or file, but it's a string! So is DirectoryInfo.Name, FileInfo.FullName, Path.GetDirectoyName and so on. This means that in .Net there is no "depth" (or "meat" - my English isn't so good) for the file system objects. There's no protection from a type system. I can't, for example, define two Path objects and ask if one of them is "above" the other - I have to manipulate the strings. I can't differentiate between a Path that identifies a directory and a path that identifies a file. I can't do anything!-( Just manipulate strings. Is this correct (or am I simply missing something). If correct, are there any alternatives?

    Read the article

  • How do you like to define your module-wide variables in drupal 6?

    - by sprugman
    I'm in my module file. I want to define some complex variables for use throughout the module. For simple things, I'm doing this: function mymodule_init() { define('SOME_CONSTANT', 'foo bar'); } But that won't work for more complex structures. Here are some ideas that I've thought of: global: function mymodule_init() { $GLOBALS['mymodule_var'] = array('foo' => 'bar'); } variable_set: function mymodule_init() { variable_set('mymodule_var', array('foo' => 'bar')); } property of a module class: class MyModule { static $var = array('foo' => 'bar'); } Variable_set/_get seems like the most "drupal" way, but I'm drawn toward the class setup. Are there any drawbacks to that? Any other approaches out there?

    Read the article

  • Sharepoint 2010 web application development suitability evaluation/assessment

    - by Robert Koritnik
    I would like to know what kind of applications are suitable to be developed on top of Sharepoint 2010 and which should not be built on to of it. So when to embrace/avoid Sharepoint 2010 as a development platform for new web applications. Addendum Would you as a sharepoint development specialist choose it as a platform for your next enterprise application with these characteristics: processor intensive lots of various screens for entering and managing data many complex business processes no need to change the UI (ie. reposition parts) ERP integration etc. I'm an Asp.net MVC (former web forms) developer and would like to know if usual multi-page semi complex web applications (intra/extra-net) should be built on top of Sharepoint 2010 and why (if yes or if no).

    Read the article

  • Efficient questions

    - by rayman
    Hi, I have to manage xml's and Strings in my app. by efficenty and memory saving, is collection(ArrayList) will be much more 'expensive' then array of Strings? another issue is: i could use the content as regular String, or XML.. is working with XML also makes it more 'expensive' ? when i say i expensive i talk about taking system sources. please tell me by any of your exprience if the diffrences are significant? thanks, ray.

    Read the article

  • In-memory data structure that supports boolean querying

    - by sanity
    I need to store data in memory where I map one or more key strings to an object, as follows: "green", "blue" -> object1 "red", "yellow" -> object2 I need to be able to efficiently receive a list of objects, where the strings match some boolean criteria, such as: ("red" OR "green") AND NOT "blue" I'm working in Java, so the ideal solution would be an off-the-shelf Java library. I am, however, willing to implement something from scratch if necessary. Anyone have any ideas? I'd rather avoid the overhead of an in-memory database if possible, I'm hoping for something comparable in speed to a HashMap (or at least the same order of magnitude).

    Read the article

  • Is there a way to specify java annotations in antlr grammar files?

    - by Steve B.
    I'm looking for a way to include a few additional strings in output .java files generated from antlr. Is there a comprehensive listing of available directives? For example, given parser output like this: package com.foo.bar; //<-- this can be generated with @header { .... } //antlr generated import org.antlr.runtime.*; ... //<-- is there a way to generate anything here? public class MyParser { //<--- or here? public void f1(){ ... } } Is there a way to generate strings that appear after the import statements (e.g. class-level annotations) or possibly method annotations?

    Read the article

  • String.split() - matching leading empty String prior to first delimiter?

    - by tehblanx
    I need to be able to split an input String by commas, semi-colons or white-space (or a mix of the three). I would also like to treat multiple consecutive delimiters in the input as a single delimiter. Here's what I have so far: String regex = "[,;\\s]+"; return input.split(regex); This works, except for when the input string starts with one of the delimiter characters, in which case the first element of the result array is an empty String. I do not want my result to have empty Strings, so that something like, ",,,,ZERO; , ;;ONE ,TWO;," returns just a three element array containing the capitalized Strings. Is there a better way to do this than stripping out any leading characters that match my reg-ex prior to invoking String.split? Thanks in advance!

    Read the article

  • (C++) While reading a file (ifstream), is there any way to direct it to make a new line?

    - by Enzo
    While reading a file (ifstream), is there any way to direct it to make a new line? For instance, I would like for THIS to happen: myfilearray[1]array[2]endl; Obviously, the "endl" just isn't allowed. Is there another way to do this? Edit---thanks for the quick responses guys! From a text file, I'm trying to store two strings from that file into arrays and then do the same with the next line (or until I desire, using a for loop) Using strings is important to me as it will make my future program a lot more flexible.

    Read the article

  • Is there a way to create a string that matches a given C# regex?

    - by Chris Phillips
    My application has a feature that parses text using a regular expression to extract special values. I find myself also needing to create strings that follow the same format. Is there a way to use the already defined regular expression to create those strings? For example, assume my regex looks something like this: public static Regex MyRegex = new Regex( @"sometext_(?<group1>\d*)" ); I'd like to be able to use MyRegex to create a new string, something like: var created = MyRegex.ToString( new Dictionary<string, string>() {{ "group1", "data1" }}; Such that created would then have the value "sometextdata1".

    Read the article

  • Get the top nth values from a rectangular array

    - by user355925
    I am reading a txt file for strings that represent integers. The file is space delimited. I have created an array[10,2]. Everytime the strings 1~10 is found in the file I increment array[n,0] by 1. I also feed array[n,1] with numbers 1~10. i.e. txt file contents: 1/1/1 10/1/2001 1 1 10 2 2 3 1 5 10 word word 3 3 etc.. streamreader reads 1/1/1 and determines that is is not 1~10 streamreader reads 10/1/2001 and determines that it is not 1~10 streamreader reads 1 and ++array[0,0] streamreader reads 1 and ++array[0,0] streamreader reads 10 and ++array[9,0] etc.. The result will be: '1' was found 3 times '2' was found 2 times '3' was found 3 times '5' was found 1 time '10' was found 2 times My problem is that I need this array placed in order(sorted) by value of column 0 so that it would be: 1 3 2 10 5

    Read the article

  • .NET Regex - need matching string for parsing...

    - by TomTom
    Hello, I am a regex idiot and never found a good tutorial (links welcome, as well as a pointer to an interactive VS2010 integrated editor). I need to parse strings in the following form: [a/b]:c/d a, b: double with "." as possible separator. CAN be empty c: double with "." as separator d: integer, positive I.e. valid strings are: [/]:0.25/2 [-0.5/0.5]:0.05/2 [/0.1]:0.05/2 ;) Anyone can help? Thanks

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • How to test Language DLLs?

    - by EKI
    Our application offer the user to display different languages if they have the approppriate Language DLL (say German.DLL, French.DLL, even Chinese.DLL). We have functional test to verify that those DLLs enable the right options in a Combobox and that choosing them will actually translate strings in the UI. I would like to know options to test this translation dll's more in depth, maybe ensuring that all the characters in the selected langauge (and in the file) can be correctly displayed, or that the internal structure of the DLL is consistent, there are no strings exceeding the limits that are expected of them, etc... Any suggestions on what to test and how to test it? Does anyone know specific problems that may arise and we should check? Thanks in advance.

    Read the article

  • Selecting dictionary items by key efficiently in Python

    - by user248237
    suppose I have a dictionary whose keys are strings. How can I efficiently make a new dictionary from that which contains only the keys present in some list? for example: # a dictionary mapping strings to stuff mydict = {'quux': ..., 'bar': ..., 'foo': ...} # list of keys to be selected from mydict keys_to_select = ['foo', 'bar', ...] The way I came up with is: filtered_mydict = [mydict[k] for k in mydict.keys() \ if k in keys_to_select] but I think this is highly inefficient because: (1) it requires enumerating the keys with keys(), (2) it requires looking up k in keys_to_select each time. at least one of these can be avoided, I would think. any ideas? I can use scipy/numpy too if needed.

    Read the article

  • RESTful enums. string or Id?

    - by GazTheDestroyer
    I have a RESTful service that exposes enums. Should I expose them as localised strings, or plain integers? My leaning is toward integers for easy conversion at the service end, but in that case the client needs to grab a list of localised strings from somewhere in order to know what the enums mean. Am I just creating extra steps for nothing? There seems to be little information I can find about which is commonly done in RESTful APIs. EDIT: OK. Let's say I'm writing a website that stores information about people's pets. I could have an AnimalType enum 0 Dog 1 Cat 2 Rabbit etc. When people grab a particular pet resource, say /pets/1, I can either provide a meaningful localised string for the animal type, or just provide the ID and force them to do another look up via a /pets/types resource. Or should I provide both?

    Read the article

  • facelet - nested <ui:insert>

    - by user321350
    I have multiple templates which differs with each other only by few containers. The most complex one contains superset of all containers used in all other one thus to avoid creating multiple templates I created the most complex one in following format some layout stuff (div and all) defining nested insert for each container and content. Now in client template based on what is needed I turn off container which is not needed as else if container is needed, just define content as doSomething Please let me know if you guys see any issues with this approach, any potential problem or alternate approach for similar scenario. thanks a lot. Maddy

    Read the article

< Previous Page | 89 90 91 92 93 94 95 96 97 98 99 100  | Next Page >