Search Results

Search found 37902 results on 1517 pages for 'object methods'.

Page 93/1517 | < Previous Page | 89 90 91 92 93 94 95 96 97 98 99 100  | Next Page >

  • PHP: How to cast object to inherited class?

    - by andreyvlru
    I'd like to inherit PDOStatement class and use it in my website scripts. But I am frustrated how to get required object. PDO::query returns only direct PDOStatement object and looks like there are no other method to create PDOStatement object or inherited class. Initially i thought to move PDOStatement object to constructor of inherit class Something like that: $stmt = PDO -> query("select * from messages"); $messageCollection = new Messaging_Collection($stmt); But how to make instance of PDOStatement to inherited object (Messaging_Collection). It is a big question for me. class Messaging_Collection extends PDOStatement { public function __construct(PDOStatement $stmt) { //there i should to transform $stmt to $this // direct $this = $stmt is not possible // is there other right way? }

    Read the article

  • Understanding how to inject object dependencies

    - by Hans
    I have an object that loads an instance of another object in a method. $survey = new survey; $question = new question($survey); $question-load($question_id); class question { public function __construct(&$survey) { $this-survey = $survey; } public function load ($id) { // now a question is loaded // want to load the survey that this question is in $this->survey->load($this->get('survey_id')); // ** survey_id is a field in the questions table // now $this->survey object has all the info about the survey this question is in } private function get($name) { // returns $name, if isset() from array that load() sets } } This is frying my brain, though, because it seems like $survey should come into $response already being a complete object. But, how do I do that, if I don't know what survey_id to load until I'm in the object? I am revamping a site and the most complex part is littered with this issue. TIA - Hans.

    Read the article

  • Learning OOP Design

    - by waiwai933
    I've read Head First Java, and I understand how OOP works. Here's my problem: I'm a PHP programmer, and while I've used OOP in PHP, I'm having trouble figuring out what should be an object and what methods to give it. For example, let's say I have a app that allows people to log in and edit a document. Why should the document be an object if there will ever only be one instance? Should I give the deleteDocument() method to the document object or the admin object? The document is the one being deleted, but the admin is the one performing the action. So my real question is, coming from a procedural background, how do I figure out what should be objects and what should have what methods?

    Read the article

  • http(/* argument here */) How is this Object (Http) being used without an explicit or implicit meth

    - by Randin
    In the example for coding with Json using Databinder Dispatch Nathan uses an Object (Http) without a method, shown here: import dispatch._ import Http._ Http("http://www.fox.com/dollhouse/" >>> System.out ) How is he doing this? Thank you for all of the answers unfortunatly I was not specific enough... It looks like it is simply passing an argument to a constructor of class or companion object Http. In another example, I've seen another form: http = new Http http(/* argument here */) Is this valid Scala? I guess it must be, because the author is a Scala expert. But it makes no sense to me. Actions are usually performed by invoking methods on objects, whether explicitly as object.doSomething() or implicitly as object = something (using the apply() method underneath the syntactic sugar). All I can think of is that a constructor is being used to do something in addition to constructing an object. In other words, it is having side effects, such as in this case going off and doing something on the web.

    Read the article

  • Object Slicing, Is it advantage ?

    - by harigm
    Object slicing is some thing that object looses some of its attributes or functions when a child class is assigned to base class. Some thing like Class A{ } Class B extends A{ } Class SomeClass{ A a = new A(); B b = new B(); // Some where if might happen like this */ a = b; (Object slicing happens) } Do we say Object slicing is any beneficial in any ways? If yes, can any one please tell me how object slicing be a helpful in development and where it might be helpful?

    Read the article

  • good __eq__, __lt__, ..., __hash__ methods for image class?

    - by Marten Bauer
    I create the following class: class Image(object): def __init__(self, extension, data, urls=None, user_data=None): self._extension = extension self._data = data self._urls = urls self._user_data = user_data self._hex_digest = hashlib.sha1(self._data).hexDigest() Images should be equal when all values are equal. Therefore I wrote: def __eq__(self, other): if isinstance(other, Image) and self.__dict__ == other.__dict__: return True return False def __ne__(self, other): return not self.__eq__(other) def __lt__(self, other): return self.__dict__ < other.__dict__ ... But how should the __hash__ method look like? Equal Images should return equal hashes... def __hash__(self): # won't work !?! return hash(self.__dict__) Is the way I try to use __eq__, __ne__, __lt__, __hash__, ... recommend?

    Read the article

  • Using one sqlconnection/sqlcommand through 2 DB-bound methods

    - by dotnetdev
    I have a class with a method which gets data from a database through a SELECT stored proc. This method uses a SqlDbReader by returning ExecuteReader() on a SqlCommand. The connection and everything is made in this method, with fields (such as connection string) set as class level fields. I now need to populate an array based on the results of this query (so the columns of each row will go into the array with its own index). However, this query will not select all of the data from one table which is involved. I can write the queries to get what I need, but how can I use one connection throughout the class? If I instantiate the connection object and call Open() in the constructor, I get an exception @ runtime. I'm hoping for something like this: // At class level: sqlconn.Open(); // sqlcommand set up Method() { // Fire stored proc // Insert results in a collection } Method2() { // Pass same collection in (use same one), // Add new row columns into same collection } How can I do this with strict performance in mind? Thanks

    Read the article

  • Building resultset using collection object

    - by Bhaskara Krishna Mohan Potam
    Hi, I had an issue in building the resultset using java. Here it goes... I am storing a collection object which is organized as row wise taken from a resultset object and putting the collection object(which is stored as vector/array list) in cache and trying to retrieve the same collection object. Here i need to build back the resultset again using the collection object. Now my doubt is building the resultset in this way possible or not? Please let me know asap. Thanks in advance, Bhaskar

    Read the article

  • Instantiating COM object hnetcfg.fwpolicy2 on Remote Server

    - by Pavan Keerthi
    I locked my self out by inadvertently changing RDP firewall rule to use IPSec,but without completing proper steps to setup IPSec channel from my laptop to server. Luckily all wmi remoting on Server works,So I am trying to edit the rule with Powershell When I enter below code ,the COM object is invoking on local machine.How can I invoke it on remote machine? Enter-PSSession $Session $fw = New-Object -ComObject hnetcfg.fwpolicy2

    Read the article

  • Passing unknown amounts of variables using through a string string and eval and multiple functions a

    - by user300797
    I'm not sure how best to describe this problem... In short, I want to use object literal to allow me to pass a random amount of variables in any order to a function. Whilst this is not big deal in theory, in my code, this object literal is passed to a second function call on_change. on_change works comparing an element inner HTML to a string. if it is the same, it sets a time out of to call the function again (this is sort of/almost recursive, but the function dose actually get to end before it is called again). if the elements inner HTML is different from the string, then the third parameter is executed. this will either be a function or a string. either way it will execute. I have tested this function plenty and used it for a while now. how ever, it cannot seem to get the object literal to flow through the function calls... var params = { xpos:'false'}; on_change('window_3_cont_buffer','',' if(Window_manager.windows[3].window_cont_buffer.getElementsByTagName(\'content\')[0].getElementsByTagName(\'p\')[0].innerHTML == \'ERROR\'){ alert(Window_manager.windows[3].window_cont_buffer.getElementsByTagName(\'content\')[0].getElementsByTagName(\'p\')[1].innerHTML); return false; } else { Window_manager.windows[3].load_xml(\'location/view.php?location_ID=3\', \'\', ' + params + ' ); } '); I call this as part of the form submission. after this line, I then call a function to load some content via ajax, which works fine and will trigger the code from the on_change function. I have tested load_xml function it is able to call alert(param.xpos) and get the correct response. I can even added in a check for being undefined so that rest of the times I cam load_xml I don't get swamped with alerts. The load_xml function first set up the on_change function, then calls the function to load the content to a hidden div. Once the AJAX request has updated that DIV, the on_change function should now call the parse_xml function. This pulls out the information from the xml file. How ever... The idea of this object literal param is that it can tell this parse_xml function to ignore certain things. on_change("window_" + this.id + "_cont_buffer", "", "Window_manager.windows[" + this.id + "].parse_xml('" + param + "')"); this is part of load_xml. it works perfectly fine, even with the param bit in there. except, parse_xml dose not seem to be able to use that parameter. I have been able to get it to a point where parse_xml can alert(param) and give [object object] which I would of thought meant that the object litteral had been passed through, but when I try and call alert(param.xpos) I get undefined. I know this is a pig of a problem, and I could get around it by just having the function take a zillion boolean parameters, but its just not practical or elegant. I'm sure you will need to ask me plenty more questions before I can solve this. I will post more complete code, I just cut it down to what is actually going on. Thanks

    Read the article

  • Get an object by its objectGUID using ldapsearch

    - by orsogufo
    If I have the objectGUID attribute as returned by the ldapsearch command, how can I search the whole directory for an object with that objectGUID? For example, if I search a user getting its objectGUID, I get the following: ldapsearch -x -D $MyDn -W -h $Host -b "dc=x,dc=y" "(mail=something)" objectGUID # 7f435ae312a0d8197605, p, Externals, x.y dn: CN=7f435ae312a0d8197605,OU=p,DC=x,DC=y objectGUID:: b+bSezFkKkWDmbIZiyE5rg== Starting from the value b+bSezFkKkWDmbIZiyE5rg==, how can I create a query string to get that object?

    Read the article

  • Creating get/set method dynamically in javascript

    - by portoalet
    I am trying to create a UserDon object, and trying to generate the get and set methods programmatically ( based on Pro Javascript book by John Resig page 37 ), and am testing this on Firefox 3.5 The problem is: in function UserDon, "this" refers to the window object instead of the UserDon object. So after calling var userdon = new UserDon(...) I got setname and getname methods created on the window object (also setage and getage). How can I fix this? function UserDon( properties ) { for( var i in properties ) { (function(){ this[ "get" + i ] = function() { return properties[i]; }; this[ "set" + i ] = function(val) { properties[i] = val; }; })(); } } var userdon = new UserDon( { name: "Bob", age: 44 });

    Read the article

  • Object drag delay issue

    - by Johnny Darvall
    I have this code that drags stuff around perfectly in IE - however in firefox the onmousedown-drag of the object does not immediately drag but shows the no-entry cursor and then after onmouseup the object drags around freely. The object does stop draging on the next onmouseup. The object should only drag in the onmousdown state, while the onmousup call should cancel the drag by making j_OK=0. I think it may have something to do with the image inside... the object: <em style=position:absolute;left:0;top:0;width:32;height:32;display:block> < img src=abc.gif onmousedown=P_MV(this.parentNode) style=position:absolute;left:0;top:0;width:inherit> </em> function P_MV(t) { p_E=t j_oy=parseInt(p_E.style.top) j_ox=parseInt(p_E.style.left) j_OK=1 document.onselectstart=function(){return false} document.onmousemove=P_MVy } function P_MVy(e) { if(j_OK) { p_E.style.top=(j_FF?e.clientY:event.clientY)-j_y+j_oy p_E.style.left=(j_FF?e.clientX:event.clientX)-j_x+j_ox } return false }

    Read the article

  • How can I define pre/post-increment behavior in Perl objects?

    - by Zaid
    Date::Simple objects display this behavior. In the case of Date::Simple objects, $date++ returns the next day's date. Date::Simple objects are immutable. After assigning $date1 to $date2, no change to $date1 can affect $date2. This means, for example, that there is nothing like a set_year operation, and $date++ assigns a new object to $date. How can one custom define the pre/post-incremental behavior of an object, such that ++$object or $object-- performs a particular action? I've skimmed over perlboot, perltoot, perltooc and perlbot, but I don't see any examples showing how this can be done.

    Read the article

  • Error when trying to use PDO object

    - by Nate
    EDIT: I'm going to put my code in here due to comments below. So sit tight for a few minutes ;-) Thanks! I'm an inexperienced php programmer and only found out about PDO a few days ago. I'm now trying to port my website code over to using PDO, but I am getting an error when I try to use the PDO object that I create. I'm using a CMS on my website, and it makes building page output kind of complicated, but I've tried to draw the structure of what is being called below: index.php -class myClass defined --method myFunction defined (it gets called on pageload & returns the page output) ---include file1.php ----require_once('mysql_connect.php') (creates pdo object) ----*I can use the pdo object here successfully* ----require_once('file2.php') -----require_once('mysql_connect.php') -----function myFunction2 defined ------*trying to use the pdo object here results in the error* The error I'm getting is: Fatal error: Call to a member function prepare() on a non-object in /home/rgcpanel/public_html/account/account_functions.php on line 147 Any idea what's going on?

    Read the article

  • json object composition details

    - by Ethan
    in .json text, is the 'value' in a basic single pair object the title of a value type (e.g. [string, number, object]), or a value for a typed object (e.g. 2, or "dog", or Object3)? This is how http://www.json.org/ presents the information: "An object is an unordered set of name/value pairs. An object begins with { (left brace) and ends with } (right brace). Each name is followed by : (colon) and the name/value pairs are separated by , (comma)."

    Read the article

  • ActionScript 2.0 problem with the object's _visible parameter

    - by GMan
    Hey guys, I've been trying to build something simple in Flash 8, and I stumbled across something weird I cannot explain: I have an object, and at some point of the program, I want it to be visible (it is invisible at first), so I write: _root.myObj._visible = true; _root.gameOver.swapDepths(_root.getNextHighestDepth()); //so it will be on the top and this works fine, the object becomes visible and etc. What I planned to happen next is that the user presses a button on that same object, and the object will go invisible: on(release) { trace(_root.myObj._visible); _root.myObj._visible = false; trace(_root.myObj._visible); _root.gotoAndPlay("three"); } The trace returns at first true and later on false, so the command works, but oddly the object stays visible, that's what I don't understand. Thanks everybody in advance.

    Read the article

  • Mocking methods that call other methods Still hit database.Can I avoid it?

    - by devnet247
    Hi, It has been decided to write some unit tests using moq etc..It's lots of legacy code c# (this is beyond my control so cannot answer the whys of this) Now how do you cope with a scenario when you dont want to hit the database but you indirectly still hit the database? This is something I put together it's not the real code but gives you an idea. How would you deal with this sort of scenario? Basically calling a method on a mocked interface still makes a dal call as inside that method there are other methods not part of that interface?Hope it's clear [TestFixture] public class Can_Test_this_legacy_code { [Test] public void Should_be_able_to_mock_login() { var mock = new Mock<ILoginDal>(); User user; var userName = "Jo"; var password = "password"; mock.Setup(x => x.login(It.IsAny<string>(), It.IsAny<string>(),out user)); var bizLogin = new BizLogin(mock.Object); bizLogin.Login(userName, password, out user); } } public class BizLogin { private readonly ILoginDal _login; public BizLogin(ILoginDal login) { _login = login; } public void Login(string userName, string password, out User user) { //Even if I dont want to this will call the DAL!!!!! var bizPermission = new BizPermission(); var permissionList = bizPermission.GetPermissions(userName); //Method I am actually testing _login.login(userName,password,out user); } } public class BizPermission { public List<Permission>GetPermissions(string userName) { var dal=new PermissionDal(); var permissionlist= dal.GetPermissions(userName); return permissionlist; } } public class PermissionDal { public List<Permission> GetPermissions(string userName) { //I SHOULD NOT BE GETTING HERE!!!!!! return new List<Permission>(); } } public interface ILoginDal { void login(string userName, string password,out User user); } public interface IOtherStuffDal { List<Permission> GetPermissions(); } public class Permission { public int Id { get; set; } public string Name { get; set; } } Any suggestions? Am I missing the obvious? Is this Untestable code? Very very grateful for any suggestions.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • How to unit test private methods in BDD / TDD?

    - by robert_d
    I am trying to program according to Behavior Driven Development, which states that no line of code should be written without writing failing unit test first. My question is, how to use BDD with private methods? How can I unit test private methods? Is there better solution than: - making private methods public first and then making them private when I write public method that uses those private methods; or - in C# making all private methods internal and using InternalsVisibleTo attribute. Robert

    Read the article

  • PHP Type Hinting: array supported, object NOT?

    - by Marius Burz
    Am I missing something or there really is no support for generic object type hinting in PHP 5.x? I find it really strange that hinting arrays is supported while hinting objects is not, at least not out of the box. I'd like to have something like this: function foo(object $o) Just as we have: function foo(array $o) Example of possible use: methods of an objects collection class. Workaround: using an interface "Object" implemented by all classes or extending all classes from a generic class "Object" and writing something like this: function foo(Object $o) Well, that just ain't cute. Edit: somebody suggested in a deleted post using stdClass. It doesn't work: Catchable fatal error: Argument 1 passed to c::add() must be an instance of stdClass, instance of b given

    Read the article

  • Web Service returning object with null fields

    - by Xaiter
    Never seen this one before. WebService.Implementation imp = new WebService.Implementation(); WebService.ImplementationRequest req = new WebService.ImplementationRequest(); return imp.GetValue(req); The object that imp returns is not null. It's returning an ImplementationResponse, as expected. But all of the fields in that object are null. Which is not expected. The WebService, currently, just returns some constant dummy data. We've tested this on another developer's machine, works just fine. I suppose I should also note that the WebService should throw an exception if I pass null into the GetValue method. It doesn't. Not for me. Any idea what could be wrong with my environment that could make a WebService return an object, but make every value in that object null? And somehow 'magically' return this mystery object when it should be throwing an exception?

    Read the article

  • Ext.app.application object is erased after initialization

    - by Queequeg
    I am trying to organize an existing extjs code in a more standard order (extjs wise). extjs version: extjs-4.0.2a. I've worked through the Extjs tutorial example and every thing went well. When I started working on the company's code I've notice there is no use of the application object there for I've added the Ext.application({...}); call. Ext.application({ name: 'FOO', appFolder: 'appFolderName', launch: function() { console.log('application was created'); } }); Upon loading the page I see the console.log output that is included in the "launch" function property - meaning the application object is created but when I look for it ("FOO" object) under the "window" object it is not there. Compering to the tutorial code the application object exist as a property of window. I encounter a few loading problems but I'm guessing the source of it all is this issue. What am I doing wrong? thanks.

    Read the article

  • a completely decoupled OO system ?

    - by shrini1000
    To make an OO system as decoupled as possible, I'm thinking of the following approach: 1) we run an RMI/directory like service where objects can register and discover each other. They talk to this service through an interface 2) we run a messaging service to which objects can publish messages, and register subscription callbacks. Again, this happens through interfaces 3) when object A wants to invoke a method on object B, it discovers the target object's unique identity through #1 above, and publishes a message on the message service for object B 4) message services invokes B's callback to give it the message 5) B processes the request and sends the response for A on message service 6) A's callback is called and it gets the response. I feel this system is as decoupled as practically possible, but it has the following problems: 1) communication is typically asynchronous 2) hence it's non real time 3) the system as a whole is less efficient. Are there any other practical problems where this design obviously won't be applicable ? What are your thoughts on this design in general ?

    Read the article

< Previous Page | 89 90 91 92 93 94 95 96 97 98 99 100  | Next Page >