Search Results

Search found 24931 results on 998 pages for 'information visualization'.

Page 930/998 | < Previous Page | 926 927 928 929 930 931 932 933 934 935 936 937  | Next Page >

  • web service filling gridview awfully slow, as is paging/sorting

    - by nat
    Hi I am making a page which calls a web service to fill a gridview this is returning alot of data, and is horribly slow. i ran the svcutil.exe on the wsdl page and it generated me the class and config so i have a load of strongly typed objects coming back from each request to the many service functions. i am then using LINQ to loop around the objects grabbing the necessary information as i go, but for each row in the grid i need to loop around an object, and grab another list of objects (from the same request) and loop around each of them.. 1 to many parent object child one.. all of this then gets dropped into a custom datatable a row at a time.. hope that makes sense.... im not sure there is any way to speed up the initial load. but surely i should be able to page/sort alot faster than it is doing. as at the moment, it appears to be taking as long to page/sort as it is to load initially. i thought if when i first loaded i put the datasource of the grid in the session, that i could whip it out of the session to deal with paging/sorting and the like. basically it is doing the below protected void Page_Load(object sender, EventArgs e) { //init the datatable //grab the filter vars (if there are any) WebServiceObj WS = WSClient.Method(args); //fill the datatable (around and around we go) foreach (ParentObject po in WS.ReturnedObj) { var COs = from ChildObject c in WS.AnotherReturnedObj where c.whatever.equals(...) ...etc foreach(ChildObject c in COs){ myDataTable.Rows.Add(tlo.this, tlo.that, c.thisthing, c.thatthing, etc......); } } grdListing.DataSource = myDataTable; Session["dt"] = myDataTable; grdListing.DataBind(); } protected void Listing_PageIndexChanging(object sender, GridViewPageEventArgs e) { grdListing.PageIndex = e.NewPageIndex; grdListing.DataSource = Session["dt"] as DataTable; grdListing.DataBind(); } protected void Listing_Sorting(object sender, GridViewSortEventArgs e) { DataTable dt = Session["dt"] as DataTable; DataView dv = new DataView(dt); string sortDirection = " ASC"; if (e.SortDirection == SortDirection.Descending) sortDirection = " DESC"; dv.Sort = e.SortExpression + sortDirection; grdListing.DataSource = dv.ToTable(); grdListing.DataBind(); } am i doing this totally wrongly? or is the slowness just coming from the amount of data being bound in/return from the Web Service.. there are maybe 15 columns(ish) and a whole load of rows.. with more being added to the data the webservice is querying from all the time any suggestions / tips happily received thanks

    Read the article

  • dynamic module creation

    - by intuited
    I'd like to dynamically create a module from a dictionary, and I'm wondering if adding an element to sys.modules is really the best way to do this. EG context = { a: 1, b: 2 } import types test_context_module = types.ModuleType('TestContext', 'Module created to provide a context for tests') test_context_module.__dict__.update(context) import sys sys.modules['TestContext'] = test_context_module My immediate goal in this regard is to be able to provide a context for timing test execution: import timeit timeit.Timer('a + b', 'from TestContext import *') It seems that there are other ways to do this, since the Timer constructor takes objects as well as strings. I'm still interested in learning how to do this though, since a) it has other potential applications; and b) I'm not sure exactly how to use objects with the Timer constructor; doing so may prove to be less appropriate than this approach in some circumstances. EDITS/REVELATIONS/PHOOEYS/EUREKAE: I've realized that the example code relating to running timing tests won't actually work, because import * only works at the module level, and the context in which that statement is executed is that of a function in the testit module. In other words, the globals dictionary used when executing that code is that of main, since that's where I was when I wrote the code in the interactive shell. So that rationale for figuring this out is a bit botched, but it's still a valid question. I've discovered that the code run in the first set of examples has the undesirable effect that the namespace in which the newly created module's code executes is that of the module in which it was declared, not its own module. This is like way weird, and could lead to all sorts of unexpected rattlesnakeic sketchiness. So I'm pretty sure that this is not how this sort of thing is meant to be done, if it is in fact something that the Guido doth shine upon. The similar-but-subtly-different case of dynamically loading a module from a file that is not in python's include path is quite easily accomplished using imp.load_source('NewModuleName', 'path/to/module/module_to_load.py'). This does load the module into sys.modules. However this doesn't really answer my question, because really, what if you're running python on an embedded platform with no filesystem? I'm battling a considerable case of information overload at the moment, so I could be mistaken, but there doesn't seem to be anything in the imp module that's capable of this. But the question, essentially, at this point is how to set the global (ie module) context for an object. Maybe I should ask that more specifically? And at a larger scope, how to get Python to do this while shoehorning objects into a given module?

    Read the article

  • Can this be improved? Scrubing of dangerous html tags.

    - by chobo2
    I been finding that for something that I consider pretty import there is very little information or libraries on how to deal with this problem. I found this while searching. I really don't know all the million ways that a hacker could try to insert the dangerous tags. I have a rich html editor so I need to keep non dangerous tags but strip out bad ones. So is this script missing anything? It uses html agility pack. public string ScrubHTML(string html) { HtmlDocument doc = new HtmlDocument(); doc.LoadHtml(html); //Remove potentially harmful elements HtmlNodeCollection nc = doc.DocumentNode.SelectNodes("//script|//link|//iframe|//frameset|//frame|//applet|//object|//embed"); if (nc != null) { foreach (HtmlNode node in nc) { node.ParentNode.RemoveChild(node, false); } } //remove hrefs to java/j/vbscript URLs nc = doc.DocumentNode.SelectNodes("//a[starts-with(translate(@href, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'javascript')]|//a[starts-with(translate(@href, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'jscript')]|//a[starts-with(translate(@href, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'vbscript')]"); if (nc != null) { foreach (HtmlNode node in nc) { node.SetAttributeValue("href", "#"); } } //remove img with refs to java/j/vbscript URLs nc = doc.DocumentNode.SelectNodes("//img[starts-with(translate(@src, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'javascript')]|//img[starts-with(translate(@src, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'jscript')]|//img[starts-with(translate(@src, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'vbscript')]"); if (nc != null) { foreach (HtmlNode node in nc) { node.SetAttributeValue("src", "#"); } } //remove on<Event> handlers from all tags nc = doc.DocumentNode.SelectNodes("//*[@onclick or @onmouseover or @onfocus or @onblur or @onmouseout or @ondoubleclick or @onload or @onunload]"); if (nc != null) { foreach (HtmlNode node in nc) { node.Attributes.Remove("onFocus"); node.Attributes.Remove("onBlur"); node.Attributes.Remove("onClick"); node.Attributes.Remove("onMouseOver"); node.Attributes.Remove("onMouseOut"); node.Attributes.Remove("onDoubleClick"); node.Attributes.Remove("onLoad"); node.Attributes.Remove("onUnload"); } } // remove any style attributes that contain the word expression (IE evaluates this as script) nc = doc.DocumentNode.SelectNodes("//*[contains(translate(@style, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'expression')]"); if (nc != null) { foreach (HtmlNode node in nc) { node.Attributes.Remove("stYle"); } } return doc.DocumentNode.WriteTo(); }

    Read the article

  • jQuery: modify hidden form field value before submit

    - by Jason Miesionczek
    I have the following code in a partial view (using Spark): <span id="selectCount">0</span> video(s) selected. <for each="var video in Model"> <div style="padding: 3px; margin:2px" class="video_choice" id="${video.YouTubeID}"> <span id="video_name">${video.Name}</span><br/> <for each="var thumb in video.Thumbnails"> <img src="${thumb}" /> </for> </div> </for> # using(Html.BeginForm("YouTubeVideos","Profile", FormMethod.Post, new { id = "youTubeForm" })) # { <input type="hidden" id="video_names" name="video_names" /> <input type="submit" value="add selected"/> # } <ScriptBlock> $(".video_choice").click(function() { $(this).toggleClass('selected'); var count = $(".selected").length; $("#selectCount").html(count); }); var options = { target: '#videos', beforeSubmit: function(arr, form, opts) { var names = []; $(".selected").each(function() { names[names.length] = $(this).attr('id'); }); var namestring = names.join(","); $("#video_names").attr('value',namestring); //alert(namestring); //arr["video_names"] = namestring; //alert($.param(arr)); //alert($("#video_names").attr('value')); return true; } }; $("#youTubeForm").ajaxForm(options); </ScriptBlock> Essentially i display a series of divs that contain information pulled from the YouTube API. I use jQuery to allow the the user to select which videos they would like to add to their profile. When i submit the form i would like to populate the hidden field with a comma separated list of video ids. Everything works except that when i try to set the value of the field, in the controller on post, the field comes back empty. I am using the jQuery ajax form plugin. What am i doing wrong that is not allowing the value i set in the field to be sent to the server?

    Read the article

  • How to salvage SQL server 2008 query from KILLED/ROLLBACK state without waiting half a day?

    - by littlegreen
    I have a stored procedure that inserts batches of millions of rows, emerging from a certain query, into an SQL database. It has one parameter selecting the batch; when this parameter is omitted, it will gather a list of batches and recursively call itself, in order to iterate over batches. In (pseudo-)code, it looks something like this: CREATE PROCEDURE spProcedure AS BEGIN IF @code = 0 BEGIN ... WHILE @@Fetch_Status=0 BEGIN EXEC spProcedure @code FETCH NEXT ... INTO @code END END ELSE BEGIN -- Disable indexes ... INSERT INTO table SELECT (...) -- Enable indexes ... Now it can happen that this procedure is slow, for whatever reason: it can't get a lock, one of the indexes it uses is misdefined or disabled. In that case, I want to be able kill the procedure, truncate and recreate the resulting table, and try again. However, when I try and kill the procedure, the process frequently oozes into a KILLED/ROLLBACK state from which there seems to be no return. From Google I have learned to do an sp_lock, find the spid, and then kill it with KILL <spid>. But when I try to kill it, it tells me SPID 75: transaction rollback in progress. Estimated rollback completion: 0%. Estimated time remaining: 554 seconds. I did find a forum message hinting that another spid should be killed before the other one can start a rollback. But that didn't work for me either, plus I do not understand, why that would be the case... could it be because I am recursively calling my own stored procedure? (But it should be having the same spid, right?) In any case, my process is just sitting there, being dead, not responding to kills, and locking the table. This is very frustrating, as I want to go on developing my queries, not waiting hours on my server sitting dead while pretending to be finishing a supposed rollback. Is there some way in which I can tell the server not to store any rollback information for my query? Or not to allow any other queries to interfere with the rollback, so that it will not take so long? Or how to rewrite my query in a better way, or how kill the process successfully without restarting the server?

    Read the article

  • Changing Data in ListView

    - by legr3c
    Hi In my app I use a ListView to display data from the database. The data changes sometimes, for example when the user applies new filters or changes the sorting method. I use AsyncTask to get the databsase cursor that points to the new data set because sometimes data needs to be loaded from the net which can take some time. What I do now looks something like this: private class updateTask extends AsyncTask<Void, Void, Void> { /* * runs on the UI thread before doInBackground */ @Override protected void onPreExecute(){ // prepare some stuff... } /* * runs in a separate thread * used for time-consuming loading operation */ @Override protected Void doInBackground() { //get new database cursor mCursor = mDbAdapter.getCursor(); return null; } /* * runs on the UI thread after doInBackground */ @Override protected void onPostExecute(Void result){ if(mCursor!=null){ MyActivity.this.startManagingCursor(mCursor); mCursorAdapter = new MyCustomCursorAdapter(MyActivity.this, mCursor); mListView.setAdapter(mCursorAdapter); } } } This works so far but I realize that creating a new CursorAdapter and calling setAdapter on my ListView each time isn't the correct way to do it. Also, after setAdapter the scroll position of the list is set back to the top. I found this post which describes how to do it properly. So now I want to do something like this: onCreate(){ // ... // create the CursorAdapter using null as the initial cursor MyCustomCursorAdapter cursorAdapter = new MyCustomCursorAdapter(this, null); mListView.setAdapter(cursorAdapter); // ... } private class updateTask extends AsyncTask<Void, Void, Void> { /* * runs on the UI thread before doInBackground */ @Override protected void onPreExecute(){ // prepare some stuff... } /* * runs in a separate thread * used for time-consuming loading operation */ @Override protected Void doInBackground() { //get new database cursor mCursor = mDbAdapter.getCursor(); return null; } /* * runs on the UI thread after doInBackground */ @Override protected void onPostExecute(Void result){ // this returns null! MyCustomCursorAdapter cursorAdapter = (MyCustomCursorAdapter)mListView.getAdapter(); Cursor oldCursor = cursorAdapter.getCursor(); if(oldCursor!=null){ MyActivity.this.stopManagingCursor(oldCursor); oldCursor.close(); } if(mCursor!=null){ MyActivity.this.startManagingCursor(mCursor); cursorAdapter.changeCursor(mCursor); } } } This however doesn't work for me because (MyCustomCursorAdapter)mListView.getAdapter(); always returns null. Why does this happen? What am I doing wrong? Edit: Some additional information: my adapter implements SectionIndexer. I don't really think that this has anything to do with my problem but it has caused me some troubles before so I thought I'd mention it.

    Read the article

  • Web SITE publishing, dynamic compilation, smoke & mirrors

    - by tbehunin
    When you publish a web SITE in Visual Studio, in the dialog box that follows, you are given an option to "Allow this precompiled site to be updatable". According to MSDN, checking this option "specifies that all program code is compiled into assemblies, but that .aspx files (including single-file ASP.NET Web pages) are copied as-is to the target folder". With this option checked, you can update existing .aspx files as well as add new ones without any issue. When a page, that has either been updated or newly created, is requested, the page gets dynamically compiled at run-time and is then processed and returned to the user. If, on the other hand, you didn't check that checkbox during the publish phase, the .aspx files get compiled, along with the code-behind and App_Code files in separate assemblies. The .aspx files are then completely overwritten with a line of text that says: This is a marker file generated by the precompilation tool, and should not be deleted! You obviously can't edit an existing page in this scenario. If you were to ADD a new .aspx file to this site, you would get a .Net run-time error saying that the file hasn't been precompiled. With that background, my questions are these: Something must be able to determine that this website was published to be updatable (allow dynamic compilation) or not. If it was published as updatable, it must also be able to determine whether a file was changed or added, so it can do a dynamic compile. Who makes those determinations? IIS? ASP.NET worker process? HOW does it make those determinations? If I had the same website published in both of those scenarios, could I make a visual determination that one is updatable and the other is not? Is there some bit I can look at in the assemblies using Reflector to make that determination myself? In addition to answering those questions, what also might be helpful would be information on the process flow from when a resource is requested to when it starts being processed, not necessarily the ASP.NET Page Lifecycle, but what happens BEFORE ASP.Net worker process starts processing the page and firing off events. The dynamic compilation appears to be smoke and mirrors. Can someone demystify this for me?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • C++ Class Access Specifier Verbosity

    - by PolyTex
    A "traditional" C++ class (just some random declarations) might resemble the following: class Foo { public: Foo(); explicit Foo(const std::string&); ~Foo(); enum FooState { Idle, Busy, Unknown }; FooState GetState() const; bool GetBar() const; void SetBaz(int); private: struct FooPartialImpl; void HelperFunction1(); void HelperFunction2(); void HelperFunction3(); FooPartialImpl* m_impl; // smart ptr FooState m_state; bool m_bar; int m_baz; }; I always found this type of access level specification ugly and difficult to follow if the original programmer didn't organize his "access regions" neatly. Taking a look at the same snippet in a Java/C# style, we get: class Foo { public: Foo(); public: explicit Foo(const std::string&); public: ~Foo(); public: enum FooState { Idle, Busy, Unknown }; public: FooState GetState() const; public: bool GetBar() const; public: void SetBaz(int); private: struct FooPartialImpl; private: void HelperFunction1(); private: void HelperFunction2(); private: void HelperFunction3(); private: FooPartialImpl* m_impl; // smart ptr private: FooState m_state; private: bool m_bar; private: int m_baz; }; In my opinion, this is much easier to read in a header because the access specifier is right next to the target, and not a bunch of lines away. I found this especially true when working with header-only template code that wasn't separated into the usual "*.hpp/*.inl" pair. In that scenario, the size of the function implementations overpowered this small but important information. My question is simple and stems from the fact that I've never seen anyone else actively do this in their C++ code. Assuming that I don't have a "Class View" capable IDE, are there any obvious drawbacks to using this level of verbosity? Any other style recommendations are welcome!

    Read the article

  • Android Google Analytics

    - by ibenot
    I'm trying to use Google Analytics in my Android application with Google Configuration Add .jar in my project Insert this in AndroidManifest Add this in my java file public class MainActivity extends Activity { GoogleAnalyticsTracker tracker; @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); tracker = GoogleAnalyticsTracker.getInstance(); tracker.startNewSession("My-UA–XXXXXXXX", this); setContentView(R.layout.main); Button createEventButton = (Button)findViewById(R.id.NewEventButton); createEventButton.setOnClickListener(new OnClickListener() { @Override public void onClick(View v) { tracker.trackEvent( "Clicks", // Category "Button", // Action "clicked", // Label 77); // Value } }); setContentView(R.layout.main); Button createPageButton = (Button)findViewById(R.id.NewPageButton); createPageButton.setOnClickListener(new OnClickListener() { @Override public void onClick(View v) { // Add a Custom Variable to this pageview, with name of "Medium" and value "MobileApp" and // scope of session-level. tracker.setCustomVar(1, "Navigation Type", "Button click", 2); // Track a page view. This is probably the best way to track which parts of your application // are being used. // E.g. // tracker.trackPageView("/help"); to track someone looking at the help screen. // tracker.trackPageView("/level2"); to track someone reaching level 2 in a game. // tracker.trackPageView("/uploadScreen"); to track someone using an upload screen. tracker.trackPageView("/testApplicationHomeScreen"); } }); Button quitButton = (Button)findViewById(R.id.QuitButton); quitButton.setOnClickListener(new OnClickListener() { @Override public void onClick(View v) { finish(); } }); Button dispatchButton = (Button)findViewById(R.id.DispatchButton); dispatchButton.setOnClickListener(new OnClickListener() { @Override public void onClick(View v) { // Manually start a dispatch, not needed if the tracker was started with a dispatch // interval. tracker.dispatch(); } }); } @Override protected void onDestroy() { super.onDestroy(); // Stop the tracker when it is no longer needed. tracker.stopSession(); } } == And it's ok, no error, compiling and executing but i have created my ua account yesterday (more 24h) and i have nothing in my google analytics panel. My Question : is there an error in my code or i want to wait again ? Live trafic works for Android application (like tradicional website) ??? I have no information about Live trafic (when i play my app, i would like to show the number of person using my application) and Saved trafic (with viewed pages, time) Thank you for your replies and excuse my poor english :) bye

    Read the article

  • Embedded "Smart" character LCD driver. Is this a good idea?

    - by chris12892
    I have an embedded project that I am working on, and I am currently coding the character LCD driver. At the moment, the LCD driver only supports "dumb" writing. For example, let's say line 1 has some text on it, and I make a call to the function that writes to the line. The function will simply seek to the beginning of the line and write the text (plus enough whitespace to erase whatever was last written). This is well and good, but I get the feeling it is horribly inefficient sometimes, since some lines are simply: "Some-reading: some-Value" Rather than "brute force" replacing the entire line, I wanted to develop some code that would figure out the best way to update the information on the LCD. (just as background, it takes 2 bytes to seek to any char position. I can then begin writing the string) My idea was to first have a loop. This loop would compare the input to the last write, and in doing so, it would cover two things: A: Collect all the differences between the last write and the input. For every contiguous segment (be it same or different) add two bytes to the byte count. This is referenced in B to determine if we are wasting serial bandwidth. B: The loop would determine if this is really a smart thing to do. If we end up using more bytes to update the line than to "brute force" the line, then we should just return and let the brute force method take over. We should exit the smart write function as soon as this condition is met to avoid wasting time. The next part of the function would take all the differences, seek to the required char on the LCD, and write them. Thus, if we have a string like this already on the LCD: "Current Temp: 80F" and we want to update it to "Current Temp: 79F" The function will go through and see that it would take less bandwidth to simply seek to the "8" and write "79". The "7" will cover the "8" and the "9" will cover the "0". That way, we don't waste time writing out the entire string. Does this seem like a practical idea?

    Read the article

  • OpenGL, how to set a monochrome texture to a colored shape?

    - by Santiago
    I'm developing on Android with OpenGL ES, I draw some cubes and I change its colors with glColor4f. Now, what I want is to give a more realistic effect on the cubes, so I create a monochromatic 8bit depth, 64x64 pixel size PNG file. I loaded on a texture, and here is my problem, witch is the way to combine the color and the texture to get a colorized and textured cubes onto the screen? I'm not an expert on OpenGL, I tried this: On create: public void asignBitmap(GL10 gl, Bitmap bitmap) { int[] textures = new int[1]; gl.glGenTextures(1, textures, 0); mTexture = textures[0]; gl.glBindTexture(GL10.GL_TEXTURE_2D, mTexture); gl.glTexParameterf(GL10.GL_TEXTURE_2D, GL10.GL_TEXTURE_MIN_FILTER, GL10.GL_NEAREST); gl.glTexParameterf(GL10.GL_TEXTURE_2D, GL10.GL_TEXTURE_MAG_FILTER, GL10.GL_LINEAR); gl.glTexParameterf(GL10.GL_TEXTURE_2D, GL10.GL_TEXTURE_WRAP_S, GL10.GL_CLAMP_TO_EDGE); gl.glTexParameterf(GL10.GL_TEXTURE_2D, GL10.GL_TEXTURE_WRAP_T, GL10.GL_CLAMP_TO_EDGE); gl.glTexEnvf(GL10.GL_TEXTURE_ENV, GL10.GL_TEXTURE_ENV_MODE, GL10.GL_REPLACE); GLUtils.texImage2D(GL10.GL_TEXTURE_2D, 0, GL10.GL_ALPHA, bitmap, 0); ByteBuffer tbb = ByteBuffer.allocateDirect(texCoords.length * 4); tbb.order(ByteOrder.nativeOrder()); mTexBuffer = tbb.asFloatBuffer(); for (int i = 0; i < 48; i++) mTexBuffer.put(texCoords[i]); mTexBuffer.position(0); } And OnDraw: public void draw(GL10 gl, int alphawires) { gl.glColor4f(1.0f, 0.0f, 0.0f, 0.5f); //RED gl.glBindTexture(GL10.GL_TEXTURE_2D, mTexture); gl.glBlendFunc(GL10.GL_SRC_ALPHA, GL10.GL_ONE_MINUS_SRC_ALPHA); gl.glEnable(GL10.GL_TEXTURE_2D); gl.glEnable(GL10.GL_BLEND); gl.glEnableClientState(GL10.GL_TEXTURE_COORD_ARRAY); gl.glTexCoordPointer(2, GL10.GL_FLOAT, 0, mTexBuffer); //Set the face rotation gl.glFrontFace(GL10.GL_CW); //Point to our buffers gl.glVertexPointer(3, GL10.GL_FLOAT, 0, vertexBuffer); //Enable the vertex and color state gl.glEnableClientState(GL10.GL_VERTEX_ARRAY); //Draw the vertices as triangles, based on the Index Buffer information gl.glDrawElements(GL10.GL_TRIANGLES, 36, GL10.GL_UNSIGNED_BYTE, indexBuffer); //Disable the client state before leaving gl.glDisableClientState(GL10.GL_VERTEX_ARRAY); gl.glDisableClientState(GL10.GL_TEXTURE_COORD_ARRAY); gl.glDisable(GL10.GL_BLEND); gl.glDisable(GL10.GL_TEXTURE_2D); } I'm even not sure if I have to use a blend option, because I don't need transparency, but is a plus :)

    Read the article

  • How do I write sql data into a textbox after a submit type event

    - by Matt
    Finishing up some homework and Im having trouble with figuring out how to take information generated in sql column(a primary key set up to assign a record number to a customer example 1046) at submit and writing it to my redirected recipt page. I call it recipt.aspx. Any takers Professor says to use a datareader...but things go bad after that. public partial class _Default : System.Web.UI.Page { String cnStr = "EDITED FOR THE PURPOSE OF NOT DISPLAYED SQL SERVERta Source=111.11.111.11; uid=xxxxxxx; password=xxxx; database=xxxxxx; "; String insertStr; SqlDataReader reader; SqlConnection myConnection = new SqlConnection(); protected void submitbutton_Click(object sender, EventArgs e) { myConnection.ConnectionString = cnStr; try { //more magic happens as myConnection opens myConnection.Open(); insertStr = "insert into connectAssignment values ('" + TextBox2.Text + "','" + TextBox3.Text + "','" + TextBox4.Text + "','" + TextBox5.Text + "','" + bigtextthing.Text + "','" + DropDownList1.SelectedItem.Value + "')"; //magic happens as Connection string is assigned to connection object and passes in the SQL statment //associate the command to the the myConnection connection object SqlCommand cmd = new SqlCommand(insertStr, myConnection); cmd.ExecuteNonQuery(); Session["passmyvalue1"] = TextBox2.Text; Session["passmyvalue2"] = TextBox3.Text; Session["passmyvalue3"] = TextBox4.Text; Session["passmyvalue4"] = TextBox5.Text; Session["passmyvalue5"] = bigtextthing.Text; Session["I NEED SOME HELP RIGHT HERE"] =Textbox6.Text; Response.Redirect("receipt.aspx"); } catch { bigtextthing.Text = "Error submitting" + "Possible casues: Internet is down,server is down, check your settings!"; } finally { myConnection.Close(); TextBox2.Text = ""; TextBox3.Text = ""; TextBox4.Text = ""; TextBox5.Text = ""; bigtextthing.Text = ""; } //reset validators? } The recipt page public partial class _Default : System.Web.UI.Page { protected void Page_Load(object sender, EventArgs e) { if(Session["passmyvalue1"] != null) { TextBox1.Text = (string)Session["passmyvalue1"]; TextBox2.Text = (string)Session["passmyvalue2"]; TextBox3.Text = (string)Session["passmyvalue3"]; TextBox4.Text = (string)Session["passmyvalue4"]; TextBox5.Text = (string)Session["passmyvalue5"]; TextBox6.Text = I don't know ; } } } THanks for the help

    Read the article

  • What is an overloaded operator in c++?

    - by Jeff
    I realize this is a basic question but I have searched online, been to cplusplus.com, read through my book, and I can't seem to grasp the concept of overloaded operators. A specific example from cplusplus.com is: // vectors: overloading operators example #include <iostream> using namespace std; class CVector { public: int x,y; CVector () {}; CVector (int,int); CVector operator + (CVector); }; CVector::CVector (int a, int b) { x = a; y = b; } CVector CVector::operator+ (CVector param) { CVector temp; temp.x = x + param.x; temp.y = y + param.y; return (temp); } int main () { CVector a (3,1); CVector b (1,2); CVector c; c = a + b; cout << c.x << "," << c.y; return 0; } from http://www.cplusplus.com/doc/tutorial/classes2/ but reading through it I'm still not understanding them at all. I just need a basic example of the point of the overloaded operator (which I assume is the "CVector CVector::operator+ (CVector param)"). There's also this example from wikipedia: Time operator+(const Time& lhs, const Time& rhs) { Time temp = lhs; temp.seconds += rhs.seconds; if (temp.seconds >= 60) { temp.seconds -= 60; temp.minutes++; } temp.minutes += rhs.minutes; if (temp.minutes >= 60) { temp.minutes -= 60; temp.hours++; } temp.hours += rhs.hours; return temp; } from "http://en.wikipedia.org/wiki/Operator_overloading" The current assignment I'm working on I need to overload a ++ and a -- operator. Thanks in advance for the information and sorry about the somewhat vague question, unfortunately I'm just not sure on it at all.

    Read the article

  • CodeIgniter Third party class not loading

    - by Jatin Soni
    I am trying to implement Dashboard widget class (found here: http://harpanet.com/programming/php/codeigniter/dashboard/index#installation) but it is giving me error Unable to load the requested class I have tried to add this class in autoload as well as menually to my controller $this->load->library('dash') but this also giving the same error. I have checked dash.php and found below method private function __example__() but can't understand what the developer is saying in comment. class Dash { private function __example__() { /* * This function is purely to show an example of a dashboard method to place * within your own controller. */ // load third_party hArpanet dashboard library $this->load->add_package_path(APPPATH.'third_party/hArpanet/hDash/'); $dash =& $this->load->library('dash'); $this->load->remove_package_path(APPPATH.'third_party/hArpanet/hDash/'); // configure dashboard widgets - format: type, src, title, cols, alt (for images) $dash->widgets = array( array('type'=>'oop', 'src'=>'test_dash', 'title'=>'Test OOP Widget', 'cols'=>3), // if 'title' is set to FALSE, the title block is omitted entirely // note: this is an 'html' widget but is being fed content from a local method array('type'=>'html', 'src'=>self::test_method(), 'title'=>false, 'cols'=>3), array('type'=>'file', 'src'=>'saf_inv.htm', 'title'=>'Safety Investigation'), // multi-content widget - set widget title in outer array (also note use of CI anchor to create a link) array('title'=>anchor('tz', 'TARGET ZERO'), // sub-content follows same array format as single content widget // 'img' content can also have an 'alt' text array('type'=>'img', 'src'=>'saf_tzout.gif', 'alt'=>'Action Completed'), array('type'=>'file', 'src'=>'saf_tz.htm'), array('type'=>'file', 'src'=>'ave_close.htm', 'title'=>'Average Time to Close') ), array('type'=>'file', 'src'=>'saf_meet.htm', 'title'=>'Safety Meeting'), array('type'=>'file', 'src'=>'saf_acc.htm', 'title'=>'Accident Investigation'), array('type'=>'file', 'src'=>'saf_hazmat.htm', 'title'=>anchor('hazmat', 'HAZMAT')), array('type'=>'file', 'src'=>'saf_cont.htm', 'title'=>'Loss of Containment'), array('type'=>'file', 'src'=>'saf_worksinfo.htm', 'title'=>'Works Information'), // an action widget - 'clear' will generate a blank widget with a style of clear:both array('type'=>'clear'), // multi-content widget - width can be set using the 'cols' param in outer array array('title'=>'RAG Report', 'cols' => 2, array('type'=>'file', 'src'=>'saf_rag.htm'), array('type'=>'img', 'src'=>'ProcSaf.gif')), array('type'=>'file', 'src'=>'saf_chrom.htm', 'title'=>'Chrome checks'), ); // populate the view variable $widgets = $dash->build('safety'); // render the dashboard $this->load->view('layout_default', $widgets); } ................... } // end of Dash class Installation path is root/application/third_party/hArpanet/hDash/libraries/dash.php How can I load this class to my system and use widgets?

    Read the article

  • Spring 3 MVC - Form Failure Causes Exception When Reloading JSP

    - by jboyd
    Using Spring 3 MVC, please bear with the long code example, it's quite simple, but I want to make sure all relevant information is posted. Basically here is the use case: There is a registration page, a user can login, OR fill out a registration form. The login form is a simple HTML form, the registration form is a more complicated, Spring bound form that uses a RegistrationFormData bean. Here is the relevant code: UserController.java ... @RequestMapping(value = "/login", method = RequestMethod.GET) public String login(Model model) { model.addAttribute("registrationInfo", new ProfileAdminFormData()); return "login"; } ... @RequestMapping(value = "/login.do", method = RequestMethod.POST) public String doLogin( @RequestParam(value = "userName") String userName, @RequestParam(value = "password") String password, Model model) { logger.info("login.do : userName=" + userName + ", password=" + password); try { getUser().login(userName, password); } catch (UserNotFoundException ex) { logger.error(ex); model.addAttribute("loginError", ex.getWebViewableErrorMessage()); return "login"; } return "redirect:/"; } ... @RequestMapping(value = "/register.do") public String register( @ModelAttribute(value = "registrationInfo") ProfileAdminFormData profileAdminFormData, BindingResult result, Model model) { //todo: redirect if (new RegistrationValidator(profileAdminFormData, result).validate()) { try { User().register(profileAdminFormData); return "index"; } catch (UserException ex) { logger.error(ex); model.addAttribute("registrationErrorMessage", ex.getWebViewableErrorMessage()); return "login"; } } return "login"; } and the JSP: ... <form:form commandName="registrationInfo" action="register.do"> ... So the problem here is that when login fails I get an exception because there is no bean "registrationInfo" in the model attributes. What I need is that regardless of the path through this controller that the "registrationInfo" bean is not null, that way if login fails, as opposed to registration, that bean is still in the model. As you can see I create the registrationInfo object explicitly in my controller in the method bound to "/login", which is what I thought was going to be kind of a setup method" Something doesn't feel right about the "/login" method which sets up the page, but I needed to that in order to get the page to render at all without throwing an exception because there is no "registrationInfo" model attribute, as needed by the form in the JSP

    Read the article

  • CSS Hidden DIV Form Submit

    - by Michael
    Using CSS, when a link is clicked it brings up a hidden DIV that contains a form. The user will then enter information and then submit the form. I'd like the hidden DIV to remain visisble, and a 'success message' to be displayed after submission. Then the user will have the option of closing the DIV. I can't get it to work without reloading the page, which causes the DIV to become hidden again. Any ideas? <body> <a href="javascript:showDiv()" style="color: #fff;">Click Me</a> <!--POPUP--> <div id="hideshow" style="visibility:hidden;"> <div id="fade"></div> <div class="popup_block"> <div class="popup"> <a href="javascript:hideDiv()"> <img src="images/icon_close.png" class="cntrl" title="Close" /> </a> <h3>Remove Camper</h3> <form method="post" onsubmit="email.php"> <p><input name="Name" type="text" /></p> <p><input name="Submit" type="submit" value="submit" /></p> </form> <div id="status" style="display:none;">success</div> </div> </div> </div> <!--END POPUP--> <script language=javascript type='text/javascript'> function hideDiv() { if (document.getElementById) { // DOM3 = IE5, NS6 document.getElementById('hideshow').style.visibility = 'hidden'; } else { if (document.layers) { // Netscape 4 document.hideshow.visibility = 'hidden'; } else { // IE 4 document.all.hideshow.style.visibility = 'hidden'; } } } function showDiv() { if (document.getElementById) { // DOM3 = IE5, NS6 document.getElementById('hideshow').style.visibility = 'visible'; } else { if (document.layers) { // Netscape 4 document.hideshow.visibility = 'visible'; } else { // IE 4 document.all.hideshow.style.visibility = 'visible'; } } } </script> </body>

    Read the article

  • Wordpress installed in root folder, subdomain now not working, GoDaddy host

    - by Kristin
    Hi, please forgive me for being a complete beginner at this, I'd rather not have to try to deal with this myself but as GoDaddy support have not replied after 2 days I'm going to have to. I think my problem is the same as the one above, but I'm not 100% sure, so I'm reposting it, I'm not really confident enough to attempt to try the fixes I've seen here so I need someone to give me baby instructions? Our original website (www.mwpics.com.au) was built in Dreamweaver etc, recently we created a new website in Wordpress, in a subdomain, then migrated it over to the root folder where it is now operating fine. I also moved the files for the old website into another directory which I called 'old', so they're all still there. The problem is that I have a subdomain set up - which is still showing as set up in the control panel on godaddy the url is www.mwpics.com.au/clients and it is at www.clients.mwpics.com.au. This directory contains loads of other directories, each of which is password protected by .htaccess files and which our clients access directly (not through the site) to download their finished work. The test one and the one for random clients is www.mwpics.com.au/clients/temp - username and password both temp (the usernames are all the same as the directory names). Since the WP install to the root directory the /clients extension no longer works (it should bring up an information page which is an .html index page in the directory) and the /clients/name extensions no longer works - it goes back to the wp site with a 'not found' error message. Strangely it does bring up the box for the username and password, but when you enter it it just goes back to the 'not found' message. Someone told me it was the .htaccess file - so as an experiment, I renamed the .htaccess file in the root directory and then copied the .htaccess file from the old root files into the root directory, eureka! It worked - and also the WP site opened to the home page... but bummer - the /pages in the WP site now no longer worked! But at least I know the source of the problem. So I switched it back and this is the status quo - I have no idea how to fix this, and with everyone back at work tomorrow, clients are going to want to start downloading their stuff... Can anyone help me? I'm starting to panic a bit

    Read the article

  • Good design of mapping Java Domain objects to Tables (using Hibernate)

    - by M. McKenzie
    Hey guys, I have a question that is more in the realm of design, than implementation. I'm also happy for anyone to point out resources for the answer and I'll gladly, research for myself. Highly simplified Java and SQL: Say I have a business domain POJO called 'Picture' with three attributes. class Picture int idPicture String fileName long size Say I have another business domain POJO called "Item" with 3 attributes Class Item int idItem String itemName ArrayList itemPictures These would be a normal simple relationship. You could say that 'Picture' object, will never exist outside an 'Item' object. Assume a picture belongs only to a specific item, but that an item can have multiple pictures Now - using good database design (3rd Normal Form), we know that we should put items and pictures in their own tables. Here is what I assume would be correct. table Item int idItem (primary key) String itemName table Picture int idPicture (primary key) varchar(45) fileName long size int idItem (foreign key) Here is my question: If you are making Hibernate mapping files for these objects. In the data design, your Picture table needs a column to refer to the Item, so that a foreign key relation can be maintained. However,in your business domain objects - your Picture does not hold a reference/attribute to the idItem - and does not need to know it. A java Picture instance is always instantiated inside an Item instance. If you want to know the Item that the Picture belongs to you are already in the correct scope. Call myItem.getIdItem() and myItem.getItemPictures(),and you have the two pieces of information you need. I know that Hibernate tools have a generator that can auto make your POJO's from looking at your database. My problem stems from the fact that I planned out the data design for this experiment/project first. Then when I went to make the domain java objects, I realized that good design dictated that the objects hold other objects in a nested way. This is obviously different from the way that a database schema is - where all objects(tables) are flat and hold no other complex types within them. What is a good way to reconcile this? Would you: (A) Make the hibernate mapping files so that Picture.hbm.xml has a mapping to the POJO parent's idItem Field (if it's even possible) (B) Add an int attribute in the Picture class to refer to the idItem and set it at instantiation, thus simplifying the hbm.xml mapping file by having all table fields as local attributes in the class (C) Fix the database design because it is wrong, dork. I'd truly appreciate any feedback

    Read the article

  • How to dynamically change the content of a facet in a custom component?

    - by romaintaz
    Hello, Let's consider that I want to extend an existing JSF component, such as the <rich:datatable/>. My main requirement is to dynamically modify the content of a <f:facet>, to change its content. What is the best way to achieve that? Or where is the best place in the code to achieve that? In my faces-config.xml, I have the following declaration: <faces-config> ... <component> <component-type>my.component.dataTable</component-type> <component-class>my.project.component.table.MyHtmlDataTable</component-class> </component> ... <render-kit> <render-kit-id>HTML_BASIC</render-kit-id> <renderer> <component-family>org.richfaces.DataTable</component-family> <renderer-type>my.renderkit.dataTable</renderer-type> <renderer-class>my.project.component.table.MyDataTableRenderer</renderer-class> </renderer> ... Also, my my-project.taglib.xml file (as I use Facelets) looks like: <facelet-taglib> <namespace>http://my.project/jsf</namespace> <tag> <tag-name>dataTable</tag-name> <component> <component-type>my.component.dataTable</component-type> <renderer-type>my.renderkit.dataTable</renderer-type> </component> </tag> So as you can see, I have two classes in my project for my custom datatable: MyHtmlDataTable and MyDataTableRenderer. One of my idea is to modify the content of the <f:facet> directly in the doEncodeBegin() method of my renderer. This is working (in fact almost working), but I don't really think that's the better place to achieve my modification. What do you think? Technical information: JSF 1.2, Facelets, Richfaces 3.3.2, Java 1.6

    Read the article

  • Creating multiple heads in remote repository

    - by Jab
    We are looking to move our team (~10 developers) from SVN to mercurial. We are trying to figure out how to manage our workflow. In particular, we are trying to see if creating remote heads is the right solution. We currently have a very large repository with multiple, related projects. They share a lot of code, but pieces of the project are deployed by different teams (3 teams) independent of other portions of the code-base. So each team is working on concurrent large features. The way we currently handles this in SVN are branches. Team1 has a branch for Feature1, same deal for the other teams. When Team1 finishes their change, it gets merged into the trunk and deployed out. The other teams follow suite when their project is complete, merging of course. So my initial thought are using Named Branches for these situations. Team1 makes a Feature1 branch off of the default branch in Hg. Now, here is the question. Should the team PUSH that branch, in it's current/half-state to the repository. This will create a second head in the core repo. My initial reaction was "NO!" as it seems like a bad idea. Handling multiple heads on our repository just sounds awful, but there are some advantages... First, the teams want to setup Continuous Integration to build this branch during their development cycle(months long). This will only work if the CI can pull this branch from the repo. This is something we do now with SVN, copy a CI build and change the branch. Easy. Second, it makes it easier for any team member to jump onto the branch and start working. Without pushing to the core repo, they would have to receive a push from a developer on that team with the changeset information. It is also possible to lose local commits to hardware failure. The chances increase a lot if it's a branch by a single developer who has followed the "don't push until finished" approach. And lastly is just for ease of use. The developers can easily just commit and push on their branch at any time without consequence(as they do today, in their SVN branches). Is there a better way to handle this scenario that I may be missing? I just want a veteran's opinion before moving forward with the strategy. For bug fixes we like the general workflow of mecurial, anonymous branches that only consist of 1-2 commits. The simplicity is great for those cases. By the way, I've read this , great article which seems to favor Named branches.

    Read the article

  • drupal (CMS) or codeigniter (MVC) for creating a new web application?

    - by ajsie
    im going to create a new web application that is very customized. it will contain images, that are fully searchable - in a very, very customized way. when you click on the pictures you can add comments and so on. it requires users to be registered, but the registration/login process will be highly customized too. at the moment im using CodeIgniter for this. But i've read a lot of posts about CMS like Drupal and it sounds like i could let it handle basic stuff, maybe design and other front end work. i have no experience with CMS, in fact, i just started to use a MVC framework like CI and was impressed of how much easier it gets to start developing. so i wonder, if i'm going to create this kind of application, could i use drupal and then add the usual stuff, as i was going to do with CodeIgniter, like controllers, views, models, config files, my own libraries and so on? how does it work on a system like Drupal. how do you code PHP with it as with any MVC framework. it sounds like it has a lot of modules, i just wonder, if i can use it as a MVC framework but have the benefit of having all these basic stuff and design ready to use? cause then it sounds like the best "library" to provide for a web application from scratch. or is it difficult to create a customized app with it? i guess it has modules like images and users, but then how could i customize these so that every image has tags on it and country information, or have every user subscribing to changes to an image, that email will be sent to users and so on? cause i guess its easy to install a module. the question is, how do i customize it. maybe i don't need all that table columns. maybe i want to add/remove business logic. what are the pros and cons with using Drupal for this? is it even the right way to go? can you make a Stackoverflow with Drupal? Facebook? Twitter? Youtube? assuming that you know php of course. share your thoughts cause im totally new on creating a web application! thanks

    Read the article

  • How to use a LinkButton inside gridview to delete selected username in the code-behind file?

    - by jenifer
    I have a "UserDetail" table in my "JobPost.mdf". I have a "Gridview1" showing the column from "UserDetail" table,which has a primary key "UserName". This "UserName" is originally saved using Membership class function. Now I add a "Delete" linkbutton to the GridView1. This "Delete" is not autogenerate button,I dragged inside the column itemtemplate from ToolBox. The GridView1's columns now become "Delete_LinkButton"+"UserName"(within the UserDetail table)+"City"(within the UserDetail table)+"IsAdmin"(within the UserDetail table) What I need is that by clicking this "delete_linkButton",it will ONLY delete the entire User Entity on the same row (link by the corresponding "UserName") from the "UserDetail" table,as well as delete all information from the AspNetDB.mdf (User,Membership,UserInRole,etc). I would like to fireup a user confirm,but not mandatory. At least I am trying to make it functional in the correct way. for example: Command UserName City IsAdmin delete ken Los Angles TRUE delete jim Toronto FALSE When I click "delete" on the first row, I need all the record about "ken" inside the "UserDetail" table to be removed. Meanwhile, all the record about "ken" in the AspNetDB.mdf will be gone, including UserinRole table. I am new to asp.net, so I don't know how to pass the commandargument of the "Delete_LinkButton" to the code-behind file LinkButton1_Click(object sender, EventArgs e), because I need one extra parameter "UserName". My partial code is listed below: <asp:TemplateField> <ItemTemplate> <asp:LinkButton ID="Delete_LinkButton" runat="server" onclick="LinkButton1_Click1" CommandArgument='<%# Eval("UserName","{0}") %>'>LinkButton</asp:LinkButton> </ItemTemplate> </asp:TemplateField> protected void Delete_LinkButton_Click(object sender, EventArgs e) { ((LinkButton) GridView1.FindControl("Delete_LinkButton")).Attributes.Add("onclick", "'return confirm('Are you sure you want to delete {0} '" + UserName); Membership.DeleteUser(UserName); JobPostDataContext db = new JobPostDataContext(); var query = from u in db.UserDetails where u.UserName == UserName select u; for (var Item in query) { db.UserDetails.DeleteOnSubmit(Item); } db.SubmitChanges(); } Please do help! Thanks in advance.

    Read the article

  • How to handle very frequent updates to a Lucene index

    - by fsm
    I am trying to prototype an indexing/search application which uses very volatile indexing data sources (forums, social networks etc), here are some of the performance requirements, Very fast turn-around time (by this I mean that any new data (such as a new message on a forum) should be available in the search results very soon (less than a minute)) I need to discard old documents on a fairly regular basis to ensure that the search results are not dated. Last but not least, the search application needs to be responsive. (latency on the order of 100 milliseconds, and should support at least 10 qps) All of the requirements I have currently can be met w/o using Lucene (and that would let me satisfy all 1,2 and 3), but I am anticipating other requirements in the future (like search relevance etc) which Lucene makes easier to implement. However, since Lucene is designed for use cases far more complex than the one I'm currently working on, I'm having a hard time satisfying my performance requirements. Here are some questions, a. I read that the optimize() method in the IndexWriter class is expensive, and should not be used by applications that do frequent updates, what are the alternatives? b. In order to do incremental updates, I need to keep committing new data, and also keep refreshing the index reader to make sure it has the new data available. These are going to affect 1 and 3 above. Should I try duplicate indices? What are some common approaches to solving this problem? c. I know that Lucene provides a delete method, which lets you delete all documents that match a certain query, in my case, I need to delete all documents which are older than a certain age, now one option is to add a date field to every document and use that to delete documents later. Is it possible to do range queries on document ids (I can create my own id field since I think that the one created by lucene keeps changing) to delete documents? Is it any faster than comparing dates represented as strings? I know these are very open questions, so I am not looking for a detailed answer, I will try to treat all of your answers as suggestions and use them to inform my design. Thanks! Please let me know if you need any other information.

    Read the article

  • Spring MVC, REST, and HATEOAS

    - by SingleShot
    I'm struggling with the correct way to implement Spring MVC 3.x RESTful services with HATEOAS. Consider the following constraints: I don't want my domain entities polluted with web/rest constructs. I don't want my controllers polluted with view constructs. I want to support multiple views. Currently I have a nicely put together MVC app without HATEOAS. Domain entities are pure POJOs without any view or web/rest concepts embedded. For example: class User { public String getName() {...} public String setName(String name) {...} ... } My controllers are also simple. They provide routing and status, and delegate to Spring's view resolution framework. Note my application supports JSON, XML, and HTML, yet no domain entities or controllers have embedded view information: @Controller @RequestMapping("/users") class UserController { @RequestMapping public ModelAndView getAllUsers() { List<User> users = userRepository.findAll(); return new ModelAndView("users/index", "users", users); } @RequestMapping("/{id}") public ModelAndView getUser(@PathVariable Long id) { User user = userRepository.findById(id); return new ModelAndView("users/show", "user", user); } } So, now my issue - I'm not sure of a clean way to support HATEOAS. Here's an example. Let's say when the client asks for a User in JSON format, it comes out like this: { firstName: "John", lastName: "Smith" } Let's also say that when I support HATEOAS, I want the JSON to contain a simple "self" link that the client can then use to refresh the object, delete it, or something else. It might also have a "friends" link indicating how to get the user's list of friends: { firstName: "John", lastName: "Smith", links: [ { rel: "self", ref: "http://myserver/users/1" }, { rel: "friends", ref: "http://myserver/users/1/friends" } ] } Somehow I want to attach links to my object. I feel the right place to do this is in the controller layer as the controllers all know the correct URLs. Additionally, since I support multiple views, I feel like the right thing to do is somehow decorate my domain entities in the controller before they are converted to JSON/XML/whatever in Spring's view resolution framework. One way to do this might be to wrap the POJO in question with a generic Resource class that contains a list of links. Some view tweaking would be required to crunch it into the format I want, but its doable. Unfortunately nested resources could not be wrapped in this way. Other things that come to mind include adding links to the ModelAndView, and then customizing each of Spring's out-of-the-box view resolvers to stuff links into the generated JSON/XML/etc. What I don't want is to be constantly hand-crafting JSON/XML/etc. to accommodate various links as they come and go during the course of development. Thoughts?

    Read the article

< Previous Page | 926 927 928 929 930 931 932 933 934 935 936 937  | Next Page >