Search Results

Search found 2736 results on 110 pages for 'semantic meaning'.

Page 94/110 | < Previous Page | 90 91 92 93 94 95 96 97 98 99 100 101  | Next Page >

• MACRO compilation PROBLEM

  - by wildfly

  i was given a primitive task to find out (and to put in cl) how many nums in an array are bigger than the following ones, (meaning if (arr[i] arr[i+1]) count++;) but i've problems as it has to be a macro. i am getting errors from TASM. can someone give me a pointer? SortA macro a, l LOCAL noes irp reg, <si,di,bx> push reg endm xor bx,bx xor si,si rept l-1 ;;also tried rept 3 : wont' compile mov bl,a[si] inc si cmp bl,arr[si] jb noes inc di noes: add di,0 endm mov cx,di irp reg2, <bx,di,si> pop reg2 endm endm dseg segment arr db 10,9,8,7 len = 4 dseg ends sseg segment stack dw 100 dup (?) sseg ends cseg segment assume ds:dseg, ss:sseg, cs:cseg start: mov ax, dseg mov ds,ax sortA arr,len cseg ends end start errors: Assembling file: sorta.asm **Error** sorta.asm(51) REPT(4) Expecting pointer type **Error** sorta.asm(51) REPT(6) Symbol already different kind: NOES **Error** sorta.asm(51) REPT(10) Expecting pointer type **Error** sorta.asm(51) REPT(12) Symbol already different kind: NOES **Error** sorta.asm(51) REPT(16) Expecting pointer type **Error** sorta.asm(51) REPT(18) Symbol already different kind: NOES Error messages: 6

  Read the article

• .NET HttpModule does not send form variables to PHP file on RewritePath()

  - by jammus

  Hello friends. We have an application running on IIS 6 which uses a custom HttpModule to rewrite urls. This works great (well done us) except in the case where the Context.RewritePath destination is a .php file. The php file is executed as expected, however the $_POST collection is empty meaning it cannot access any forms which are submitted to rewritten urls. The problem does not exist when rewriting to .aspx files as the Request.Form collection is fine. My question therefore has two parts: Why is the $_POST collection not being populated? Is there a way to ensure that the .php $_POST collection is correctly populated after a rewrite? I don't have much to show in the way of code. There's just a simple: context.RewritePath(newPath); once the HttpModule has figured out where to send the request. Edit: Interestingly, if I do var_dump(file_get_contents('php://input')); in the PHP file (method described here) the contents of the form is displayed. So the data is reaching the PHP script but not the $_POST array.

  Read the article

• Change workarea size of Linux desktop

  - by nonoitall

  I'm trying to write a taskbar/panel for Linux (like fbpanel or pypanel) using GTK# and am a little hung up. I've created a Gtk.Window to act as the panel and positioned/resized it appropriately. I've also set its WindowTypeHint to Dock so that it remains on top of other windows. So far it 'looks' like a panel. However, if the panel is running and I maximize another window, that window fills the whole desktop - meaning the bottom portion of the window is covered up by my panel. I've gathered that I probably need to change the desktop's workarea. How can I go about doing this in C#? (Preferably using GTK#, but I don't mind using interop if it's necessary.) As a bit of a side point, I'm curious if anyone knows how I would go about 'informing' the window manager about where applications' taskbar buttons are. (For example, if the window manager wants to animate the minimize action so that the window shrinks down to its button on the taskbar, how do I let the window manager know where that button is on the taskbar?)

  Read the article

• What different terms mean the same thing (or don't, but people think they do)?

  - by Matthew Jones

  One of the pitfalls I run into on a daily basis is customers saying one thing while meaning another. Usually, this is just due to a miscommunication somewhere, but occasionally they are, in fact, saying the same thing I am just using a different term. For example, one of my customers the other day mentioned a feature he called, "find as you type." Being a little confused, I asked him what he meant, and he described the feature in Google where, once you start typing a search query, Google suggests other, popular queries that match the letters you have typed. Click! He meant AutoComplete! He was not wrong, it is just that I had never heard that term before. In the spirit of reducing confusion, what terms can you think of that are different but mean, essentially, the same thing? Also, what terms do people think mean the same thing, but don't. Please differentiate between the two. Please only one set of terms per answer, so we can vote on the best ones.

  Read the article

• Enforcing default time when only date in timestamptz provided

  - by Incognito

  Assume I have the table: postgres=# create table foo (datetimes timestamptz); CREATE TABLE postgres=# \d+ foo Table "public.foo" Column | Type | Modifiers | Storage | Description -----------+--------------------------+-----------+---------+------------- datetimes | timestamp with time zone | | plain | Has OIDs: no So lets insert some values into it... postgres=# insert into foo values ('2012-12-12'), --This is the value I want to catch for. (null), ('2012-12-12 12:12:12'), ('2012-12-12 12:12'); INSERT 0 4 And here's what we have: postgres=# select * from foo ; datetimes ------------------------ 2012-12-12 00:00:00+00 2012-12-12 12:12:12+00 2012-12-12 12:12:00+00 (4 rows) Ideally, I'd like to set up a default time-stamp value when a TIME is not provided with the input, rather than the de-facto time of 2012-12-12 being 00:00:00, I would like to set a default of 15:45:10. Meaning, my results should look like: postgres=# select * from foo ; datetimes ------------------------ 2012-12-12 15:45:10+00 --This one gets the default time. 2012-12-12 12:12:12+00 2012-12-12 12:12:00+00 (4 rows) I'm not really sure how to do this in postgres 8.4, I can't find anything in the datetime section of the manual or the sections regarding column default values.

  Read the article

• Should we retire the term "Context"?

  - by MrGumbe

  I'm not sure if there is a more abused term in the world of programming than "Context." A word that has a very clear meaning in the English language has somehow morphed into a hot mess in software development, where the definition where the connotation can be completely different based on what library you happen to be developing in. Tomcat uses the word context to mean the configuration of a web application. Java applets, on the other hand, use an AppletContext to define attributes of the browser and HTML tag that launched it, but the BeanContext is defined as a container. ASP.NET uses the HttpContext object as a grab bag of state - containing information about the current request / response, session, user, server, and application objects. Context Oriented Programming defines the term as "Any information which is computationally accessible may form part of the context upon which behavioral variations depend," which I translate as "anything in the world." The innards of the Windows OS uses the CONTEXT structure to define properties about the hardware environment. The .NET installation classes, however, use the InstallContext property to represent the command line arguments entered to the installation class. The above doesn't even touch how all of us non-framework developers have used the term. I've seen plenty of developers fall into the subconscious trap of "I can't think of anything else to call this class, so I'll name it 'WidgetContext.'" Do you all agree that before naming our class a "Context," we may want to first consider some more descriptive terms? "Environment", "Configuraton", and "ExecutionState" come readily to mind.

  Read the article

• What to call factory-like (java) methods used with immutable objects

  - by StaxMan

  When creating classes for "immutable objects" immutable meaning that state of instances can not be changed; all fields assigned in constructor) in Java (and similar languages), it is sometimes useful to still allow creation of modified instances. That is, using an instance as base, and creating a new instance that differs by just one property value; other values coming from the base instance. To give a simple example, one could have class like: public class Circle { final double x, y; // location final double radius; public Circle(double x, double y, double r) { this.x = x; this.y = y; this.r = r; } // method for creating a new instance, moved in x-axis by specified amount public Circle withOffset(double deltaX) { return new Circle(x+deltaX, y, radius); } } So: what should method "withOffset" be called? (note: NOT what its name ought to be -- but what is this class of methods called). Technically it is kind of a factory method, but somehow that does not seem quite right to me, since often factories are just given basic properties (and are either static methods, or are not members of the result type but factory type). So I am guessing there should be a better term for such methods. Since these methods can be used to implement "fluent interface", maybe they could be "fluent factory methods"? Better suggestions? EDIT: as suggested by one of answers, java.math.BigDecimal is a good example with its 'add', 'subtract' (etc) methods. Also: I noticed that there's this question (by Jon Skeet no less) that is sort of related (although it asks about specific name for method)

  Read the article

• Small Open source and free java applications

  - by user1089770

  I am a Perl Developer who has just stepped into the Java world and I want to be very proficient in Java EE development. However, I have found that, being a Perl guy, I have very high MTI(Mother Tongue Influence). Indians will know what MTI is. For others, it can be defined as an influence of your "main" language whenever you "speak" your new language. In other words, our mind converts/translates what we want to "say" in the new language based on the "main" language, which can be quite absurd or meaning less in the "new" language. Coming back to the point, as a result of this MTI, many lines of my code has this Perl influence and it is absurd and useless for production. Hence, I'd like to see or better do some research on existing small to medium open source java applications, so that I will know how I can "speak" in the native way of the "new" language. Some examples in PHP will be : WordPress, Zend etc. So I'd really appreciate if you guys could suggest any such apps. Apps that have a great commercial value are highly preferred

  Read the article

• help on developing enterprise level software solutions

  - by wefwgeweg

  there is a specific niche which I would like to target by providing a complete enterprise level software solution.... the problem is, where do i begin ? meaning, i come from writing just desktop software on VB/ASP .net/PHP/mysql and suddenly unfamiliar terms popup like Oracle, SAP Business Information Warehouse, J2EE.... obviously, something is pointing towards Java, is it common for software suites, or solutions to be developed 100% on Java technology and standards? Are there any other platform to build enterprise level software on ? i am still lacking understanding what exactly is "Enterprise level" ? what is sufficient condition to call a software that sells for $199 and then suddenly it's $19,999 for "enterprise" package. I dont understand why there is such a huge discrepancy between "standard" and "enterprise" versions of software. Is it just attempting to bag large corporations on a spending spree ? so why does one choose to develop so called "enterprise" softwares ? is it because of the large inflated price tag you can justify with ? i would also like some more enterpreneural resources on starting your own enterprise software company in a niche.... Thank you for reading, i am still trying to find the right questions.

  Read the article

• Strange data swapping error occurs when I attempt to update rows in my table from another table in m

  - by Wesley

  So I have a table of data that is 10,000 lines long. Several of the columns in the table simply describe information about one of the columns, meaning, that only one column has the content, and the rest of the columns describe the location of the content (its for a book). Right now, only 6,000 of the 10,000 rows' content column is filled with its content. Rows 6-10,000's content column simply says null. I have another table in the db that has the content for rows 6,000-10,000, with the correct corresponding primary key which would (seemingly) make it easy to update the 10,000 row table. I have been trying an update query such as the following: UPDATE table(10,000) SET content_column = (SELECT content FROM table(6,000-10,000) WHERE table(10,000).id = table(6-10,000.id) Which kind of works, the only problem is that it pulls in the data from the second table just fine, but it replaces the existing content column with null. So rows 1-6,000's content column become null, and rows 6-10,000's content column have the correct values...Pretty strange I thought anyway. Does anybody have any thoughts about where I am going wrong? If you could show me a better sql query, I would appreciate it! Thanks

  Read the article

• Question regarding parent/child relationships with dynamically generated checkboxes using jquery

  - by Jeff

  I have a form of checkboxes, that is dynamically generated based on the users content. Sections of checkboxes are broken up by categories, and each category has projects within. For database purposes, the category values have checkboxes, that are hidden. IF a category has sub items that have checkboxes that are checked, THEN the category checkbox is checked as well. I have gotten this working ok using the JQuery .click(), but I can't figure out how to do it when the page loads. Here is my code for when a checkbox is actually clicked: $(".project").click(function() { if($(this).is(":checked") && $(this).hasClass("project")) { $(this).parent().parent().children(':first').attr('checked', true); }else if(!$(this).parent().children('.project').is(":checked")){ $(this).parent().parent().children(':first').attr('checked', false); } }); Now when I am editing the status of these boxes (meaning after they have been saved to the db) the category boxes are not showing up as checked even though their children projects are checked. What can I do to make it so that my category box will be checked at load time if that category's child is checked? Part of the problem I think is with the dynamically changing parent child setup, how can I find the parent box in order to have it checked? Thanks!

  Read the article

• OOP design issue: Polymorphism

  - by Graham Phillips

  I'm trying to solve a design issue using inheritance based polymorphism and dynamic binding. I have an abstract superclass and two subclasses. The superclass contains common behaviour. SubClassA and SubClassB define some different methods: SubClassA defines a method performTransform(), but SubClassB does not. So the following example 1 var v:SuperClass; 2 var b:SubClassB = new SubClassB(); 3 v = b; 4 v.performTransform(); would cause a compile error on line 4 as performTransform() is not defined in the superclass. We can get it to compile by casting... (v as SubClassA).performTransform(); however, this will cause a runtime exception to be thrown as v is actually an instance of SubClassB, which also does not define performTransform() So we can get around that by testing the type of an object before casting it: if( typeof v == SubClassA) { (cast v to SubClassA).performTransform(); } That will ensure that we only call performTransform() on v's that are instances of SubClassA. That's a pretty inelegant solution to my eyes, but at least its safe. I have used interface based polymorphism (interface meaning a type that can't be instantiated and defines the API of classes that implement it) in the past, but that also feels clunky. For the above case, if SubClassA and SubClassB implemented ISuperClass that defined performTransform, then they would both have to implement performTransform(). If SubClassB had no real need for a performTransform() you would have to implement an empty function. There must be a design pattern out there that addresses the issue.

  Read the article

• How to get XML nodes content when names include special Characters?

  - by paoloi

  Im trying to navigate an XML block similar to this one ($doc) using PHP simplexml_load_string and using xpath on $doc to get only the 'Day' block like this: $myday = $doc->xpath ('//Day'); that lets me access all data from the block as an object, meaning $doc-AdultCount returns 1 and $doc-Id returns "6a0" however I can't access "SpecialDeals" content not using: $doc-SpecialDeals nor using: $doc-SpecialDeals-a:string Whats is the right syntax in this case? Thanks in advance. <Days> <DaysId>687</DaysId> <Day> <AdultsCount>1</AdultsCount> <Availability>Available</Availability> <Id>6a0</Id> <RoomType>Studio</RoomType> <SpecialDeals xmlns:a="http://microsoft.com/2003/Arrays"> <a:string>Best Day Ever</a:string> </SpecialDeals> </Day> <DaysPrice>247.4</DaysPrice> </Days>");

  Read the article

• Need a piece of advice about e-mail automation in ms exchange + ms office environment

  - by be here now

  Hi, guys. I need your help in the following simple situation. I've got an MS Exchange server and some client computers running on XP with Office 2003 installed. And I've got a process I need to automate. Twice a day a known list of people sends an e-mail to a certain mailbox (let's call it manager's mailbox) - basically, an accomplishment report. After recieving letters from all of these people the mailbox owner sends and e-mail to another mailbox, meaning that a certain process is done. What I need to do is to replace this manager's mailbox with a depersonalized mailbox that will accumulate all the reports and automatically send a message after collecting all of them. I am definitely not in a "oh my God, what shold I do?" situation, and currently my imagination shows me a couple of ways to solve this problem, which I'm going to try, and I'm not ascking for a ready solution. But since I'm not experienced in Office/VBA developement, I'd like to ask a corresponding pro's opinion. Can you point me to a right direction from the best practices' point of view?

  Read the article

• Spring Controller's URL request mapping not working as expected

  - by Atharva

  I have created a mapping in web.xml something like this: <servlet> <servlet-name>dispatcher</servlet-name> <servlet-class>org.springframework.web.servlet.DispatcherServlet</servlet-class> <load-on-startup>1</load-on-startup> </servlet> <servlet-mapping> <servlet-name>dispatcher</servlet-name> <url-pattern>/about/*</url-pattern> </servlet-mapping> In my controller I have something like this: import org.springframework.stereotype.Controller; @Controller public class MyController{ @RequestMapping(value="/about/us", method=RequestMethod.GET) public ModelAndView myMethod1(ModelMap model){ //some code return new ModelAndView("aboutus1.jsp",model); } @RequestMapping(value="/about", method=RequestMethod.GET) public ModelAndView myMethod2(ModelMap model){ //some code return new ModelAndView("aboutus2.jsp",model); } } And my dispatcher-servlet.xml has view resolver like: <mvc:annotation-driven/> <bean id="viewResolver" class="org.springframework.web.servlet.view.InternalResourceViewResolver" p:viewClass="org.springframework.web.servlet.view.JstlView" p:prefix="/WEB-INF/jsp/" p:suffix=".jsp"/> To my surprise: request .../about/us is not reaching to myMethod1 in the controller. The browser shows 404 error. I put a logger inside the method but it isn't printing anything, meaning, its not being executed. .../about works fine! What can be the done to make .../about/us request work? Any suggestions?

  Read the article

• Is there programming language with better approach for switch's break statements ?

  - by Vitaly Polonetsky

  It's the same syntax in a way too many languages: switch (someValue) { case OPTION_ONE: case OPTION_LIKE_ONE: case OPTION_ONE_SIMILAR: doSomeStuff1(); break; // EXIT the switch case OPTION_TWO_WITH_PRE_ACTION: doPreActionStuff2(); // the default is to CONTINUE to next case case OPTION_TWO: doSomeStuff2(); break; // EXIT the switch case OPTION_THREE: doSomeStuff3(); break; // EXIT the switch } Now all you know that break statements are required, because the switch will continue to the next case when break statement is missing. We have an example of that with OPTION_LIKE_ONE, OPTION_ONE_SIMILAR and OPTION_TWO_WITH_PRE_ACTION. The problem is that we only need this "skip to next case" very very very rarely. And very often we put break at the end of case. It very easy for a beginner to forget about it. And one of my C teachers even explained it to us as if it was a bug in C language (don't want to talk about it :) I would like to ask if there are any other languages that I don't know of (or forgot about) that handle switch/case like this: switch (someValue) { case OPTION_ONE: continue; // CONTINUE to next case case OPTION_LIKE_ONE: continue; // CONTINUE to next case case OPTION_ONE_SIMILAR: doSomeStuff1(); // the default is to EXIT the switch case OPTION_TWO_WITH_PRE_ACTION: doPreActionStuff2(); continue; // CONTINUE to next case case OPTION_TWO: doSomeStuff2(); // the default is to EXIT the switch case OPTION_THREE: doSomeStuff3(); // the default is to EXIT the switch } The second question: is there any historical meaning to why it is like this in C? May be continue to next case was used far more often than we use it these days ?

  Read the article

• Building a survey to put in a WordPress website using Python/Django

  - by chiurox

  So I've been given a task to build a survey to get data regarding time slot preferences of prospective students for a particular course. I know there are really quick solutions to this like Google Forms, SurveyMonkey, but since it's not unusually hard, I want to implement the survey myself in a totally new language as an opportunity to get started with it and also be able to customize and provide dynamic info to the users who are voting. Although I have done some stuff in PHP, C++, javascript, etc, I'm pretty new to Python+Django framework but it's something I've been meaning to get into since a long time ago. Initially, what I want is to make a grid with the days of the week as columns and time-durations as rows. In each cell I want to provide users a way to choose how strong (high/medium/low) their preference for this particular day+time is. I also want to show how many "votes" have already been cast for this particular preference because this will influence a lot in their decisions and as a result make this process easier when we are going to define the classes. I'll probably store the data in MySQL. Could anyone point me to some really good Python+Django tutorials for my particular purpose? Does anyone think I'm wasting my time with this trivial task by choosing new tools and that I should just use something I already know (like PHP) or a free service or plugin for Wordpress? Thanks!

  Read the article

• string comparision and counting the key in target [closed]

  - by mesun

  Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

  Read the article

• jquery : ul, li parent multiple child sub-child toggling

  - by user360826

  hello, my main question is as follows: how to show only the first subchild of a ul or li upon clicking the enclosing parent. eg: <ul> Grandparent <li> Child1 <li> Grandchild11</li></li> <li> Child2 <li>GrandChild21</li><li>grandchild22</li></li> </ul> so, for example I would like something to the effect of <script> $('ul').click(function(){ $('ul').children('first li').toggle() }); $('li').click(function(){ $('li').children('first li').toggle() }); </script> meaning: when i click ul, i only see the first child node (child1 and child2 will be shown, but not the grandchildren). when i click child1 or child2 i see the respective grandchild. grandchild is not shown upon clicking grandparent, only upon clicking child1 or child2. i know i am reinventing the wheel of some pre-coded solution, but any help would be largely appreciated!

  Read the article

• C# Finding 2 positions 1-dimArray

  - by Chris

  Hello, In a method i am calculating the longest row of elements. The 1-dim array is filled up with random values (0 or 1). The method looks up the longest row (being 0 or 1, whatever is the longest). Meaning in for example: 1110100 --> the longest row would be 3 (3 * 1) 0110000 --> the longest row would be 4 (4 * 0) My problem is i am trying to perform some type of linear search to show the position of the row in the array. The first example has the longest row of 3 elements (3 times 1). For 1110100 the position in the array would be 0 - 2 (index) For 0110000 the position in the array would be 3 - 6 (index) I have been trying with foreaches, for loops etc..but i cannot seem to get the proper indexes of both. Cannot seem to display both positions properly. For the first example the correct output wouldbe: The largest row of same elements of the array consists of 3 elements on the position 0 - 2. The longest row of elements gets of same elements get calculated as the following: public int BerekenDeelrij (int [] table) ( int count = 0; final int value = 0; int largest = 0; foreach (int value in table) ( if (value == last value) counter + +; else ( largest = Math.Max largest (largest, counter); final value = value count = 1; ) ) Math.Max return (largest, counter); ) Best Regards.

  Read the article

• Django Many-to-Many Question

  - by DZ

  My questions seems like a common problem that when I have seen any questions on it is never really asked right or not answered. So Im going to try to get the question right, and maybe someone knows how to resolve the issue, or correct my understanding. The problem: When you have a many-to-many relation ship (related_name not through) and you are trying to use the admin interface you are required to input one of the rleationships even though it does not have to exsist for you to create the first entry. Meaning you have to assign a group to an event to create the group. Wow that sounds complicated. So I can see why the question is not getting answered. Lets try the non code explanation example... First and important versions: Django 1.1.1 Phython 2.6 So I have a model where I created a many-to-many realtionship and Im using the related_name Im creating an app that is an event organizer, for simplicty lets say events although they could be anytype). For this first post Im going to stay away from the code and just try to explain. A few keys: (explaining comment) ** - many-to-many So in the model we have 1) The Main Event (this is main model) 2) Groups (link to events and their can be many events for a group) a) Events** I have simplified this example a little becuase I recognize that what does it matter. Just create the event first... But there are specific varations where that will not work. What the many-to-many related_name does it created another table with the indecies of the two other tables. Nothing says that this extra table HAS to be populated. Becuase if I look in the database and work within myPHPadmin I can create a group with out registering an event, since the connection between the two is a seperate table the DB does not care. How do I make the admin interface this realize it? Ok I know thats a lot so I hope I have explained it clearly. Thank you anyone for your comments/thoughts/advice

  Read the article

• How to build a dynamic resize-able Flash player

  - by Leon

  Morning stackers! So my question today isn't dealing with any code, but how to go about this the correct way from the start. I have a video player built to a static size (max: 800x600) which I'll have to re-code every time I need it to be a different size. What I need it to do in the near future is dynamically resize itself and all the elements inside of it based on 1 width variable that it will received either from HTML or XML. Now to me there are 2 ways to go about this: Start with the smallest size possible and resize upwards, but I'm unsure of how the Flash movie will actually expand upwards as of right now. Or 2, start with the largest size possible (in this case 800x600) and size everything down. Step 1, I think seems to be the better way to go about this (ala YouTube style), but Step 2 also seems like it could be the easier way? A friend of mine mentioned that I should go with the larger size and have elements resize in each class, then fix to the upper left hand corner. However for the player to fit inside of certain div columns on sites, blogs whatever he said that there will have to be an HTML/CSS side of this... meaning that the div containing the resized flash player will have to cover up the areas of the Flash movie that are not to be shown? Is that possible to put a 800x600 flash movie into a div that smaller then 800 pixels wide? And cover it up with another div? Anyways, my mission is to be able to have a dynamically sized player like this: Thoughts? Recommendations? Best practices for this before I start?

  Read the article

• Extended slice that goes to beginning of sequence with negative stride

  - by recursive

  Bear with me while I explain my question. Skip down to the bold heading if you already understand extended slice list indexing. In python, you can index lists using slice notation. Here's an example: >>> A = list(range(10)) >>> A[0:5] [0, 1, 2, 3, 4] You can also include a stride, which acts like a "step": >>> A[0:5:2] [0, 2, 4] The stride is also allowed to be negative, meaning the elements are retrieved in reverse order: >>> A[5:0:-1] [5, 4, 3, 2, 1] But wait! I wanted to see [4, 3, 2, 1, 0]. Oh, I see, I need to decrement the start and end indices: >>> A[4:-1:-1] [] What happened? It's interpreting -1 as being at the end of the array, not the beginning. I know you can achieve this as follows: >>> A[4::-1] [4, 3, 2, 1, 0] But you can't use this in all cases. For example, in a method that's been passed indices. My question is: Is there any good pythonic way of using extended slices with negative strides and explicit start and end indices that include the first element of a sequence? This is what I've come up with so far, but it seems unsatisfying. >>> A[0:5][::-1] [4, 3, 2, 1, 0]

  Read the article

• What collection object is appropriate for fixed ordering of values?

  - by makerofthings7

  Scenario: I am tracking several performance counters and have a CounterDescription[] correlate to DataSnapshot[]... where CounterDescription[n] describes the data loaded within DataSnapshot[n]. I want to expose an easy to use API within C# that will allow for the easy and efficient expansion of the arrays. For example CounterDescription[0] = Humidity; DataSnapshot[0] = .9; CounterDescription[1] = Temp; DataSnapshot[1] = 63; My upload object is defined like this: Note how my intent is to correlate many Datasnapshots with a dattime reference, and using the offset of the data to refer to its meaning. This was determined to be the most efficient way to store the data on the back-end, and has now reflected itself into the following structure: public class myDataObject { [DataMember] public SortedDictionary<DateTime, float[]> Pages { get; set; } /// <summary> /// An array that identifies what each position in the array is supposed to be /// </summary> [DataMember] public CounterDescription[] Counters { get; set; } } I will need to expand each of these arrays (float[] and CounterDescription[] ), but whatever data already exists must stay in that relative offset. Which .NET objects support this? I think Array[] , LinkedList<t>, and List<t> Are able to keep the data fixed in the right locations. What do you think?

  Read the article

• Which options do I have for Java process communication?

  - by Dmitriy Matveev

  We have a place in a code of such form: void processParam(Object param) { wrapperForComplexNativeObject result = jniCallWhichMayCrash(param); processResult(result); } processParam - method which is called with many different arguments. jniCallWhichMayCrash - a native method which is intended to do some complex processing of it's parameter and to create some complex object. It can crash in some cases. wrapperForComplexNativeObject - wrapper type generated by SWIG processResult - a method written in pure Java which processes it's parameter by creation of several kinds (by the kinds I'm not meaning classes, maybe some like hierarchies) of objects: 1 - Some non-unique objects which are referencing each other (from the same hierarchy), these objects can have duplicates created from the invocations of processParam() method with different parameter values. Since it's costly to keep all the duplicates it's necessary to cache them. 2 - Some unique objects which are referencing each other (from the same hierarchy) and some of the objects of 1st kind. After processParam is executed for each of the arguments from some set the data created in processResult will be processed together. The problem is in fact that jniCallWhichMayCrash method may crash the entire JVM and this will be very bad. The reason of crash may be such that it can happen for one argument value and not for the other. We've decided that it's better to ignore crashes inside of JVM and just skip some chunks of data when such crashes occur. In order to do this we should run processParam function inside of separate process and pass the result somehow (HOW? HOW?! This is a question) to the main process and in case of any crashes we will only lose some part of data (It's ok) without lose of everything else. So for now the main problem is implementation of transport between different processes. Which options do I have? I can think about serialization and transmitting of binary data by the streams, but serialization may be not very fast due to object complexity. Maybe I have some other options of implementing this?

  Read the article

< Previous Page | 90 91 92 93 94 95 96 97 98 99 100 101  | Next Page >