Search Results

Search found 3868 results on 155 pages for 'wildcard ssl'.

Page 94/155 | < Previous Page | 90 91 92 93 94 95 96 97 98 99 100 101  | Next Page >

  • Openvpn plugin openvpn-auth-ldap does not bind to Active Directory

    - by Selivanov Pavel
    I'm trying to configure OpenVPN with openvpn-auth-ldap plugin to authorize users via Active Directory LDAP. When I use the same server config without plugin option, and add client config with generated client key and cert, connection is successful, so problem is in the plugin. server.conf: plugin /usr/lib/openvpn/openvpn-auth-ldap.so "/etc/openvpn-test/openvpn-auth-ldap.conf" port 1194 proto tcp dev tun keepalive 10 60 topology subnet server 10.0.2.0 255.255.255.0 tls-server ca ca.crt dh dh1024.pem cert server.crt key server.key #crl-verify crl.pem persist-key persist-tun user nobody group nogroup verb 3 mute 20 openvpn-auth-ldap.conf: <LDAP> URL ldap://dc1.domain:389 TLSEnable no BindDN cn=bot_auth,cn=Users,dc=domain Password bot_auth Timeout 15 FollowReferrals yes </LDAP> <Authorization> BaseDN "cn=Users,dc=domain" SearchFilter "(sAMAccountName=%u)" RequireGroup false # <Group> # BaseDN "ou=groups,dc=mycompany,dc=local" # SearchFilter "(|(cn=developers)(cn=artists))" # MemberAttribute uniqueMember # </Group> </Authorization> Top-level domain in AD is used by historical reasons. Analogue configuration is working for Apache 2.2 in mod-authzn-ldap. User and password are correct. client.conf: remote server_name port 1194 proto tcp client pull remote-cert-tls server dev tun resolv-retry infinite nobind ca ca.crt ; with keys - works fine #cert test.crt #key test.key ; without keys - by password auth-user-pass persist-tun verb 3 mute 20 In server log there is string PLUGIN_INIT: POST /usr/lib/openvpn/openvpn-auth-ldap.so '[/usr/lib/openvpn/openvpn-auth-ldap.so] [/etc/openvpn-test/openvpn-auth-ldap.conf]' which indicates, that plugin failed. I can telnet to dc1.domain:389, so this is not network/firewall problem. Later server says TLS Error: TLS object -> incoming plaintext read error TLS handshake failed - without plugin it tryes to do usal key authentification. server log: Tue Nov 22 03:06:20 2011 OpenVPN 2.1.3 i486-pc-linux-gnu [SSL] [LZO2] [EPOLL] [PKCS11] [MH] [PF_INET6] [eurephia] built on Oct 21 2010 Tue Nov 22 03:06:20 2011 NOTE: OpenVPN 2.1 requires '--script-security 2' or higher to call user-defined scripts or executables Tue Nov 22 03:06:20 2011 PLUGIN_INIT: POST /usr/lib/openvpn/openvpn-auth-ldap.so '[/usr/lib/openvpn/openvpn-auth-ldap.so] [/etc/openvpn-test/openvpn-auth-ldap.conf]' intercepted=PLUGIN_AUTH_USER_PASS_VERIFY|PLUGIN_CLIENT_CONNECT|PLUGIN_CLIENT_DISCONNECT Tue Nov 22 03:06:20 2011 Diffie-Hellman initialized with 1024 bit key Tue Nov 22 03:06:20 2011 /usr/bin/openssl-vulnkey -q -b 1024 -m <modulus omitted> Tue Nov 22 03:06:20 2011 Control Channel Authentication: using 'ta.key' as a OpenVPN static key file Tue Nov 22 03:06:20 2011 Outgoing Control Channel Authentication: Using 160 bit message hash 'SHA1' for HMAC authentication Tue Nov 22 03:06:20 2011 Incoming Control Channel Authentication: Using 160 bit message hash 'SHA1' for HMAC authentication Tue Nov 22 03:06:20 2011 TLS-Auth MTU parms [ L:1543 D:168 EF:68 EB:0 ET:0 EL:0 ] Tue Nov 22 03:06:20 2011 Socket Buffers: R=[87380->131072] S=[16384->131072] Tue Nov 22 03:06:20 2011 TUN/TAP device tun1 opened Tue Nov 22 03:06:20 2011 TUN/TAP TX queue length set to 100 Tue Nov 22 03:06:20 2011 /sbin/ifconfig tun1 10.0.2.1 netmask 255.255.255.0 mtu 1500 broadcast 10.0.2.255 Tue Nov 22 03:06:20 2011 Data Channel MTU parms [ L:1543 D:1450 EF:43 EB:4 ET:0 EL:0 ] Tue Nov 22 03:06:20 2011 GID set to nogroup Tue Nov 22 03:06:20 2011 UID set to nobody Tue Nov 22 03:06:20 2011 Listening for incoming TCP connection on [undef] Tue Nov 22 03:06:20 2011 TCPv4_SERVER link local (bound): [undef] Tue Nov 22 03:06:20 2011 TCPv4_SERVER link remote: [undef] Tue Nov 22 03:06:20 2011 MULTI: multi_init called, r=256 v=256 Tue Nov 22 03:06:20 2011 IFCONFIG POOL: base=10.0.2.2 size=252 Tue Nov 22 03:06:20 2011 MULTI: TCP INIT maxclients=1024 maxevents=1028 Tue Nov 22 03:06:20 2011 Initialization Sequence Completed Tue Nov 22 03:07:10 2011 MULTI: multi_create_instance called Tue Nov 22 03:07:10 2011 Re-using SSL/TLS context Tue Nov 22 03:07:10 2011 Control Channel MTU parms [ L:1543 D:168 EF:68 EB:0 ET:0 EL:0 ] Tue Nov 22 03:07:10 2011 Data Channel MTU parms [ L:1543 D:1450 EF:43 EB:4 ET:0 EL:0 ] Tue Nov 22 03:07:10 2011 Local Options hash (VER=V4): 'c413e92e' Tue Nov 22 03:07:10 2011 Expected Remote Options hash (VER=V4): 'd8421bb0' Tue Nov 22 03:07:10 2011 TCP connection established with [AF_INET]10.0.0.9:47808 Tue Nov 22 03:07:10 2011 TCPv4_SERVER link local: [undef] Tue Nov 22 03:07:10 2011 TCPv4_SERVER link remote: [AF_INET]10.0.0.9:47808 Tue Nov 22 03:07:11 2011 10.0.0.9:47808 TLS: Initial packet from [AF_INET]10.0.0.9:47808, sid=a2cd4052 84b47108 Tue Nov 22 03:07:11 2011 10.0.0.9:47808 TLS_ERROR: BIO read tls_read_plaintext error: error:140890C7:SSL routines:SSL3_GET_CLIENT_CERTIFICATE:peer did not return a certificate Tue Nov 22 03:07:11 2011 10.0.0.9:47808 TLS Error: TLS object -> incoming plaintext read error Tue Nov 22 03:07:11 2011 10.0.0.9:47808 TLS Error: TLS handshake failed Tue Nov 22 03:07:11 2011 10.0.0.9:47808 Fatal TLS error (check_tls_errors_co), restarting Tue Nov 22 03:07:11 2011 10.0.0.9:47808 SIGUSR1[soft,tls-error] received, client-instance restarting Tue Nov 22 03:07:11 2011 TCP/UDP: Closing socket client log: Tue Nov 22 03:06:18 2011 OpenVPN 2.1.3 x86_64-pc-linux-gnu [SSL] [LZO2] [EPOLL] [PKCS11] [MH] [PF_INET6] [eurephia] built on Oct 22 2010 Enter Auth Username:user Enter Auth Password: Tue Nov 22 03:06:25 2011 NOTE: OpenVPN 2.1 requires '--script-security 2' or higher to call user-defined scripts or executables Tue Nov 22 03:06:25 2011 Control Channel Authentication: using 'ta.key' as a OpenVPN static key file Tue Nov 22 03:06:25 2011 Outgoing Control Channel Authentication: Using 160 bit message hash 'SHA1' for HMAC authentication Tue Nov 22 03:06:25 2011 Incoming Control Channel Authentication: Using 160 bit message hash 'SHA1' for HMAC authentication Tue Nov 22 03:06:25 2011 Control Channel MTU parms [ L:1543 D:168 EF:68 EB:0 ET:0 EL:0 ] Tue Nov 22 03:06:25 2011 Socket Buffers: R=[87380->131072] S=[16384->131072] Tue Nov 22 03:06:25 2011 Data Channel MTU parms [ L:1543 D:1450 EF:43 EB:4 ET:0 EL:0 ] Tue Nov 22 03:06:25 2011 Local Options hash (VER=V4): 'd8421bb0' Tue Nov 22 03:06:25 2011 Expected Remote Options hash (VER=V4): 'c413e92e' Tue Nov 22 03:06:25 2011 Attempting to establish TCP connection with [AF_INET]10.0.0.2:1194 [nonblock] Tue Nov 22 03:06:26 2011 TCP connection established with [AF_INET]10.0.0.2:1194 Tue Nov 22 03:06:26 2011 TCPv4_CLIENT link local: [undef] Tue Nov 22 03:06:26 2011 TCPv4_CLIENT link remote: [AF_INET]10.0.0.2:1194 Tue Nov 22 03:06:26 2011 TLS: Initial packet from [AF_INET]10.0.0.2:1194, sid=7a3c2a0f bd35bca7 Tue Nov 22 03:06:26 2011 WARNING: this configuration may cache passwords in memory -- use the auth-nocache option to prevent this Tue Nov 22 03:06:26 2011 VERIFY OK: depth=1, /C=US/ST=CA/L=SanFrancisco/O=Fort-Funston/CN=Fort-Funston_CA/[email protected] Tue Nov 22 03:06:26 2011 Validating certificate key usage Tue Nov 22 03:06:26 2011 ++ Certificate has key usage 00a0, expects 00a0 Tue Nov 22 03:06:26 2011 VERIFY KU OK Tue Nov 22 03:06:26 2011 Validating certificate extended key usage Tue Nov 22 03:06:26 2011 ++ Certificate has EKU (str) TLS Web Server Authentication, expects TLS Web Server Authentication Tue Nov 22 03:06:26 2011 VERIFY EKU OK Tue Nov 22 03:06:26 2011 VERIFY OK: depth=0, /C=US/ST=CA/L=SanFrancisco/O=Fort-Funston/CN=server/[email protected] Tue Nov 22 03:06:26 2011 Connection reset, restarting [0] Tue Nov 22 03:06:26 2011 TCP/UDP: Closing socket Tue Nov 22 03:06:26 2011 SIGUSR1[soft,connection-reset] received, process restarting Tue Nov 22 03:06:26 2011 Restart pause, 5 second(s) ^CTue Nov 22 03:06:27 2011 SIGINT[hard,init_instance] received, process exiting Does anybody know how to get openvpn-auth-ldap wirking?

    Read the article

  • Integrating POP3 client functionality into a C# application?

    - by flesh
    I have a web application that requires a server based component to periodically access POP3 email boxes and retrieve emails. The service then needs to process the emails which will involve: Validating the email against some business rules (does it contain a valid reference in the subject line, which user sent the mail, etc.) Analysing and saving any attachments to disk Take the email body and attachment details and create a new item in the database Or update an existing item where the reference matches the incoming email subject line What is the best way to approach this? I really don't want to have to write a POP3 client from scratch, but I need to be able to customize the processing of emails. Ideally I would be able to plug in some component that does the access and retrieval for me, returning arrays of attachments, body text, subject line, etc. ready for my processing... [ UPDATE: Reviews ] OK, so I have spent a fair amount of time looking into (mainly free) .NET POP3 libraries so I thought I'd provide a short review of some of those mentioned below and a few others: Pop3.net - free - works OK, very basic in terms of functionality provided. This is pretty much just the POP3 commands and some base64 encoding, but it's very straight forward - probably a good introduction Pop3 Wizard - commercial / some open source code - couldn't get this to build, missing DLLs, I wouldn't bother with this C#Mail - free - works well, comes with Mime parser and SMTP client, however the comments are in Japanese (not a big deal) and it didn't work with SSL 'out of the box' - I had to change the SslStream constructor after which it worked no problem OpenPOP - free - hasn't been updated for about 5 years so it's current state is .NET 1.0, doesn't support SSL but that was no problem to resolve - I just replaced the existing stream with an SslStream and it worked. Comes with Mime parser. Of the free libraries, I'd go for C#Mail or OpenPOP. I looked at a few commercial libraries: Chillkat, Rebex, RemObjects, JMail.net. Based on features, price and impression of the company I would probably go for Rebex and may in the future if my requirements change or I run into production issues with either of C#Mail or OpenPOP. In case anyone's needs it, this is the replacement SslStream constructor that I used to enable SSL with C#Mail and OpenPOP: SslStream stream = new SslStream(clientSocket.GetStream(), false, delegate(object sender, X509Certificate cert, X509Chain chain, SslPolicyErrors errors) { return true; });

    Read the article

  • Load balancing and sessions

    - by vtortola
    Hi there, What is the better approach for load balancing on web servers? My services run in .NET and Mono, so they could be hosted on IIS or Apache2, and the will have to provide SSL connection. I've read two main approaches, store the state in a common server and use sticky sessions, there is any other else? I've read 3 diffent things about sticky sessions: 1)the load balancing device will know with which server did you start the connection and all the further connections from that host will be routed to the same server. 2)the load balancing devide read a cookie named: JSESSIONID 3)the load balancing devide read a cookie named: ASPSESSIONID I'm a little bit confused, what will happen exactly? As the connections will be SSL there is not a chance for the load balancing devide of read the cookies, so then what? About store the estate in a common server, what solutions do you know? I've read memcache is a good solution but is there any other else? Cheers.

    Read the article

  • James Server connection failure exception

    - by John
    Hi, I'm trying to connect Javamail application to James server, but I'm getting javax.mail.MessagingException: Could not connect to SMTP host:localhost, port:4555; nested exception is: java.net.SocketException: Invalid arguent: connect Here's the code, which is creating a little problem for me: import java.security.Security; import java.io.IOException; import java.io.PrintWriter; import java.util.Properties; import javax.mail.*; import javax.mail.internet.*; public class mail { public static void main(String[] argts) { Security.addProvider(new com.sun.net.ssl.internal.ssl.Provider()); String mailHost = "your.smtp.server"; String to = "blue@localhost"; String from = "red@localhost"; String subject = "jdk"; String body = "Down to wind"; if ((from != null) && (to != null) && (subject != null) && (body != null)) // we have mail to send { try { //Get system properties Properties props = System.getProperties(); props.put("mail.smtp.user", "red"); props.put("mail.smtp.host", "localhost"); props.put("mail.debug", "true"); props.put("mail.smtp.port", 4555); props.put("mail.smtp.socketFactory.port", 4555); props.put("mail.smtp.socketFactory.class", "javax.net.ssl.SSLSocketFactory"); props.put("mail.smtp.socketFactory.fallback", "false"); Session session = Session.getInstance(props,null); Message message = new MimeMessage(session); message.setFrom(new InternetAddress(from)); message.setRecipients(Message.RecipientType.TO, new InternetAddress[] { new InternetAddress(to) }); message.setSubject(subject); message.setContent(body, "text/plain"); message.setText(body); Transport.send(message); System.out.println("<b>Thank you. Your message to " + to + " was successfully sent.</b>"); } catch (Throwable t) { System.out.println("Teri maa ki "+t); } } } } Thanks in advance. :)

    Read the article

  • eventmachine on debian fails install via rubygems

    - by Max
    this has been killing me for the last 5 hours. I don't seem to be able to get eventmachine running on my debian box. here this output: $ gem install thin Building native extensions. This could take a while... ERROR: Error installing thin: ERROR: Failed to build gem native extension. /home/eventhub/.rvm/rubies/ruby-1.9.3-p125/bin/ruby extconf.rb checking for rb_trap_immediate in ruby.h,rubysig.h... no checking for rb_thread_blocking_region()... yes checking for inotify_init() in sys/inotify.h... yes checking for writev() in sys/uio.h... yes checking for rb_wait_for_single_fd()... yes checking for rb_enable_interrupt()... yes checking for rb_time_new()... yes checking for sys/event.h... no checking for epoll_create() in sys/epoll.h... yes creating Makefile make compiling kb.cpp cc1plus: warning: command line option "-Wdeclaration-after-statement" is valid for C/ObjC but not for C++ cc1plus: warning: command line option "-Wimplicit-function-declaration" is valid for C/ObjC but not for C++ In file included from project.h:149, from kb.cpp:20: binder.h:35: warning: type qualifiers ignored on function return type In file included from project.h:150, from kb.cpp:20: em.h:84: warning: type qualifiers ignored on function return type em.h:85: warning: type qualifiers ignored on function return type em.h:86: warning: type qualifiers ignored on function return type em.h:88: warning: type qualifiers ignored on function return type em.h:89: warning: type qualifiers ignored on function return type em.h:90: warning: type qualifiers ignored on function return type em.h:91: warning: type qualifiers ignored on function return type em.h:93: warning: type qualifiers ignored on function return type em.h:99: warning: type qualifiers ignored on function return type em.h:116: warning: type qualifiers ignored on function return type em.h:125: warning: type qualifiers ignored on function return type In file included from project.h:154, from kb.cpp:20: eventmachine.h:46: warning: type qualifiers ignored on function return type eventmachine.h:47: warning: type qualifiers ignored on function return type eventmachine.h:48: warning: type qualifiers ignored on function return type eventmachine.h:50: warning: type qualifiers ignored on function return type eventmachine.h:65: warning: type qualifiers ignored on function return type eventmachine.h:66: warning: type qualifiers ignored on function return type eventmachine.h:67: warning: type qualifiers ignored on function return type eventmachine.h:68: warning: type qualifiers ignored on function return type In file included from project.h:154, from kb.cpp:20: eventmachine.h:103: warning: type qualifiers ignored on function return type eventmachine.h:105: warning: type qualifiers ignored on function return type eventmachine.h:108: warning: type qualifiers ignored on function return type compiling rubymain.cpp cc1plus: warning: command line option "-Wdeclaration-after-statement" is valid for C/ObjC but not for C++ cc1plus: warning: command line option "-Wimplicit-function-declaration" is valid for C/ObjC but not for C++ In file included from project.h:149, from rubymain.cpp:20: binder.h:35: warning: type qualifiers ignored on function return type In file included from project.h:150, from rubymain.cpp:20: em.h:84: warning: type qualifiers ignored on function return type em.h:85: warning: type qualifiers ignored on function return type em.h:86: warning: type qualifiers ignored on function return type em.h:88: warning: type qualifiers ignored on function return type em.h:89: warning: type qualifiers ignored on function return type em.h:90: warning: type qualifiers ignored on function return type em.h:91: warning: type qualifiers ignored on function return type em.h:93: warning: type qualifiers ignored on function return type em.h:99: warning: type qualifiers ignored on function return type em.h:116: warning: type qualifiers ignored on function return type em.h:125: warning: type qualifiers ignored on function return type In file included from project.h:154, from rubymain.cpp:20: eventmachine.h:46: warning: type qualifiers ignored on function return type eventmachine.h:47: warning: type qualifiers ignored on function return type eventmachine.h:48: warning: type qualifiers ignored on function return type eventmachine.h:50: warning: type qualifiers ignored on function return type eventmachine.h:65: warning: type qualifiers ignored on function return type eventmachine.h:66: warning: type qualifiers ignored on function return type eventmachine.h:67: warning: type qualifiers ignored on function return type eventmachine.h:68: warning: type qualifiers ignored on function return type In file included from project.h:154, from rubymain.cpp:20: eventmachine.h:103: warning: type qualifiers ignored on function return type eventmachine.h:105: warning: type qualifiers ignored on function return type eventmachine.h:108: warning: type qualifiers ignored on function return type compiling ssl.cpp cc1plus: warning: command line option "-Wdeclaration-after-statement" is valid for C/ObjC but not for C++ cc1plus: warning: command line option "-Wimplicit-function-declaration" is valid for C/ObjC but not for C++ In file included from project.h:149, from ssl.cpp:23: binder.h:35: warning: type qualifiers ignored on function return type In file included from project.h:150, from ssl.cpp:23: em.h:84: warning: type qualifiers ignored on function return type em.h:85: warning: type qualifiers ignored on function return type em.h:86: warning: type qualifiers ignored on function return type em.h:88: warning: type qualifiers ignored on function return type em.h:89: warning: type qualifiers ignored on function return type em.h:90: warning: type qualifiers ignored on function return type em.h:91: warning: type qualifiers ignored on function return type em.h:93: warning: type qualifiers ignored on function return type em.h:99: warning: type qualifiers ignored on function return type em.h:116: warning: type qualifiers ignored on function return type em.h:125: warning: type qualifiers ignored on function return type In file included from project.h:154, from ssl.cpp:23: eventmachine.h:46: warning: type qualifiers ignored on function return type eventmachine.h:47: warning: type qualifiers ignored on function return type eventmachine.h:48: warning: type qualifiers ignored on function return type eventmachine.h:50: warning: type qualifiers ignored on function return type eventmachine.h:65: warning: type qualifiers ignored on function return type eventmachine.h:66: warning: type qualifiers ignored on function return type eventmachine.h:67: warning: type qualifiers ignored on function return type eventmachine.h:68: warning: type qualifiers ignored on function return type In file included from project.h:154, from ssl.cpp:23: eventmachine.h:103: warning: type qualifiers ignored on function return type eventmachine.h:105: warning: type qualifiers ignored on function return type eventmachine.h:108: warning: type qualifiers ignored on function return type compiling cmain.cpp cc1plus: warning: command line option "-Wdeclaration-after-statement" is valid for C/ObjC but not for C++ cc1plus: warning: command line option "-Wimplicit-function-declaration" is valid for C/ObjC but not for C++ In file included from project.h:149, from cmain.cpp:20: binder.h:35: warning: type qualifiers ignored on function return type In file included from project.h:150, from cmain.cpp:20: em.h:84: warning: type qualifiers ignored on function return type em.h:85: warning: type qualifiers ignored on function return type em.h:86: warning: type qualifiers ignored on function return type em.h:88: warning: type qualifiers ignored on function return type em.h:89: warning: type qualifiers ignored on function return type em.h:90: warning: type qualifiers ignored on function return type em.h:91: warning: type qualifiers ignored on function return type em.h:93: warning: type qualifiers ignored on function return type em.h:99: warning: type qualifiers ignored on function return type em.h:116: warning: type qualifiers ignored on function return type em.h:125: warning: type qualifiers ignored on function return type In file included from project.h:154, from cmain.cpp:20: eventmachine.h:46: warning: type qualifiers ignored on function return type eventmachine.h:47: warning: type qualifiers ignored on function return type eventmachine.h:48: warning: type qualifiers ignored on function return type eventmachine.h:50: warning: type qualifiers ignored on function return type eventmachine.h:65: warning: type qualifiers ignored on function return type eventmachine.h:66: warning: type qualifiers ignored on function return type eventmachine.h:67: warning: type qualifiers ignored on function return type eventmachine.h:68: warning: type qualifiers ignored on function return type In file included from project.h:154, from cmain.cpp:20: eventmachine.h:103: warning: type qualifiers ignored on function return type eventmachine.h:105: warning: type qualifiers ignored on function return type eventmachine.h:108: warning: type qualifiers ignored on function return type cmain.cpp:96: warning: type qualifiers ignored on function return type cmain.cpp:107: warning: type qualifiers ignored on function return type cmain.cpp:117: warning: type qualifiers ignored on function return type cmain.cpp:127: warning: type qualifiers ignored on function return type cmain.cpp:269: warning: type qualifiers ignored on function return type cmain.cpp:279: warning: type qualifiers ignored on function return type cmain.cpp:289: warning: type qualifiers ignored on function return type cmain.cpp:299: warning: type qualifiers ignored on function return type cmain.cpp:309: warning: type qualifiers ignored on function return type cmain.cpp:329: warning: type qualifiers ignored on function return type cmain.cpp:678: warning: type qualifiers ignored on function return type compiling em.cpp cc1plus: warning: command line option "-Wdeclaration-after-statement" is valid for C/ObjC but not for C++ cc1plus: warning: command line option "-Wimplicit-function-declaration" is valid for C/ObjC but not for C++ In file included from project.h:149, from em.cpp:23: binder.h:35: warning: type qualifiers ignored on function return type In file included from project.h:150, from em.cpp:23: em.h:84: warning: type qualifiers ignored on function return type em.h:85: warning: type qualifiers ignored on function return type em.h:86: warning: type qualifiers ignored on function return type em.h:88: warning: type qualifiers ignored on function return type em.h:89: warning: type qualifiers ignored on function return type em.h:90: warning: type qualifiers ignored on function return type em.h:91: warning: type qualifiers ignored on function return type em.h:93: warning: type qualifiers ignored on function return type em.h:99: warning: type qualifiers ignored on function return type em.h:116: warning: type qualifiers ignored on function return type em.h:125: warning: type qualifiers ignored on function return type In file included from project.h:154, from em.cpp:23: eventmachine.h:46: warning: type qualifiers ignored on function return type eventmachine.h:47: warning: type qualifiers ignored on function return type eventmachine.h:48: warning: type qualifiers ignored on function return type eventmachine.h:50: warning: type qualifiers ignored on function return type eventmachine.h:65: warning: type qualifiers ignored on function return type eventmachine.h:66: warning: type qualifiers ignored on function return type eventmachine.h:67: warning: type qualifiers ignored on function return type eventmachine.h:68: warning: type qualifiers ignored on function return type In file included from project.h:154, from em.cpp:23: eventmachine.h:103: warning: type qualifiers ignored on function return type eventmachine.h:105: warning: type qualifiers ignored on function return type eventmachine.h:108: warning: type qualifiers ignored on function return type em.cpp: In member function 'bool EventMachine_t::_RunEpollOnce()': em.cpp:578: warning: 'int rb_thread_select(int, fd_set*, fd_set*, fd_set*, timeval*)' is deprecated (declared at /home/eventhub/.rvm/rubies/ruby-1.9.3-p125/include/ruby-1.9.1/ruby/intern.h:379) em.cpp:578: warning: 'int rb_thread_select(int, fd_set*, fd_set*, fd_set*, timeval*)' is deprecated (declared at /home/eventhub/.rvm/rubies/ruby-1.9.3-p125/include/ruby-1.9.1/ruby/intern.h:379) em.cpp: In member function 'bool EventMachine_t::_RunSelectOnce()': em.cpp:974: warning: 'int rb_thread_select(int, fd_set*, fd_set*, fd_set*, timeval*)' is deprecated (declared at /home/eventhub/.rvm/rubies/ruby-1.9.3-p125/include/ruby-1.9.1/ruby/intern.h:379) em.cpp:974: warning: 'int rb_thread_select(int, fd_set*, fd_set*, fd_set*, timeval*)' is deprecated (declared at /home/eventhub/.rvm/rubies/ruby-1.9.3-p125/include/ruby-1.9.1/ruby/intern.h:379) em.cpp: At global scope: em.cpp:1057: warning: type qualifiers ignored on function return type em.cpp:1079: warning: type qualifiers ignored on function return type em.cpp:1265: warning: type qualifiers ignored on function return type em.cpp:1338: warning: type qualifiers ignored on function return type em.cpp:1510: warning: type qualifiers ignored on function return type em.cpp:1593: warning: type qualifiers ignored on function return type em.cpp:1856: warning: type qualifiers ignored on function return type em.cpp:1982: warning: type qualifiers ignored on function return type em.cpp:2046: warning: type qualifiers ignored on function return type em.cpp:2070: warning: type qualifiers ignored on function return type em.cpp:2142: warning: type qualifiers ignored on function return type em.cpp:2361: fatal error: error writing to /tmp/ccdlOK0T.s: No space left on device compilation terminated. make: *** [em.o] Error 1 Gem files will remain installed in /home/eventhub/.rvm/gems/ruby-1.9.3-p125/gems/eventmachine-1.0.1 for inspection. Results logged to /home/eventhub/.rvm/gems/ruby-1.9.3-p125/gems/eventmachine-1.0.1/ext/gem_make.out Any thoughts? I read a lot of different ways to solve this issue, but none of them worked. Thanks

    Read the article

  • WSAECONNRESET (10054) error using WebDrive to map to a Subversion/Apache WebDAV share

    - by Dylan Beattie
    Hello, I'm using WebDrive to map a drive letter to a WebDAV share running on Subversion with the SVNAutoversioning flag enabled. The Subversion server is running CollabNet Subversion Edge with LDAP authentication. When trying to connect using WebDrive, I get: Connecting to site myserver Connecting to http://myserver/webdrive/ Resolving url myserver to an IP address Url resolved to IP address 192.168.0.12 Connecting to 192.168.0.12 on port 80 Connected successfully to the server on port 80 Testing directory listing ... Connecting to 192.168.0.12 on port 80 Connected successfully to the server on port 80 Unable to connect to server, error information below Error: Socket receive failure (4507) Operation: Connecting to server Winsock Error: WSAECONNRESET (10054) The httpd.conf file running on the server contains the following section: <Location /webdrive/> DAV svn SVNParentPath "C:\Program Files\Subversion\data\repositories" SVNReposName "My Subversion WebDrive" AuthzSVNAccessFile "C:\Program Files\Subversion\data/conf/svn_access_file" SVNListParentPath On Allow from all AuthType Basic AuthName "My Subversion Repository" AuthBasicProvider csvn-file-users ldap-users Require valid-user ModMimeUsePathInfo on SVNAutoversioning on </Location> and in the Apache error_yyyy_mm_dd.log file on the server, I'm seeing this when I try to connect via WebDAV: [Mon Jan 10 14:53:22 2011] [debug] mod_authnz_ldap.c(379): [client 192.168.0.50] [5572] auth_ldap authenticate: using URL ldap://mydc/dc=mydomain,dc=com?sAMAccountName?sub [Mon Jan 10 14:53:22 2011] [debug] mod_authnz_ldap.c(484): [client 192.168.0.50] [5572] auth_ldap authenticate: accepting dylan.beattie [Mon Jan 10 14:53:22 2011] [info] [client 192.168.0.50] Access granted: 'dylan.beattie' OPTIONS webdrive:/ [Mon Jan 10 14:53:22 2011] [debug] mod_authnz_ldap.c(379): [client 192.168.0.50] [5572] auth_ldap authenticate: using URL ldap://mydc/dc=mydomain,dc=com?sAMAccountName?sub [Mon Jan 10 14:53:22 2011] [debug] mod_authnz_ldap.c(484): [client 192.168.0.50] [5572] auth_ldap authenticate: accepting dylan.beattie [Mon Jan 10 14:53:22 2011] [info] [client 192.168.0.50] Access granted: 'dylan.beattie' PROPFIND webdrive:/ [Mon Jan 10 14:53:25 2011] [notice] Parent: child process exited with status 3221225477 -- Restarting. [Mon Jan 10 14:53:25 2011] [debug] util_ldap.c(1990): LDAP merging Shared Cache conf: shm=0xcd0f18 rmm=0xcd0f48 for VHOST: myserver.mydomain.com [Mon Jan 10 14:53:25 2011] [debug] util_ldap.c(1990): LDAP merging Shared Cache conf: shm=0xcd0f18 rmm=0xcd0f48 for VHOST: myserver.mydomain.com [Mon Jan 10 14:53:25 2011] [info] APR LDAP: Built with Microsoft Corporation. LDAP SDK [Mon Jan 10 14:53:25 2011] [info] LDAP: SSL support unavailable: LDAP: CA certificates cannot be set using this method, as they are stored in the registry instead. [Mon Jan 10 14:53:25 2011] [notice] Apache/2.2.16 (Win32) DAV/2 SVN/1.6.13 configured -- resuming normal operations [Mon Jan 10 14:53:25 2011] [notice] Server built: Oct 4 2010 19:55:36 [Mon Jan 10 14:53:25 2011] [notice] Parent: Created child process 4368 [Mon Jan 10 14:53:25 2011] [debug] mpm_winnt.c(487): Parent: Sent the scoreboard to the child [Mon Jan 10 14:53:25 2011] [debug] util_ldap.c(1990): LDAP merging Shared Cache conf: shm=0xca2bb0 rmm=0xca2be0 for VHOST: myserver.mydomain.com [Mon Jan 10 14:53:25 2011] [debug] util_ldap.c(1990): LDAP merging Shared Cache conf: shm=0xca2bb0 rmm=0xca2be0 for VHOST: myserver.mydomain.com [Mon Jan 10 14:53:25 2011] [info] APR LDAP: Built with Microsoft Corporation. LDAP SDK [Mon Jan 10 14:53:25 2011] [info] LDAP: SSL support unavailable: LDAP: CA certificates cannot be set using this method, as they are stored in the registry instead. [Mon Jan 10 14:53:25 2011] [error] python_init: Python version mismatch, expected '2.5', found '2.5.4'. [Mon Jan 10 14:53:25 2011] [error] python_init: Python executable found 'C:\\Program Files\\Subversion\\bin\\httpd.exe'. [Mon Jan 10 14:53:25 2011] [error] python_init: Python path being used 'C:\\Program Files\\Subversion\\Python25\\python25.zip;C:\\Program Files\\Subversion\\Python25\\\\DLLs;C:\\Program Files\\Subversion\\Python25\\\\lib;C:\\Program Files\\Subversion\\Python25\\\\lib\\plat-win;C:\\Program Files\\Subversion\\Python25\\\\lib\\lib-tk;C:\\Program Files\\Subversion\\bin'. [Mon Jan 10 14:53:25 2011] [notice] mod_python: Creating 8 session mutexes based on 0 max processes and 64 max threads. [Mon Jan 10 14:53:25 2011] [notice] Child 4368: Child process is running [Mon Jan 10 14:53:25 2011] [debug] mpm_winnt.c(408): Child 4368: Retrieved our scoreboard from the parent. [Mon Jan 10 14:53:25 2011] [info] Parent: Duplicating socket 288 and sending it to child process 4368 [Mon Jan 10 14:53:25 2011] [info] Parent: Duplicating socket 276 and sending it to child process 4368 [Mon Jan 10 14:53:25 2011] [debug] mpm_winnt.c(564): Child 4368: retrieved 2 listeners from parent [Mon Jan 10 14:53:25 2011] [notice] Child 4368: Acquired the start mutex. [Mon Jan 10 14:53:25 2011] [notice] Child 4368: Starting 64 worker threads. [Mon Jan 10 14:53:25 2011] [debug] mpm_winnt.c(605): Parent: Sent 2 listeners to child 4368 [Mon Jan 10 14:53:25 2011] [notice] Child 4368: Starting thread to listen on port 49159. [Mon Jan 10 14:53:25 2011] [notice] Child 4368: Starting thread to listen on port 80. [Mon Jan 10 14:53:25 2011] [debug] mod_authnz_ldap.c(379): [client 192.168.0.50] [4368] auth_ldap authenticate: using URL ldap://mydc/dc=mydomain,dc=com?sAMAccountName?sub [Mon Jan 10 14:53:25 2011] [debug] mod_authnz_ldap.c(484): [client 192.168.0.50] [4368] auth_ldap authenticate: accepting dylan.beattie [Mon Jan 10 14:53:25 2011] [info] [client 192.168.0.50] Access granted: 'dylan.beattie' PROPFIND webdrive:/ [Mon Jan 10 14:53:28 2011] [notice] Parent: child process exited with status 3221225477 -- Restarting. [Mon Jan 10 14:53:28 2011] [debug] util_ldap.c(1990): LDAP merging Shared Cache conf: shm=0xcd4f90 rmm=0xcd4fc0 for VHOST: myserver.mydomain.com [Mon Jan 10 14:53:28 2011] [debug] util_ldap.c(1990): LDAP merging Shared Cache conf: shm=0xcd4f90 rmm=0xcd4fc0 for VHOST: myserver.mydomain.com [Mon Jan 10 14:53:28 2011] [info] APR LDAP: Built with Microsoft Corporation. LDAP SDK [Mon Jan 10 14:53:28 2011] [info] LDAP: SSL support unavailable: LDAP: CA certificates cannot be set using this method, as they are stored in the registry instead. [Mon Jan 10 14:53:28 2011] [notice] Apache/2.2.16 (Win32) DAV/2 SVN/1.6.13 configured -- resuming normal operations [Mon Jan 10 14:53:28 2011] [notice] Server built: Oct 4 2010 19:55:36 [Mon Jan 10 14:53:28 2011] [notice] Parent: Created child process 5440 [Mon Jan 10 14:53:28 2011] [debug] mpm_winnt.c(487): Parent: Sent the scoreboard to the child [Mon Jan 10 14:53:28 2011] [debug] util_ldap.c(1990): LDAP merging Shared Cache conf: shm=0xda2bb0 rmm=0xda2be0 for VHOST: myserver.mydomain.com [Mon Jan 10 14:53:28 2011] [debug] util_ldap.c(1990): LDAP merging Shared Cache conf: shm=0xda2bb0 rmm=0xda2be0 for VHOST: myserver.mydomain.com [Mon Jan 10 14:53:28 2011] [info] APR LDAP: Built with Microsoft Corporation. LDAP SDK [Mon Jan 10 14:53:28 2011] [info] LDAP: SSL support unavailable: LDAP: CA certificates cannot be set using this method, as they are stored in the registry instead. [Mon Jan 10 14:53:28 2011] [error] python_init: Python version mismatch, expected '2.5', found '2.5.4'. [Mon Jan 10 14:53:28 2011] [error] python_init: Python executable found 'C:\\Program Files\\Subversion\\bin\\httpd.exe'. [Mon Jan 10 14:53:28 2011] [error] python_init: Python path being used 'C:\\Program Files\\Subversion\\Python25\\python25.zip;C:\\Program Files\\Subversion\\Python25\\\\DLLs;C:\\Program Files\\Subversion\\Python25\\\\lib;C:\\Program Files\\Subversion\\Python25\\\\lib\\plat-win;C:\\Program Files\\Subversion\\Python25\\\\lib\\lib-tk;C:\\Program Files\\Subversion\\bin'. [Mon Jan 10 14:53:28 2011] [notice] mod_python: Creating 8 session mutexes based on 0 max processes and 64 max threads. [Mon Jan 10 14:53:28 2011] [notice] Child 5440: Child process is running [Mon Jan 10 14:53:28 2011] [debug] mpm_winnt.c(408): Child 5440: Retrieved our scoreboard from the parent. [Mon Jan 10 14:53:28 2011] [info] Parent: Duplicating socket 288 and sending it to child process 5440 [Mon Jan 10 14:53:28 2011] [info] Parent: Duplicating socket 276 and sending it to child process 5440 [Mon Jan 10 14:53:28 2011] [debug] mpm_winnt.c(564): Child 5440: retrieved 2 listeners from parent [Mon Jan 10 14:53:28 2011] [notice] Child 5440: Acquired the start mutex. [Mon Jan 10 14:53:28 2011] [notice] Child 5440: Starting 64 worker threads. [Mon Jan 10 14:53:28 2011] [debug] mpm_winnt.c(605): Parent: Sent 2 listeners to child 5440 [Mon Jan 10 14:53:28 2011] [notice] Child 5440: Starting thread to listen on port 49159. [Mon Jan 10 14:53:28 2011] [notice] Child 5440: Starting thread to listen on port 80. Browsing http://myserver/webdrive/ from a web browser is working fine, and I have a similar set-up working perfectly on a different SVN server that isn't running Collabnet but has had Subversion and Apache installed and configured separately. Any ideas? The python version error might be red herring - I've seen it in a couple of places in the log files and in other scenarios it doesn't appear to be breaking anything...

    Read the article

  • Rails: Open HTTP URL From HTTPS site

    - by Imran
    I have a rails application running on SSL. I also have setup Piwik (for analytics) and it is running non-secure i.e. HTTP. When I try to make a call to Piwik API from my ruby code (the application running on SSL) it gives me the following error: SocketError (getaddrinfo: Name or service not known): /usr/lib/ruby/1.8/net/http.rb:560:in initialize' /usr/lib/ruby/1.8/net/http.rb:560:inopen' /usr/lib/ruby/1.8/net/http.rb:560:in connect' /usr/lib/ruby/1.8/timeout.rb:53:intimeout' /usr/lib/ruby/1.8/timeout.rb:93:in timeout' /usr/lib/ruby/1.8/net/http.rb:560:inconnect' /usr/lib/ruby/1.8/net/http.rb:553:in do_start' /usr/lib/ruby/1.8/net/http.rb:542:instart' /usr/lib/ruby/1.8/net/http.rb:379:in get_response' app/controllers/piwik_charts_controller.rb:195:inmake_graph' It works perfect when I make call from an application running on HTTP. Please advise. Thanks, Imran

    Read the article

  • nginx - redirection doesn't work as expected

    - by Luis
    I have a domain listening on both http and https. I want to redirect all the traffic to https except for two specific locations. It works, but only for mydomain.com, not for www.mydomain.com. Here the config: upstream mydomain_rails { server unix:/home/deploy/mydomain/shared/pids/unicorn.sock; } # blog.mydomain.com server { listen 80; server_name blog.mydomain.com; rewrite ^ http://www.mydomain.com/de/blog permanent; } # blog.mydomain.com.br server { listen 80; server_name blog.mydomain.com.br; rewrite ^ http://www.mydomain.com/br/blog permanent; } # www.mydomain.de server { listen 80; server_name mydomain.de www.mydomain.de; rewrite ^ https://www.mydomain.com/de permanent; } # www.mydomain.com.br server { listen 80; server_name mydomain.com.br www.mydomain.com.br; rewrite ^ https://www.mydomain.com/br permanent; } server { listen 80; server_name mydomain.com; rewrite ^ http://www.mydomain.com$request_uri permanent; } ## www.mydomain.com ## Redirect http to https, keep blogs on plain http server { listen 80; server_name www.mydomain.com; location / { # if ($host ~* ^(www\.mydomain\.com)$ ) { rewrite ^/(.*)$ https://www.mydomain.com/$1 permanent; # } # return 444; } # Matches any request starting with '/br/blog' and proxies to the upstream blog instance location ~* /br/blog { proxy_set_header X-Forwarded-For $proxy_add_x_forwarded_for; proxy_set_header Host $http_host; proxy_redirect off; if (!-f $request_filename) { rewrite ^/br/blog$ /; rewrite ^/br/blog/(.*)$ /$1; proxy_pass http://mydomain_blog_br; break; } } # Matches any request starting with '/de/blog' and proxies to the upstream blog instance location ~* /de/blog { proxy_set_header X-Forwarded-For $proxy_add_x_forwarded_for; proxy_set_header Host $http_host; proxy_redirect off; if (!-f $request_filename) { rewrite ^/de/blog$ /; rewrite ^/de/blog/(.*)$ /$1; proxy_pass http://mydomain_blog; break; } } } # www.mydomain.com server { add_header Cache-Control "public, must-revalidate"; server_name mydomain.com www.mydomain.com; listen 443; ssl on; ssl_certificate /etc/ssl/mydomain.com/sslchain.crt; ssl_certificate_key /etc/ssl/mydomain.com/privatekey.key; ## Strict Transport Security (ForceHTTPS), max-age 30d add_header Strict-Transport-Security "max-age=2592000; includeSubdomains"; ## Due SSL encryption, rather to increase the keepalive requests and timeout keepalive_requests 10; keepalive_timeout 60 60; root /home/deploy/mydomain/current/public/; error_log /home/deploy/mydomain/shared/log/nginx.error.log info; access_log /home/deploy/mydomain/shared/log/nginx.access.log main; ## Redirect from non-www to www if ($host = 'mydomain.com' ) { rewrite ^/(.*)$ https://www.mydomain.com/$1 permanent; } ## Caching images for 3 months location ~* \.(ico|css|js|gif|jpe?g|png)\?[0-9]+$ { expires 30d; break; } ## Deny illegal Host headers if ($host !~* ^(mydomain.com|www.mydomain.com)$ ) { return 444; } ## Deny certain User-Agents (case insensitive) if ($http_user_agent ~* (Baiduspider|webalta|Wget|WordPress|youdao|jakarta) ) { return 444; } ## Deny certain Referers (case insensitive) if ($http_referer ~* (dating|diamond|forsale|girl|jewelry|nudit|poker|porn|poweroversoftware|sex|teen|webcam|zippo|zongdo) ) { return 444; } ## Enable maintenance page. The page is copied in during capistrano deployment set $maintenance 0; if (-f $document_root/index.html) { set $maintenance 1; } if ($request_uri ~* (jpg|jpeg|gif|png|js|css)$) { set $maintenance 0; } if ($maintenance) { rewrite ^(.*)$ /index.html last; break; } location /uk { auth_basic "Restricted"; auth_basic_user_file /etc/nginx/htpasswd; root /home/deploy/mydomain/current/public/; try_files $uri @fallback; } # Matches any request starting with '/br/blog' and proxies to the upstream blog instance location ^~ /br/blog { proxy_set_header X-Forwarded-For $proxy_add_x_forwarded_for; proxy_set_header Host $http_host; proxy_redirect off; if (!-f $request_filename) { rewrite ^/br/blog$ /; rewrite ^/br/blog/(.*)$ /$1; proxy_pass http://mydomain_blog_br; break; } } # Matches any request starting with '/de/blog' and proxies to the upstream blog instance location ^~ /de/blog { proxy_set_header X-Forwarded-For $proxy_add_x_forwarded_for; proxy_set_header Host $http_host; proxy_redirect off; if (!-f $request_filename) { rewrite ^/de/blog$ /; rewrite ^/de/blog/(.*)$ /$1; proxy_pass http://mydomain_blog; break; }} # Matches any request starting with '/lp' and proxies to the upstream blog instance location /lp { proxy_set_header X-Forwarded-For $proxy_add_x_forwarded_for; proxy_set_header Host $http_host; proxy_redirect off; rewrite ^/lp(/?.*)$ /$1; proxy_pass http://mydomain_landingpage; break; } #Matches any request, and looks for static files before reverse proxying to the upstream app server socket location / { root /home/deploy/mydomain/current/public/; try_files $uri @fallback; } # Called after the above pattern, if no static file is found location @fallback { proxy_set_header X-Sendfile-Type X-Accel-Redirect; proxy_set_header X-Forwarded-For $proxy_add_x_forwarded_for; proxy_set_header Host $http_host; proxy_redirect off; proxy_pass http://mydomain_rails; } ## All other errors get the generic error page error_page 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 495 496 497 500 501 502 503 504 505 506 507 /500.html; location /500.html { root /home/deploy/mydomain/current/public/; } } I defined the blog upstream. As said, it works properly for mydomain.com, but not for www.mydomain.com. Any idea?

    Read the article

  • Did OpenPOP.net with GMail attachments break recently?

    - by Ashley Simpson
    I could swear this code was working few days ago. I'm using the SSL binaries from http://trixy.justinkbeck.com/2009/07/c-pop3-library-with-ssl-for-gmail.html POPClient client = new POPClient("pop.gmail.com", 995, "[email protected]", "qwerty", AuthenticationMethod.USERPASS, true); int unread = client.GetMessageCount(); for (int i = 0; i < unread; i++) { Message m = client.GetMessage(i + 1, true); Console.WriteLine(m.Subject); if (m.HasAttachment) { Attachment a = m.GetAttachment(1); // Problem! HasAttachment flag is set, but there's no attachments in the collection! m.SaveAttachment(a, a.ContentFileName); } } client.QUIT(); But today, I can read the mail ok but the attachments are empty. I'm thinking the China fiasco caused them to change something. Ideas?

    Read the article

  • Facebook Connect: problem including facebook class??

    - by Garrett
    Debug Error: /facebook-php-sdk/src/facebook.php line 511 - Uncaught CurlException: 60: SSL certificate problem, verify that the CA cert is OK. Details: error:14090086:SSL routines:SSL3_GET_SERVER_CERTIFICATE:certificate verify failed i really can't understand why this is happening... but here is the line (in the facebook class i downloaded): protected function makeRequest($url, $params, $ch=null) { if (!$ch) { $ch = curl_init(); } $opts = self::$CURL_OPTS; $opts[CURLOPT_POSTFIELDS] = $params; $opts[CURLOPT_URL] = $url; curl_setopt_array($ch, $opts); $result = curl_exec($ch); if ($result === false) { $e = new FacebookApiException(array( /////////////////// HERE 'error_code' => curl_errno($ch), 'error' => array( 'message' => curl_error($ch), 'type' => 'CurlException', ), )); curl_close($ch); throw $e; } curl_close($ch); return $result; } any ideas? thanks!

    Read the article

  • How to make QT support HTML 5 database?

    - by Mickey Shine
    I am using Qt 4.7.1 and embedded a webview in my app. But I got the following error when trying to visit http://webkit.org/demos/sticky-notes/ to test the HTML 5 database feature Failed to open the database on disk. This is probably because the version was bad or there is not enough space left in this domain's quota I compiled my static Qt library with the following command: configure --prefix=/usr/local/qt-static-release-db --accessibility --multimedia --audio-backend --svg --webkit --javascript-jit --script --scripttools --declarative --release -nomake examples -nomake demos --static --openssl -I /usr/local/ssl/include -L /usr/local/ssl/lib -confirm-license -sql-qsqlite -sql-qmysql -sql-qodbc

    Read the article

  • undefined BIO_new_socket function in OpenSSL library

    - by Chuck
    Hi, I get the following problem with some openssl (yeah, I know it's poorly documented, but I wish to use it any way) code in a project of mine (written in c, on osx and tested in ubuntu): Undefined symbols: "_BIO_new_socket", referenced from: _main in ccG3cvyw.o ld: symbol(s) not found collect2: ld returned 1 exit status I did have SSL library problems aswel, because I forgot to link my program to the openssl libraries. The above undefined still stands though. My compile line is: gcc -o test_app test_app.c -lssl Versions I use: (GCC) 4.2.1 OpenSSL 0.9.8l 5 Nov 2009 I'm fairly certain it's a (linked) library issue, as the SSL function SSL_set_bio() works (as in does not produce a build error). Any clue is very much appreciated :) Chuck

    Read the article

  • Cisco VPN Client Behind ASA 5505

    - by fdf33
    I'm trying to get connected to another ASA via Cisco VPN Client. I am behind an ASA 5505 myself and I am tryihng to VPN to a 5510. I get the message: Secure VPN Connection terminated locally by the Client. Reason 412: The remote peer is no longer responding. I can connect to the other ASA if I use a normal cheap Linksys. Here's the version of my ASA: Result of the command: "sh ver" Cisco Adaptive Security Appliance Software Version 8.4(1) Any help would be great. Thanks running-config : Saved : Written by enable_15 at 23:12:32.378 UTC Fri Jul 1 2011 ! ASA Version 8.4(1) ! hostname aaaasa domain-name aaa.local enable password xxxxxxxxxxxxxxx encrypted passwd xxxxxxxxxxxxxxxxxxxx encrypted names ! interface Vlan1 nameif inside security-level 100 ip address 192.168.1.254 255.255.255.0 ! interface Vlan2 nameif outside security-level 0 ip address xxx.xxx.xxx.xxx 255.255.254.0 ! interface Vlan5 no nameif security-level 50 ip address 172.16.0.254 255.255.255.0 ! interface Vlan500 no nameif security-level 100 ip address 10.10.10.1 255.255.255.0 ! interface Ethernet0/0 switchport access vlan 2 ! interface Ethernet0/1 ! interface Ethernet0/2 ! interface Ethernet0/3 ! interface Ethernet0/4 ! interface Ethernet0/5 ! interface Ethernet0/6 ! interface Ethernet0/7 ! boot system disk0:/asa841-k8.bin ftp mode passive dns domain-lookup inside dns domain-lookup outside dns server-group DefaultDNS name-server 4.2.2.2 domain-name aaa.local same-security-traffic permit inter-interface same-security-traffic permit intra-interface object network obj_any subnet 0.0.0.0 0.0.0.0 object network A_93.97.168.1 host 93.97.168.1 object network rdp host 192.168.1.2 object network NETWORK_OBJ_192.168.1.0_24 subnet 192.168.1.0 255.255.255.0 access-list 101 extended permit tcp any host 192.168.1.2 eq 3389 access-list 101 extended permit icmp any any echo-reply access-list 101 extended permit icmp any any source-quench access-list 101 extended permit icmp any any time-exceeded access-list 101 extended permit icmp any any unreachable access-list 102 extended permit ip any any pager lines 24 logging enable logging asdm informational mtu inside 1500 mtu outside 1492 ip local pool VPNPool 192.168.2.200-192.168.2.210 mask 255.255.255.0 icmp unreachable rate-limit 1 burst-size 1 asdm image disk0:/asdm-641.bin no asdm history enable arp timeout 14400 ! object network rdp nat (inside,outside) static interface service tcp 3389 3389 ! nat (inside,outside) after-auto source dynamic any interface access-group 101 in interface outside access-group 102 out interface outside ! router ospf 1 network 192.168.1.0 255.255.255.0 area 0 log-adj-changes ! route outside 0.0.0.0 0.0.0.0 93.97.168.1 1 timeout xlate 3:00:00 timeout conn 1:00:00 half-closed 0:10:00 udp 0:02:00 icmp 0:00:02 timeout sunrpc 0:10:00 h323 0:05:00 h225 1:00:00 mgcp 0:05:00 mgcp-pat 0:05:00 timeout sip 0:30:00 sip_media 0:02:00 sip-invite 0:03:00 sip-disconnect 0:02:00 timeout sip-provisional-media 0:02:00 uauth 0:05:00 absolute timeout tcp-proxy-reassembly 0:01:00 dynamic-access-policy-record DfltAccessPolicy http server enable http 192.168.1.0 255.255.255.0 inside no snmp-server location no snmp-server contact snmp-server enable traps snmp authentication linkup linkdown coldstart crypto ipsec ikev2 ipsec-proposal DES protocol esp encryption des protocol esp integrity sha-1 md5 crypto ipsec ikev2 ipsec-proposal 3DES protocol esp encryption 3des protocol esp integrity sha-1 md5 crypto ipsec ikev2 ipsec-proposal AES protocol esp encryption aes protocol esp integrity sha-1 md5 crypto ipsec ikev2 ipsec-proposal AES192 protocol esp encryption aes-192 protocol esp integrity sha-1 md5 crypto ipsec ikev2 ipsec-proposal AES256 protocol esp encryption aes-256 protocol esp integrity sha-1 md5 crypto dynamic-map SYSTEM_DEFAULT_CRYPTO_MAP 65535 set ikev2 ipsec-proposal AES256 AES192 AES 3DES DES crypto map outside_map 65535 ipsec-isakmp dynamic SYSTEM_DEFAULT_CRYPTO_MAP crypto map outside_map interface outside crypto ca trustpoint ASDM_TrustPoint0 enrollment self subject-name CN=ciscoasa proxy-ldc-issuer crl configure crypto ca certificate chain ASDM_TrustPoint0 certificate 8877d64d 30820248 308201b1 a0030201 02020488 77d64d30 0d06092a 864886f7 0d010105 05003036 3111300f 06035504 03130863 6973636f 61736131 21301f06 092a8648 86f70d01 09021612 63697363 6f617361 2e6e6a64 2e6c6f63 616c301e 170d3131 30353231 30383533 34325a17 0d323130 35313830 38353334 325a3036 3111300f 06035504 03130863 6973636f 61736131 21301f06 092a8648 86f70d01 09021612 63697363 6f617361 2e6e6a64 2e6c6f63 616c3081 9f300d06 092a8648 86f70d01 01010500 03818d00 30818902 818100ea 1aa95141 480e616c efee6816 a96d6511 313b6776 cd3dd57b cd84b4d2 5e108aee 7c980086 4d92e2eb b6c7bf66 4585af0a ccbf153a db9270be c6f5c67b db9dd8d1 2f78d033 3348b056 df4be0da 70e08953 53adf294 9db6c020 597d250f bf448b43 b90179c8 ff0b15d8 744632d9 31c1945f 0b11e258 b4c1d224 692efff4 7b2f5102 03010001 a3633061 300f0603 551d1301 01ff0405 30030101 ff300e06 03551d0f 0101ff04 04030201 86301f06 03551d23 04183016 8014493c 19db183a ab1af9e9 b1e44ad4 2a408b3c 89d1301d 0603551d 0e041604 14493c19 db183aab 1af9e9b1 e44ad42a 408b3c89 d1300d06 092a8648 86f70d01 01050500 03818100 1dd1760a fdd15941 4803fb9a cd6f44a7 2e275854 a1c0fbe1 d19f2cc9 182d43ef a547f854 8df96d15 3ea79c62 cf3fcb1c 5820360b c607dbfc 4de8bb16 19f727e9 b928a085 665816d8 138e4a35 ed610950 7910dd4a 0b1a9dd9 0e26f1c8 b78bc0cc cbf19eb2 4c4c3931 45199ea5 249e3266 661e44fd 7a00d376 dcfc6e4e d43f10b8 quit crypto isakmp nat-traversal 30 crypto ikev2 policy 1 encryption aes-256 integrity sha group 5 prf sha lifetime seconds 86400 crypto ikev2 policy 10 encryption aes-192 integrity sha group 5 prf sha lifetime seconds 86400 crypto ikev2 policy 20 encryption aes integrity sha group 5 prf sha lifetime seconds 86400 crypto ikev2 policy 30 encryption 3des integrity sha group 5 prf sha lifetime seconds 86400 crypto ikev2 policy 40 encryption des integrity sha group 5 prf sha lifetime seconds 86400 crypto ikev2 enable outside client-services port 443 crypto ikev2 remote-access trustpoint ASDM_TrustPoint0 telnet timeout 5 ssh 192.168.1.0 255.255.255.0 inside ssh timeout 5 console timeout 0 dhcpd auto_config outside ! dhcpd address 192.168.1.5-192.168.1.36 inside dhcpd dns 4.2.2.2 interface inside dhcpd enable inside ! threat-detection basic-threat threat-detection statistics host number-of-rate 3 threat-detection statistics port threat-detection statistics protocol threat-detection statistics access-list threat-detection statistics tcp-intercept rate-interval 30 burst-rate 400 average-rate 200 ntp server 82.219.4.31 source outside prefer ssl trust-point ASDM_TrustPoint0 outside webvpn enable outside anyconnect image disk0:/anyconnect-win-2.4.1012-k9.pkg 1 anyconnect profiles AnyConnectVPN_client_profile disk0:/AnyConnectVPN_client_profile.xml anyconnect profiles SSLAnyConnectVPN_client_profile disk0:/SSLAnyConnectVPN_client_profile.xml anyconnect enable tunnel-group-list enable group-policy GroupPolicy_AnyConnectVPN internal group-policy GroupPolicy_AnyConnectVPN attributes wins-server none dns-server value 4.2.2.2 vpn-tunnel-protocol ikev2 ssl-client ssl-clientless default-domain value aaa.local webvpn url-list none anyconnect profiles value AnyConnectVPN_client_profile type user group-policy GroupPolicy_SSLAnyConnectVPN internal group-policy GroupPolicy_SSLAnyConnectVPN attributes wins-server none dns-server value 4.2.2.2 vpn-tunnel-protocol ikev2 ssl-client default-domain value aaa.local webvpn anyconnect profiles value SSLAnyConnectVPN_client_profile type user username testuser password xxxxxxxxxxxxxxxxx encrypted privilege 0 username testuser attributes vpn-group-policy GroupPolicy_AnyConnectVPN tunnel-group SSLPOL type remote-access tunnel-group SSLPOL general-attributes default-group-policy GroupPolicy_AnyConnectVPN tunnel-group SSLAnyConnectVPN type remote-access tunnel-group SSLAnyConnectVPN general-attributes address-pool VPNPool default-group-policy GroupPolicy_SSLAnyConnectVPN tunnel-group SSLAnyConnectVPN webvpn-attributes group-alias SSLAnyConnectVPN enable ! class-map inspection_default match default-inspection-traffic ! ! policy-map type inspect dns preset_dns_map parameters message-length maximum 512 policy-map global_policy class inspection_default inspect dns preset_dns_map inspect esmtp inspect ftp inspect h323 h225 inspect h323 ras inspect ip-options inspect netbios inspect rsh inspect rtsp inspect sip inspect skinny inspect sqlnet inspect sunrpc inspect tftp inspect xdmcp ! service-policy global_policy global prompt hostname context call-home profile CiscoTAC-1 no active destination address http https://tools.cisco.com/its/service/oddce/services/DDCEService destination address email [email protected] destination transport-method http subscribe-to-alert-group diagnostic subscribe-to-alert-group environment subscribe-to-alert-group inventory periodic monthly subscribe-to-alert-group configuration periodic monthly subscribe-to-alert-group telemetry periodic daily Cryptochecksum:94a65341aa27d3929d5e92a32ba22120 : end

    Read the article

  • Restful authentication between two GAE apps.

    - by user259349
    Hello everyone, i am trying to write a restful google app engine application (python) that accepts requests only from another GAE that i wrote. I dont like any of the ways that i thought of to get this done, please advice if you know of something better than: Get SSL setup, and simply add the credentials on the request that my consuming app will send. I dont like it cause SSL will slow things down. Security by obsecurity. Add a random number in my request that is in Xmod0, where X is a secret number that both applications know. I just,,,, dont like this. Check the HTTP header to see where is the request coming from. This option is the one that i hate the least, not alot of processing, and spoofing an HTTP request is not really worth it, for my application's data. Is there any other clean solution for this?

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • SSL_CTX_use_PrivateKey_file fail on Linux (part 2)

    - by Fredrik Ullner
    For some reason, my calls to OpenSSL's SSL_CTX_use_PrivateKey_file have started to fail (again) on Ubuntu. My previous post concerning this function; http://stackoverflow.com/questions/2028862/ssl-ctx-use-privatekey-file-fail-under-linux With the above fix, I have been able to use things fine until a couple of days ago. I have no idea why. The error string I'm now getting is error:140B0009:SSL routines:SSL_CTX_use_PrivateKey_file:PEM lib with 336265225 as error code. What is the problem? Additional info: The file passed to the function exist (SSL_CTX_use_certificate_file is passed the same file). The code in the callback function for the password is also not called (at least apparantly not according to the debugger). Everything works fine on Windows.

    Read the article

  • facebook iframe size not working under https facebook connect

    - by acton
    Follow the following direction in: http://wiki.developers.facebook.com/index.php/Facebook_Connect_Via_SSL to use SSL version facebook connect, some of CanvasUtil functions regarding the resizing doesn't seem to work, the code is as following: FB_RequireFeatures(["Connect","Api","CanvasUtil"], function() { FB.Facebook.init(apiKey, channel,{ "doNotUseCachedConnectState":true }); FB.CanvasClient.getCanvasInfo(function(info){ alert("get it"); }); }); I don't see "get it". If I swtich back to http version, I could get the alert message and things are ok. Does anyone know how to make CanvasUtils from SSL facebook connect working? It might be a bug in facebook. Thanks a lot!

    Read the article

  • Apple Push Notifications With Foreign Accent Characters Not Receiving

    - by confeng
    I'm sending push notifications and when the message contains foreign characters (Turkish in my case) like I, s, ç, g... The message does not arrive to devices. Here's my code: $message = 'THIS is push'; $passphrase = 'mypass'; $ctx = stream_context_create(); stream_context_set_option($ctx, 'ssl', 'local_cert', 'MyPemFile.pem'); stream_context_set_option($ctx, 'ssl', 'passphrase', $passphrase); // Open a connection to the APNS server $fp = stream_socket_client( 'ssl://gateway.push.apple.com:2195', $err, $errstr, 60, STREAM_CLIENT_CONNECT|STREAM_CLIENT_PERSISTENT, $ctx); if (!$fp) exit("Failed to connect: $err $errstr" . PHP_EOL); echo 'Connected to Apple service. ' . PHP_EOL; // Encode the payload as JSON $body['aps'] = array( 'alert' => $message, 'sound' => 'default' ); $payload = json_encode($body); $result = 'Start'.PHP_EOL; $tokenArray = array('mytoken'); foreach ($tokenArray as $item) { // Build the binary notification $msg = chr(0) . pack('n', 32) . pack('H*', $item) . pack('n', strlen($payload)) . $payload; // Send it to the server $result = fwrite($fp, $msg, strlen($msg)); if (!$result) echo 'Failed message'.PHP_EOL; else echo 'Successful message'.PHP_EOL; } // Close the connection to the server fclose($fp); I have tried encoding $message variable with utf8_encode() but the message received as "THÝS is push". And other ways like iconv() didn't work for me, some of them cropped Turkish characters, some didn't receive at all. I also have header('content-type: text/html; charset: utf-8'); and <meta http-equiv="Content-Type" content="text/html; charset=UTF-8" /> in my page. I don't think the problem appears while I set the value but maybe with pack() function. Any ideas to solve this without replacing characters with English?

    Read the article

  • Simplest Way to Process Basic HTTPS GET File Requests?

    - by stormin986
    All I need to do is download some basic text-based and image files from a web server that has a self-signed SSL certificate. I have been trying to figure out how to use HttpClient to do this, but getting the SSL to work is a nightmare that seems to be way too much trouble for such a simple task. Is there a better way to perform these file downloads? Perhaps through a WebView or Browser feature? Reinventing the wheel of making a simple HTTPS GET request is a major pain, and is significantly holding up my development schedule.

    Read the article

  • imap_open() says "invalid remote specification" and fails to connect

    - by Kristopher Ives
    When I try to use imap_open I get the following error: Warning: imap_open() [function.imap-open]: Couldn't open stream {mail.domain.com:110/pop3/novalidate-cert/} in /path/to/mailbox.php on line 5 Can't open mailbox {mail.domain.com:110/pop3/novalidate-cert/}: invalid remote specification My phpinfo says that I have: IMAP c-Client Version 2007e SSL Support enabled Kerberos Support enabled On another server that gives the same phpinfo for imap it works, although that version is 2006. PHP says it was compiled with the following settings: './configure' '--disable-path-info-check' '--enable-exif' '--enable-fastcgi' '--enable-ftp' '--enable-gd-native-ttf' '--enable-libxml' '--enable-mbstring' '--enable-pdo=shared' '--enable-soap' '--enable-sockets' '--enable-zip' '--prefix=/usr' '--with-bz2' '--with-curl=/opt/curlssl/' '--with-freetype-dir=/usr' '--with-gd' '--with-gettext' '--with-imap=/opt/php_with_imap_client/' '--with-imap-ssl=/usr' '--with-jpeg-dir=/usr' '--with-kerberos' '--with-libexpat-dir=/usr' '--with-libxml-dir=/opt/xml2' '--with-libxml-dir=/opt/xml2/' '--with-mysql=/usr' '--with-mysql-sock=/var/lib/mysql/mysql.sock' '--with-mysqli=/usr/bin/mysql_config' '--with-openssl=/usr' '--with-openssl-dir=/usr' '--with-pdo-mysql=shared' '--with-pdo-sqlite=shared' '--with-pgsql=/usr' '--with-png-dir=/usr' '--with-sqlite=shared' '--with-ttf' '--with-xpm-dir=/usr' '--with-zlib' '--with-zlib-dir=/usr'

    Read the article

  • html5 cache -> "network: *" doesn't work

    - by Greg
    Hello all, I am trying a simple test with the html 5 cache. Here is a simple web page : <!DOCTYPE html> <html manifest="test.manifest"> <head> </head> <body> <img src="http://www.somewebsite.com/picture.jpg"/> </body> </html> With the following manifest : CACHE MANIFEST #v0.1 NETWORK: http://www.somewebsite.com/ This work fine, the picture is displayed. My problem is that I won't be able to know from where the picture will come. Here comes the online whitelist wildcard flag, that is supposed to solve my problem. But with the manifest : CACHE MANIFEST #v0.1 NETWORK: * The image is not displayed (tested on safari / safari mobile / firefox). What is not working ? Is there another way to turn the online whitelist wildcard flag on ?

    Read the article

  • Restfull authentication between two GAE apps.

    - by user259349
    Hello everyone, i am trying to write a restful google app engine application (python) that accepts requests only from another GAE that i wrote. I dont like any of the ways that i thought of to get this done, please advice if you know of something better than: Get SSL setup, and simply add the credentials on the request that my consuming app will send. I dont like it cause SSL will slow things down. Security by obsecurity. Pass a long number by my consuming app that is in Xmod0, where X is a secret number that both applications know. I just,,,, dont like this. Check the HTTP header to see where is the request coming from. This option is the one that i hate the least, not alot of processing, and spoofing an HTTP request is not really worth it, for my application's data. Is there any other clean solution for this?

    Read the article

  • SharePoint : https area in a public website

    - by Hugo Migneron
    I'm working on a public website that was built using SharePoint (WSS). We need to add an area in the site where people will be able to purchase items with their credit cards and obviously the area needs to be secured. The website is using Form Based Authentication and the users need to stay logged in when they are moved back and forth from the https zone. I know how to enable SSL for a new web application / site collection but this isn't really an option for me as the website is already online and we don't want the whole thing to be secured. I am comfortable with the development of the webparts involved (payment module, shopping cart, etc.) but I can't really figure out how to create only certain https pages when the site collection is created. Can you have features that deploy pages that are secured? If so, how? Can you have a zone where SSL is enabled but where the users are redirected to and from without losing their authentication (FBA)? Thanks!

    Read the article

< Previous Page | 90 91 92 93 94 95 96 97 98 99 100 101  | Next Page >