Search Results

Search found 2779 results on 112 pages for 'yield keyword'.

Page 94/112 | < Previous Page | 90 91 92 93 94 95 96 97 98 99 100 101  | Next Page >

  • Does SNI represent a privacy concern for my website visitors?

    - by pagliuca
    Firstly, I'm sorry for my bad English. I'm still learning it. Here it goes: When I host a single website per IP address, I can use "pure" SSL (without SNI), and the key exchange occurs before the user even tells me the hostname and path that he wants to retrieve. After the key exchange, all data can be securely exchanged. That said, if anybody happens to be sniffing the network, no confidential information is leaked* (see footnote). On the other hand, if I host multiple websites per IP address, I will probably use SNI, and therefore my website visitor needs to tell me the target hostname before I can provide him with the right certificate. In this case, someone sniffing his network can track all the website domains he is accessing. Are there any errors in my assumptions? If not, doesn't this represent a privacy concern, assuming the user is also using encrypted DNS? Footnote: I also realize that a sniffer could do a reverse lookup on the IP address and find out which websites were visited, but the hostname travelling in plaintext through the network cables seems to make keyword based domain blocking easier for censorship authorities.

    Read the article

  • Is there a local yubnub.org replacement?

    - by Justin Keogh
    I use yubnub very often... every google search I do by just (in firefox) "ctrl-t" - (now in the url bar) "y g searchterms" [Enter] "y" in this case is a search keyword I added by right clicking in the yubnub.org command box it's really fast, and I just do it automatically now... but the problem is now I am stuck with whatever the yubnub command that I am so used to using does. I cant change it... for example, what if I dont want to use google... but I still want to use the "g" command to search? or say I want to use google's https search... ect... I suppose this would be kinda trivial to implement locally... but I would hate to re-invent the code if it's allready done and in use... ideas? Also a local yubnub.org replacement would save me the DNS lookup and traffic to yubnub.org. I dont expect to be able to import all commands from yubnub.org but that would be cool if possible.

    Read the article

  • Allow members of a group to be unlocked by a specific account on AD

    - by JohnLBevan
    Background I'm creating a service to allow support staff to enable their firecall accounts out of hours (i.e. if there's an issue in the night and we can't get hold of someone with admin rights, another member of the support team can enable their personal firecall account on AD, which has previously been setup with admin rights). This service also logs a reason for the change, alerts key people, and a bunch of other bits to ensure that this change of access is audited / so we can ensure these temporary admin rights are used in the proper way. To do this I need the service account which my service runs under to have permissions to enable users on active directory. Ideally I'd like to lock this down so that the service account can only enable/disable users in a particular AD security group. Question How do you grant access to an account to enable/disable users who are members of a particular security group in AD? Backup Question If it's not possible to do this by security group, is there a suitable alternative? i.e. could it be done by OU, or would it be best to write a script to loop through all members of the security group and update the permissions on the objects (firecall accounts) themselves? Thanks in advance. Additional Tags (I don't yet have access to create new tags here, so listing below to help with keyword searches until it can be tagged & this bit editted/removed) DSACLS, DSACLS.EXE, FIRECALL, ACCOUNT, SECURITY-GROUP

    Read the article

  • Is there an algorithm for converting quaternion rotations to Euler angle rotations?

    - by Will Baker
    Is there an existing algorithm for converting a quaternion representation of a rotation to an Euler angle representation? The rotation order for the Euler representation is known and can be any of the six permutations (i.e. xyz, xzy, yxz, yzx, zxy, zyx). I've seen algorithms for a fixed rotation order (usually the NASA heading, bank, roll convention) but not for arbitrary rotation order. Furthermore, because there are multiple Euler angle representations of a single orientation, this result is going to be ambiguous. This is acceptable (because the orientation is still valid, it just may not be the one the user is expecting to see), however it would be even better if there was an algorithm which took rotation limits (i.e. the number of degrees of freedom and the limits on each degree of freedom) into account and yielded the 'most sensible' Euler representation given those constraints. I have a feeling this problem (or something similar) may exist in the IK or rigid body dynamics domains. Solved: I just realised that it might not be clear that I solved this problem by following Ken Shoemake's algorithms from Graphics Gems. I did answer my own question at the time, but it occurs to me it may not be clear that I did so. See the answer, below, for more detail. Just to clarify - I know how to convert from a quaternion to the so-called 'Tait-Bryan' representation - what I was calling the 'NASA' convention. This is a rotation order (assuming the convention that the 'Z' axis is up) of zxy. I need an algorithm for all rotation orders. Possibly the solution, then, is to take the zxy order conversion and derive from it five other conversions for the other rotation orders. I guess I was hoping there was a more 'overarching' solution. In any case, I am surprised that I haven't been able to find existing solutions out there. In addition, and this perhaps should be a separate question altogether, any conversion (assuming a known rotation order, of course) is going to select one Euler representation, but there are in fact many. For example, given a rotation order of yxz, the two representations (0,0,180) and (180,180,0) are equivalent (and would yield the same quaternion). Is there a way to constrain the solution using limits on the degrees of freedom? Like you do in IK and rigid body dynamics? i.e. in the example above if there were only one degree of freedom about the Z axis then the second representation can be disregarded. I have tracked down one paper which could be an algorithm in this pdf but I must confess I find the logic and math a little hard to follow. Surely there are other solutions out there? Is arbitrary rotation order really so rare? Surely every major 3D package that allows skeletal animation together with quaternion interpolation (i.e. Maya, Max, Blender, etc) must have solved exactly this problem?

    Read the article

  • Rails 3 and Bootstrap 2.1.0 - can't fix my footer

    - by ExiRe
    I have Rails application with bootstrap 2.1.0 (i use twitter-bootstrap-rails gem for that). But i can't get working footer. It is not visible unless i scroll down the page. I can't get how to fix that. Application.html.haml !!! %html %head %title MyApp = stylesheet_link_tag "application", :media => "all" = javascript_include_tag "application" = csrf_meta_tags %meta{ :name => "viewport", :content => "width=device-width, initial-scale=1.0" } %body %div{ :class => "wrapper" } = render 'layouts/navbar_template' %div{ :class => "container-fluid" } - flash.each do |key, value| = content_tag( :div, value, :class => "alert alert-#{key}" ) %div{ :class => "row-fluid" } %div{:class => "span10"} =yield %div{:class => "span2"} %h2 Test sidebar %footer{ :class => "footer" } = debug(params) if Rails.env.development? bootstrap_and_overrides.css.less @import "twitter/bootstrap/bootstrap"; body { padding-top: 60px; } @import "twitter/bootstrap/responsive"; // Set the correct sprite paths @iconSpritePath: asset-path('twitter/bootstrap/glyphicons-halflings.png'); @iconWhiteSpritePath: asset-path('twitter/bootstrap/glyphicons-halflings-white.png'); // Set the Font Awesome (Font Awesome is default. You can disable by commenting below lines) // Note: If you use asset_path() here, your compiled boostrap_and_overrides.css will not // have the proper paths. So for now we use the absolute path. @fontAwesomeEotPath: '/assets/fontawesome-webfont.eot'; @fontAwesomeWoffPath: '/assets/fontawesome-webfont.woff'; @fontAwesomeTtfPath: '/assets/fontawesome-webfont.ttf'; @fontAwesomeSvgPath: '/assets/fontawesome-webfont.svg'; // Font Awesome @import "fontawesome"; // Your custom LESS stylesheets goes here // // Since bootstrap was imported above you have access to its mixins which // you may use and inherit here // // If you'd like to override bootstrap's own variables, you can do so here as well // See http://twitter.github.com/bootstrap/less.html for their names and documentation // // Example: // @linkColor: #ff0000; //MY CSS IS HERE. html, body { height: 100%; } footer { color: #666; background: #F5F5F5; padding: 17px 0 18px 0; border-top: 1px solid #000; } footer a { color: #999; } footer a:hover { color: #efefef; } .wrapper { min-height: 100%; height: auto !important; height: 10px; margin-bottom: -10px; }

    Read the article

  • heroku time zone problem, logging local server time

    - by Ole Morten Amundsen
    UPDATE: Ok, I didn't formulate a good Q to be answered. I still struggle with heroku being on -07:00 UTC and I at +02:200 UTC. Q: How do I get the log written in the correct Time.zone ? The 9 hours difference, heroku (us west) - norway, is distracting to work with. I get this in my production.log (using heroku logs): Processing ProductionController#create to xml (for 81.26.51.35 at 2010-04-28 23:00:12) [POST] How do I get it to write 2010-04-29 08:00:12 +02:00 GMT ? Note that I'm running at heroku and cannot set the server time myself, as one could do at your amazon EC2 servers. Below is my previous question, I'll leave it be as it holds some interesting information about time and zones. Why does Time.now yield the server local time when I have set the another time zone in my environment.rb config.time_zone = 'Copenhagen' I've put this in a view <p> Time.zone <%= Time.zone %> </p> <p> Time.now <%= Time.now %> </p> <p> Time.now.utc <%= Time.now.utc %> </p> <p> Time.zone.now <%= Time.zone.now %> </p> <p> Time.zone.today <%= Time.zone.today %> </p> rendering this result on my app at heroku Time.zone (GMT+01:00) Copenhagen Time.now Mon Apr 26 08:28:21 -0700 2010 Time.now.utc Mon Apr 26 15:28:21 UTC 2010 Time.zone.now 2010-04-26 17:28:21 +0200 Time.zone.today 2010-04-26 Time.zone.now yields the correct result. Do I have to switch from Time.now to Time.zone.now, everywhere? Seems cumbersome. I truly don't care what the local time of the server is, it's giving me loads of trouble due to extensive use of Time.now. Am I misunderstanding anything fundamental here?

    Read the article

  • State machines in C#

    - by Sir Psycho
    Hi, I'm trying to work out what's going on with this code. I have two threads iterating over the range and I'm trying to understand what is happening when the second thread calls GetEnumerator(). This line in particular (T current = start;), seems to spawn a new 'instance' in this method by the second thread. Seeing that there is only one instance of the DateRange class, I'm trying to understand why this works. Thanks in advance. class Program { static void Main(string[] args) { var daterange = new DateRange(DateTime.Now, DateTime.Now.AddDays(10), new TimeSpan(24, 0, 0)); var ts1 = new ThreadStart(delegate { foreach (var date in daterange) { Console.WriteLine("Thread " + Thread.CurrentThread.ManagedThreadId + " " + date); } }); var ts2 = new ThreadStart(delegate { foreach (var date in daterange) { Console.WriteLine("Thread " + Thread.CurrentThread.ManagedThreadId + " " + date); } }); Thread t1 = new Thread(ts1); Thread t2 = new Thread(ts2); t1.Start(); Thread.Sleep(4000); t2.Start(); Console.Read(); } } public class DateRange : Range<DateTime> { public DateTime Start { get; private set; } public DateTime End { get; private set; } public TimeSpan SkipValue { get; private set; } public DateRange(DateTime start, DateTime end, TimeSpan skip) : base(start, end) { SkipValue = skip; } public override DateTime GetNextElement(DateTime current) { return current.Add(SkipValue); } } public abstract class Range<T> : IEnumerable<T> where T : IComparable<T> { readonly T start; readonly T end; public Range(T start, T end) { if (start.CompareTo(end) > 0) throw new ArgumentException("Start value greater than end value"); this.start = start; this.end = end; } public abstract T GetNextElement(T currentElement); public IEnumerator<T> GetEnumerator() { T current = start; do { Thread.Sleep(1000); yield return current; current = GetNextElement(current); } while (current.CompareTo(end) < 1); } System.Collections.IEnumerator System.Collections.IEnumerable.GetEnumerator() { return GetEnumerator(); } }

    Read the article

  • Available Coroutine Libraries in Java

    - by JUST MY correct OPINION
    I would like to do some stuff in Java that would be clearer if written using concurrent routines, but for which full-on threads are serious overkill. The answer, of course, is the use of coroutines, but there doesn't appear to be any coroutine support in the standard Java libraries and a quick Google on it brings up tantalising hints here or there, but nothing substantial. Here's what I've found so far: JSIM has a coroutine class, but it looks pretty heavyweight and conflates, seemingly, with threads at points. The point of this is to reduce the complexity of full-on threading, not to add to it. Further I'm not sure that the class can be extracted from the library and used independently. Xalan has a coroutine set class that does coroutine-like stuff, but again it's dubious if this can be meaningfully extracted from the overall library. It also looks like it's implemented as a tightly-controlled form of thread pool, not as actual coroutines. There's a Google Code project which looks like what I'm after, but if anything it looks more heavyweight than using threads would be. I'm basically nervous of something that requires software to dynamically change the JVM bytecode at runtime to do its work. This looks like overkill and like something that will cause more problems than coroutines would solve. Further it looks like it doesn't implement the whole coroutine concept. By my glance-over it gives a yield feature that just returns to the invoker. Proper coroutines allow yields to transfer control to any known coroutine directly. Basically this library, heavyweight and scary as it is, only gives you support for iterators, not fully-general coroutines. The promisingly-named Coroutine for Java fails because it's a platform-specific (obviously using JNI) solution. And that's about all I've found. I know about the native JVM support for coroutines in the Da Vinci Machine and I also know about the JNI continuations trick for doing this. These are not really good solutions for me, however, as I would not necessarily have control over which VM or platform my code would run on. (Indeed any bytecode manipulation system would suffer similar problems -- it would be best were this pure Java if possible. Runtime bytecode manipulation would restrict me from using this on Android, for example.) So does anybody have any pointers? Is this even possible? If not, will it be possible in Java 7? Edited to add: Just to ensure that confusion is contained, this is a related question to my other one, but not the same. This one is looking for an existing implementation in a bid to avoid reinventing the wheel unnecessarily. The other one is a question relating to how one would go about implementing coroutines in Java should this question prove unanswerable. The intent is to keep different questions on different threads.

    Read the article

  • What's a clean way to break up a DataTable into chunks of a fixed size with Linq?

    - by Michael Haren
    Update: Here's a similar question Suppose I have a DataTable with a few thousand DataRows in it. I'd like to break up the table into chunks of smaller rows for processing. I thought C#3's improved ability to work with data might help. This is the skeleton I have so far: DataTable Table = GetTonsOfData(); // Chunks should be any IEnumerable<Chunk> type var Chunks = ChunkifyTableIntoSmallerChunksSomehow; // ** help here! ** foreach(var Chunk in Chunks) { // Chunk should be any IEnumerable<DataRow> type ProcessChunk(Chunk); } Any suggestions on what should replace ChunkifyTableIntoSmallerChunksSomehow? I'm really interested in how someone would do this with access C#3 tools. If attempting to apply these tools is inappropriate, please explain! Update 3 (revised chunking as I really want tables, not ienumerables; going with an extension method--thanks Jacob): Final implementation: Extension method to handle the chunking: public static class HarenExtensions { public static IEnumerable<DataTable> Chunkify(this DataTable table, int chunkSize) { for (int i = 0; i < table.Rows.Count; i += chunkSize) { DataTable Chunk = table.Clone(); foreach (DataRow Row in table.Select().Skip(i).Take(chunkSize)) { Chunk.ImportRow(Row); } yield return Chunk; } } } Example consumer of that extension method, with sample output from an ad hoc test: class Program { static void Main(string[] args) { DataTable Table = GetTonsOfData(); foreach (DataTable Chunk in Table.Chunkify(100)) { Console.WriteLine("{0} - {1}", Chunk.Rows[0][0], Chunk.Rows[Chunk.Rows.Count - 1][0]); } Console.ReadLine(); } static DataTable GetTonsOfData() { DataTable Table = new DataTable(); Table.Columns.Add(new DataColumn()); for (int i = 0; i < 1000; i++) { DataRow Row = Table.NewRow(); Row[0] = i; Table.Rows.Add(Row); } return Table; } }

    Read the article

  • Rails render partial with block

    - by brad
    I'm trying to re-use an html component that i've written that provides panel styling. Something like: <div class="v-panel"> <div class="v-panel-tr"></div> <h3>Some Title</h3> <div class="v-panel-c"> .. content goes here </div> <div class="v-panel-b"><div class="v-panel-br"></div><div class="v-panel-bl"></div></div> </div> So I see that render takes a block. I figured then I could do something like this: # /shared/_panel.html.erb <div class="v-panel"> <div class="v-panel-tr"></div> <h3><%= title %></h3> <div class="v-panel-c"> <%= yield %> </div> <div class="v-panel-b"><div class="v-panel-br"></div><div class="v-panel-bl"></div></div> </div> And I want to do something like: #some html view <%= render :partial => '/shared/panel', :locals =>{:title => "Some Title"} do %> <p>Here is some content to be rendered inside the panel</p> <% end %> Unfortunately this doesn't work with this error: ActionView::TemplateError (/Users/bradrobertson/Repos/VeloUltralite/source/trunk/app/views/sessions/new.html.erb:1: , unexpected tRPAREN old_output_buffer = output_buffer;;@output_buffer = ''; __in_erb_template=true ; @output_buffer.concat(( render :partial => '/shared/panel', :locals => {:title => "Welcome"} do ).to_s) on line #1 of app/views/sessions/new.html.erb: 1: <%= render :partial => '/shared/panel', :locals => {:title => "Welcome"} do -%> ... So it doesn't like the = obviously with a block, but if I remove it, then it just doesn't output anything. Does anyone know how to do what I'm trying to achieve here? I'd like to re-use this panel html in many places on my site.

    Read the article

  • Coroutines in Java

    - by JUST MY correct OPINION
    I would like to do some stuff in Java that would be clearer if written using concurrent routines, but for which full-on threads are serious overkill. The answer, of course, is the use of coroutines, but there doesn't appear to be any coroutine support in the standard Java libraries and a quick Google on it brings up tantalising hints here or there, but nothing substantial. Here's what I've found so far: JSIM has a coroutine class, but it looks pretty heavyweight and conflates, seemingly, with threads at points. The point of this is to reduce the complexity of full-on threading, not to add to it. Further I'm not sure that the class can be extracted from the library and used independently. Xalan has a coroutine set class that does coroutine-like stuff, but again it's dubious if this can be meaningfully extracted from the overall library. It also looks like it's implemented as a tightly-controlled form of thread pool, not as actual coroutines. There's a Google Code project which looks like what I'm after, but if anything it looks more heavyweight than using threads would be. I'm basically nervous of something that requires software to dynamically change the JVM bytecode at runtime to do its work. This looks like overkill and like something that will cause more problems than coroutines would solve. Further it looks like it doesn't implement the whole coroutine concept. By my glance-over it gives a yield feature that just returns to the invoker. Proper coroutines allow yields to transfer control to any known coroutine directly. Basically this library, heavyweight and scary as it is, only gives you support for iterators, not fully-general coroutines. The promisingly-named Coroutine for Java fails because it's a platform-specific (obviously using JNI) solution. And that's about all I've found. I know about the native JVM support for coroutines in the Da Vinci Machine and I also know about the JNI continuations trick for doing this. These are not really good solutions for me, however, as I would not necessarily have control over which VM or platform my code would run on. (Indeed any bytecode manipulation system would suffer similar problems -- it would be best were this pure Java if possible. Runtime bytecode manipulation would restrict me from using this on Android, for example.) So does anybody have any pointers? Is this even possible? If not, will it be possible in Java 7?

    Read the article

  • IP address numbers in MySQL subquery

    - by Iain Collins
    I have a problem with a subquery involving IPV4 addresses stored in MySQL (MySQL 5.0). The IP addresses are stored in two tables, both in network number format - e.g. the format output by MySQL's INET_ATON(). The first table ('events') contains lots of rows with IP addresses associated with them, the second table ('network_providers') contains a list of provider information for given netblocks. events table (~4,000,000 rows): event_id (int) event_name (varchar) ip_address (unsigned 4 byte int) network_providers table (~60,000 rows): ip_start (unsigned 4 byte int) ip_end (unsigned 4 byte int) provider_name (varchar) Simplified for the purposes of the problem I'm having, the goal is to create an export along the lines of: event_id,event_name,ip_address,provider_name If do a query along the lines of either of the following, I get the result I expect: SELECT provider_name FROM network_providers WHERE INET_ATON('192.168.0.1') >= network_providers.ip_start ORDER BY network_providers.ip_start DESC LIMIT 1 SELECT provider_name FROM network_providers WHERE 3232235521 >= network_providers.ip_start ORDER BY network_providers.ip_start DESC LIMIT 1 That is to say, it returns the correct provider_name for whatever IP I look up (of course I'm not really using 192.168.0.1 in my queries). However, when performing this same query as a subquery, in the following manner, it doesn't yield the result I would expect: SELECT event.id, event.event_name, (SELECT provider_name FROM network_providers WHERE event.ip_address >= network_providers.ip_start ORDER BY network_providers.ip_start DESC LIMIT 1) as provider FROM events Instead the a different (incorrect) value for network_provider is returned - over 90% (but curiously not all) values returned in the provider column contain the wrong provider information for that IP. Using event.ip_address in a subquery just to echo out the value confirms it contains the value I'd expect and that the subquery can parse it. Replacing event.ip_address with an actual network number also works, just using it dynamically in the subquery in this manner that doesn't work for me. I suspect the problem is there is something fundamental and important about subqueries in MySQL that I don't get. I've worked with IP addresses like this in MySQL quite a bit before, but haven't previously done lookups for them using a subquery. The question: I'd really appreciate an example of how I could get the output I want, and if someone here knows, some enlightenment as to why what I'm doing doesn't work so I can avoid making this mistake again. Notes: The actual real-world usage I'm trying to do is considerably more complicated (involving joining two or three tables). This is a simplified version, to avoid overly complicating the question. Additionally, I know I'm not using a between on ip_start & ip_end - that's intentional (the DB's can be out of date, and such cases the owner in the DB is almost always in the next specified range and 'best guess' is fine in this context) however I'm grateful for any suggestions for improvement that relate to the question. Efficiency is always nice, but in this case absolutely not essential - any help appreciated.

    Read the article

  • How can I implement NotOfType<T> in LINQ that has a nice calling syntax?

    - by Lette
    I'm trying to come up with an implementation for NotOfType, which has a readable call syntax. NotOfType should be the complement to OfType<T> and would consequently yield all elements that are not of type T My goal was to implement a method which would be called just like OfType<T>, like in the last line of this snippet: public abstract class Animal {} public class Monkey : Animal {} public class Giraffe : Animal {} public class Lion : Animal {} var monkey = new Monkey(); var giraffe = new Giraffe(); var lion = new Lion(); IEnumerable<Animal> animals = new Animal[] { monkey, giraffe, lion }; IEnumerable<Animal> fewerAnimals = animals.NotOfType<Giraffe>(); However, I can not come up with an implementation that supports that specific calling syntax. This is what I've tried so far: public static class EnumerableExtensions { public static IEnumerable<T> NotOfType<T>(this IEnumerable<T> sequence, Type type) { return sequence.Where(x => x.GetType() != type); } public static IEnumerable<T> NotOfType<T, TExclude>(this IEnumerable<T> sequence) { return sequence.Where(x => !(x is TExclude)); } } Calling these methods would look like this: // Animal is inferred IEnumerable<Animal> fewerAnimals = animals.NotOfType(typeof(Giraffe)); and // Not all types could be inferred, so I have to state all types explicitly IEnumerable<Animal> fewerAnimals = animals.NotOfType<Animal, Giraffe>(); I think that there are major drawbacks with the style of both of these calls. The first one suffers from a redundant "of type/type of" construct, and the second one just doesn't make sense (do I want a list of animals that are neither Animals nor Giraffes?). So, is there a way to accomplish what I want? If not, could it be possible in future versions of the language? (I'm thinking that maybe one day we will have named type arguments, or that we only need to explicitly supply type arguments that can't be inferred?) Or am I just being silly?

    Read the article

  • Distinct rand() sequences yielding the same results in an expression

    - by suszterpatt
    Ok, this is a really weird one. I have an MPI program, where each process has to generate random numbers in a fixed range (the range is read from file). What happens is that even though I seed each process with a different value, and the numbers generated by rand() are different in each process, the expression to generate the random numbers still yields the same sequence between them. Here's all relevant code: // 'rank' will be unique for each process int rank; MPI_Comm_rank(MPI_COMM_WORLD, &rank); // seed the RNG with a different value for each process srand(time(NULL) + rank); // print some random numbers to see if we get a unique sequence in each process // 'log' is a uniquely named file, each process has its own log << rand() << " " << rand() << " " << rand() << std::endl; // do boring deterministic stuff while (true) { // waitTimeMin and waitTimeMax are integers, Max is always greater than Min waitSecs = waitTimeMin + rand() % (waitTimeMax - waitTimeMin); log << "waiting " << waitSecs << " seconds" << std::endl; sleep(waitSecs); // do more boring deterministic stuff } Here's the output of each process, with 3 processes generating numbers in the range [1,9]. process 1: 15190 28284 3149 waiting 6 seconds waiting 8 seconds waiting 9 seconds waiting 4 seconds process 2: 286 6264 3153 waiting 6 seconds waiting 8 seconds waiting 9 seconds waiting 4 seconds process 3: 18151 17013 3156 waiting 6 seconds waiting 8 seconds waiting 9 seconds waiting 4 seconds So while rand() clearly generates different numbers, the expression to calculate waitSecs still evaluates to the same sequence on all processes. What's even weirder: if I run the program with the same parameteres again, only the first 3 random numbers will change, the rest of the "random" sequence will be exactly the same in each run! Changing the range of numbers will obviously produce a different result from this one, but the same parameters always yield the same sequence, between processes and between executions: except for the first 3 numbers. Just what the hell is going on here?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Use HTTP PUT to create new cache (ehCache) running on the same Tomcat?

    - by socal_javaguy
    I am trying to send a HTTP PUT (in order to create a new cache and populate it with my generated JSON) to ehCache using my webservice which is on the same local tomcat instance. Am new to RESTful Web Services and am using JDK 1.6, Tomcat 7, ehCache, and JSON. I have my POJOs defined like this: Person POJO: import javax.xml.bind.annotation.XmlRootElement; @XmlRootElement public class Person { private String firstName; private String lastName; private List<House> houses; // Getters & Setters } House POJO: import javax.xml.bind.annotation.XmlRootElement; @XmlRootElement public class House { private String address; private String city; private String state; // Getters & Setters } Using a PersonUtil class, I hardcoded the POJOs as follows: public class PersonUtil { public static Person getPerson() { Person person = new Person(); person.setFirstName("John"); person.setLastName("Doe"); List<House> houses = new ArrayList<House>(); House house = new House(); house.setAddress("1234 Elm Street"); house.setCity("Anytown"); house.setState("Maine"); houses.add(house); person.setHouses(houses); return person; } } Am able to create a JSON response per a GET request: @Path("") public class MyWebService{ @GET @Produces(MediaType.APPLICATION_JSON) public Person getPerson() { return PersonUtil.getPerson(); } } When deploying the war to tomcat and pointing the browser to http://localhost:8080/personservice/ Generated JSON: { "firstName" : "John", "lastName" : "Doe", "houses": [ { "address" : "1234 Elmstreet", "city" : "Anytown", "state" : "Maine" } ] } So far, so good, however, I have a different app which is running on the same tomcat instance (and has support for REST): http://localhost:8080/ehcache/rest/ While tomcat is running, I can issue a PUT like this: echo "Hello World" | curl -S -T - http://localhost:8080/ehcache/rest/hello/1 When I "GET" it like this: curl http://localhost:8080/ehcache/rest/hello/1 Will yield: Hello World What I need to do is create a POST which will put my entire Person generated JSON and create a new cache: http://localhost:8080/ehcache/rest/person And when I do a "GET" on this previous URL, it should look like this: { "firstName" : "John", "lastName" : "Doe", "houses": [ { "address" : "1234 Elmstreet", "city" : "Anytown", "state" : "Maine" } ] } So, far, this is what my PUT looks like: @PUT @Path("/ehcache/rest/person") @Produces(MediaType.APPLICATION_JSON) @Consumes(MediaType.APPLICATION_JSON) public Response createCache() { ResponseBuilder response = Response.ok(PersonUtil.getPerson(), MediaType.APPLICATION_JSON); return response.build(); } Question(s): (1) Is this the correct way to write the PUT? (2) What should I write inside the createCache() method to have it PUT my generated JSON into: http://localhost:8080/ehcache/rest/person (3) What would the command line CURL comment look like to use the PUT? Thanks for taking the time to read this...

    Read the article

  • C++: Trouble with Pointers, loop variables, and structs

    - by Rosarch
    Consider the following example: #include <iostream> #include <sstream> #include <vector> #include <wchar.h> #include <stdlib.h> using namespace std; struct odp { int f; wchar_t* pstr; }; int main() { vector<odp> vec; ostringstream ss; wchar_t base[5]; wcscpy_s(base, L"1234"); for (int i = 0; i < 4; i++) { odp foo; foo.f = i; wchar_t loopStr[1]; foo.pstr = loopStr; // wchar_t* = wchar_t ? Why does this work? foo.pstr[0] = base[i]; vec.push_back(foo); } for (vector<odp>::iterator iter = vec.begin(); iter != vec.end(); iter++) { cout << "Vec contains: " << iter->f << ", " << *(iter->pstr) << endl; } } This produces: Vec contains: 0, 52 Vec contains: 1, 52 Vec contains: 2, 52 Vec contains: 3, 52 I would hope that each time, iter->f and iter->pstr would yield a different result. Unfortunately, iter->pstr is always the same. My suspicion is that each time through the loop, a new loopStr is created. Instead of copying it into the struct, I'm only copying a pointer. The location that the pointer writes to is getting overwritten. How can I avoid this? Is it possible to solve this problem without allocating memory on the heap?

    Read the article

  • Big O Complexity of a method

    - by timeNomad
    I have this method: public static int what(String str, char start, char end) { int count=0; for(int i=0;i<str.length(); i++) { if(str.charAt(i) == start) { for(int j=i+1;j<str.length(); j++) { if(str.charAt(j) == end) count++; } } } return count; } What I need to find is: 1) What is it doing? Answer: counting the total number of end occurrences after EACH (or is it? Not specified in the assignment, point 3 depends on this) start. 2) What is its complexity? Answer: the first loops iterates over the string completely, so it's at least O(n), the second loop executes only if start char is found and even then partially (index at which start was found + 1). Although, big O is all about worst case no? So in the worst case, start is the 1st char & the inner iteration iterates over the string n-1 times, the -1 is a constant so it's n. But, the inner loop won't be executed every outer iteration pass, statistically, but since big O is about worst case, is it correct to say the complexity of it is O(n^2)? Ignoring any constants and the fact that in 99.99% of times the inner loop won't execute every outer loop pass. 3) Rewrite it so that complexity is lower. What I'm not sure of is whether start occurs at most once or more, if once at most, then method can be rewritten using one loop (having a flag indicating whether start has been encountered and from there on incrementing count at each end occurrence), yielding a complexity of O(n). In case though, that start can appear multiple times, which most likely it is, because assignment is of a Java course and I don't think they would make such ambiguity. Solving, in this case, is not possible using one loop... WAIT! Yes it is..! Just have a variable, say, inc to be incremented each time start is encountered & used to increment count each time end is encountered after the 1st start was found: inc = 0, count = 0 if (current char == start) inc++ if (inc > 0 && current char == end) count += inc This would also yield a complexity of O(n)? Because there is only 1 loop. Yes I realize I wrote a lot hehe, but what I also realized is that I understand a lot better by forming my thoughts into words...

    Read the article

  • Links to my “Best of 2010” Posts

    - by ScottGu
    I hope everyone is having a Happy New Years! 2010 has been a busy blogging year for me (this is the 100th blog post I’ve done in 2010).  Several people this week suggested I put together a summary post listing/organizing my favorite posts from the year.  Below is a quick listing of some of my favorite posts organized by topic area: VS 2010 and .NET 4 Below is a series of posts I wrote (some in late 2009) about the VS 2010 and .NET 4 (including ASP.NET 4 and WPF 4) release we shipped in April: Visual Studio 2010 and .NET 4 Released Clean Web.Config Files Starter Project Templates Multi-targeting Multiple Monitor Support New Code Focused Web Profile Option HTML / ASP.NET / JavaScript Code Snippets Auto-Start ASP.NET Applications URL Routing with ASP.NET 4 Web Forms Searching and Navigating Code in VS 2010 VS 2010 Code Intellisense Improvements WPF 4 Add Reference Dialog Improvements SEO Improvements with ASP.NET 4 Output Cache Extensibility with ASP.NET 4 Built-in Charting Controls for ASP.NET and Windows Forms Cleaner HTML Markup with ASP.NET 4 - Client IDs Optional Parameters and Named Arguments in C# 4 - and a cool scenarios with ASP.NET MVC 2 Automatic Properties, Collection Initializers and Implicit Line Continuation Support with VB 2010 New <%: %> Syntax for HTML Encoding Output using ASP.NET 4 JavaScript Intellisense Improvements with VS 2010 VS 2010 Debugger Improvements (DataTips, BreakPoints, Import/Export) Box Selection and Multi-line Editing Support with VS 2010 VS 2010 Extension Manager (and the cool new PowerCommands Extension) Pinning Projects and Solutions VS 2010 Web Deployment Debugging Tips/Tricks with Visual Studio Search and Navigation Tips/Tricks with Visual Studio Visual Studio Below are some additional Visual Studio posts I’ve done (not in the first series above) that I thought were nice: Download and Share Visual Studio Color Schemes Visual Studio 2010 Keyboard Shortcuts VS 2010 Productivity Power Tools Fun Visual Studio 2010 Wallpapers Silverlight We shipped Silverlight 4 in April, and announced Silverlight 5 the beginning of December: Silverlight 4 Released Silverlight 4 Tools for VS 2010 and WCF RIA Services Released Silverlight 4 Training Kit Silverlight PivotViewer Now Available Silverlight Questions Announcing Silverlight 5 Silverlight for Windows Phone 7 We shipped Windows Phone 7 this fall and shipped free Visual Studio development tools with great Silverlight and XNA support in September: Windows Phone 7 Developer Tools Released Building a Windows Phone 7 Twitter Application using Silverlight ASP.NET MVC We shipped ASP.NET MVC 2 in March, and started previewing ASP.NET MVC 3 this summer.  ASP.NET MVC 3 will RTM in less than 2 weeks from today: ASP.NET MVC 2: Strongly Typed Html Helpers ASP.NET MVC 2: Model Validation Introducing ASP.NET MVC 3 (Preview 1) Announcing ASP.NET MVC 3 Beta and NuGet (nee NuPack) Announcing ASP.NET MVC 3 Release Candidate 1  Announcing ASP.NET MVC 3 Release Candidate 2 Introducing Razor – A New View Engine for ASP.NET ASP.NET MVC 3: Layouts with Razor ASP.NET MVC 3: New @model keyword in Razor ASP.NET MVC 3: Server-Side Comments with Razor ASP.NET MVC 3: Razor’s @: and <text> syntax ASP.NET MVC 3: Implicit and Explicit code nuggets with Razor ASP.NET MVC 3: Layouts and Sections with Razor IIS and Web Server Stack The IIS and Web Stack teams have made a bunch of great improvements to the core web server this year: Fix Common SEO Problems using the URL Rewrite Extension Introducing the Microsoft Web Farm Framework Automating Deployment with Microsoft Web Deploy Introducing IIS Express SQL CE 4 (New Embedded Database Support with ASP.NET) Introducing Web Matrix EF Code First EF Code First is a really nice new data option that enables a very clean code-oriented data workflow: Announcing Entity Framework Code-First CTP5 Release Class-Level Model Validation with EF Code First and ASP.NET MVC 3 Code-First Development with Entity Framework 4 EF 4 Code First: Custom Database Schema Mapping Using EF Code First with an Existing Database jQuery and AJAX Contributions My team began making some significant source code contributions to the jQuery project this year: jQuery Templates, Data Link and Globalization Accepted as Official jQuery Plugins jQuery Templates and Data Linking (and Microsoft contributing to jQuery) jQuery Globalization Plugin from Microsoft Patches and Hot Fixes Some useful fixes you can download prior to VS 2010 SP1: Patch for Cut/Copy “Insufficient Memory” issue with VS 2010 Patch for VS 2010 Find and Replace Dialog Growing Patch for VS 2010 Scrolling Context Menu Videos of My Talks Some recordings of technical talks I’ve done this year: ASP.NET 4, ASP.NET MVC, and Silverlight 4 Talks I did in Europe VS 2010 and ASP.NET 4 Web Forms Talk in Arizona Other About Technical Debates (and ASP.NET Web Forms and ASP.NET MVC debates in particular) ASP.NET Security Fix Now on Windows Update Upcoming Web Camps I’d like to say a big thank you to everyone who follows my blog – I really appreciate you reading it (the comments you post help encourage me to write it).  See you in the New Year! Scott P.S. In addition to blogging, I am also now using Twitter for quick updates and to share links. Follow me at: twitter.com/scottgu

    Read the article

  • Visual Studio App.config XML Transformation

    - by João Angelo
    Visual Studio 2010 introduced a much-anticipated feature, Web configuration transformations. This feature allows to configure a web application project to transform the web.config file during deployment based on the current build configuration (Debug, Release, etc). If you haven’t already tried it there is a nice step-by-step introduction post to XML transformations on the Visual Web Developer Team Blog and for a quick reference on the supported syntax you have this MSDN entry. Unfortunately there are some bad news, this new feature is specific to web application projects since it resides in the Web Publishing Pipeline (WPP) and therefore is not officially supported in other project types like such as a Windows applications. The keyword here is officially because Vishal Joshi has a nice blog post on how to extend it’s support to app.config transformations. However, the proposed workaround requires that the build action for the app.config file be changed to Content instead of the default None. Also from the comments to the said post it also seems that the workaround will not work for a ClickOnce deployment. Working around this I tried to remove the build action change requirement and at the same time add ClickOnce support. This effort resulted in a single MSBuild project file (AppConfig.Transformation.targets) available for download from GitHub. It integrates itself in the build process so in order to add app.config transformation support to an existing Windows Application Project you just need to import this targets file after all the other import directives that already exist in the *.csproj file. Before – Without App.config transformation support ... <Import Project="$(MSBuildToolsPath)\Microsoft.CSharp.targets" /> <Target Name="BeforeBuild"> </Target> <Target Name="AfterBuild"> </Target> </Project> After – With App.config transformation support ... <Import Project="$(MSBuildToolsPath)\Microsoft.CSharp.targets" /> <Import Project="C:\MyExtensions\AppConfig.Transformation.targets" /> <Target Name="BeforeBuild"> </Target> <Target Name="AfterBuild"> </Target> </Project> As a final disclaimer, the testing time was limited so any problem that you find let me know. The MSBuild project invokes the mage tool so the Framework SDK must be installed. Update: I finally had some spare time and was able to check the problem reported by Geoff Smith and believe the problem is solved. The Publish command inside Visual Studio triggers a build workflow different than through MSBuild command line and this was causing problems. I posted a new version in GitHub that should now support ClickOnce deployment with app.config tranformation from within Visual Studio and MSBuild command line. Also here is a link for the sample application used to test the new version using the Publish command with the install location set to be from a CD-ROM or DVD-ROM and selected that the application will not check for updates. Thanks to Geoff for spotting the problem.

    Read the article

  • Automatic Properties, Collection Initializers, and Implicit Line Continuation support with VB 2010

    - by ScottGu
    [In addition to blogging, I am also now using Twitter for quick updates and to share links. Follow me at: twitter.com/scottgu] This is the eighteenth in a series of blog posts I’m doing on the upcoming VS 2010 and .NET 4 release. A few days ago I blogged about two new language features coming with C# 4.0: optional parameters and named arguments.  Today I’m going to post about a few of my favorite new features being added to VB with VS 2010: Auto-Implemented Properties, Collection Initializers, and Implicit Line Continuation support. Auto-Implemented Properties Prior to VB 2010, implementing properties within a class using VB required you to explicitly declare the property as well as implement a backing field variable to store its value.  For example, the code below demonstrates how to implement a “Person” class using VB 2008 that exposes two public properties - “Name” and “Age”:   While explicitly declaring properties like above provides maximum flexibility, I’ve always found writing this type of boiler-plate get/set code tedious when you are simply storing/retrieving the value from a field.  You can use VS code snippets to help automate the generation of it – but it still generates a lot of code that feels redundant.  C# 2008 introduced a cool new feature called automatic properties that helps cut down the code quite a bit for the common case where properties are simply backed by a field.  VB 2010 also now supports this same feature.  Using the auto-implemented properties feature of VB 2010 we can now implement our Person class using just the code below: When you declare an auto-implemented property, the VB compiler automatically creates a private field to store the property value as well as generates the associated Get/Set methods for you.  As you can see above – the code is much more concise and easier to read. The syntax supports optionally initializing the properties with default values as well if you want to: You can learn more about VB 2010’s automatic property support from this MSDN page. Collection Initializers VB 2010 also now supports using collection initializers to easily create a collection and populate it with an initial set of values.  You identify a collection initializer by declaring a collection variable and then use the From keyword followed by braces { } that contain the list of initial values to add to the collection.  Below is a code example where I am using the new collection initializer feature to populate a “Friends” list of Person objects with two people, and then bind it to a GridView control to display on a page: You can learn more about VB 2010’s collection initializer support from this MSDN page. Implicit Line Continuation Support Traditionally, when a statement in VB has been split up across multiple lines, you had to use a line-continuation underscore character (_) to indicate that the statement wasn’t complete.  For example, with VB 2008 the below LINQ query needs to append a “_” at the end of each line to indicate that the query is not complete yet: The VB 2010 compiler and code editor now adds support for what is called “implicit line continuation support” – which means that it is smarter about auto-detecting line continuation scenarios, and as a result no longer needs you to explicitly indicate that the statement continues in many, many scenarios.  This means that with VB 2010 we can now write the above code with no “_” at all: The implicit line continuation feature also works well when editing XML Literals within VB (which is pretty cool). You can learn more about VB 2010’s Implicit Line Continuation support and many of the scenarios it supports from this MSDN page (scroll down to the “Implicit Line Continuation” section to find details). Summary The above three VB language features are but a few of the new language and code editor features coming with VB 2010.  Visit this site to learn more about some of the other VB language features coming with the release.  Also subscribe to the VB team’s blog to learn more and stay up-to-date with the posts they the team regularly publishes. Hope this helps, Scott

    Read the article

  • List of blogs - year 2010

    - by hajan
    This is the last day of year 2010 and I would like to add links to all blogs I have posted in this year. First, I would like to mention that I started blogging in ASP.NET Community in May / June 2010 and have really enjoyed writing for my favorite technologies, such as: ASP.NET, jQuery/JavaScript, C#, LINQ, Web Services etc. I also had great feedback either through comments on my blogs or in Twitter, Facebook, LinkedIn where I met many new experts just as a result of my blog posts. Thanks to the interesting topics I have in my blog, I became DZone MVB. Here is the list of blogs I made in 2010 in my ASP.NET Community Weblog: (newest to oldest) Great library of ASP.NET videos – Pluralsight! NDepend – Code Query Language (CQL) NDepend tool – Why every developer working with Visual Studio.NET must try it! jQuery Templates in ASP.NET - Blogs Series jQuery Templates - XHTML Validation jQuery Templates with ASP.NET MVC jQuery Templates - {Supported Tags} jQuery Templates – tmpl(), template() and tmplItem() Introduction to jQuery Templates ViewBag dynamic in ASP.NET MVC 3 - RC 2 Today I had a presentation on "Deep Dive into jQuery Templates in ASP.NET" jQuery Data Linking in ASP.NET How do you prefer getting bundles of technologies?? Case-insensitive XPath query search on XML Document in ASP.NET jQuery UI Accordion in ASP.NET MVC - feed with data from database (Part 3) jQuery UI Accordion in ASP.NET WebForms - feed with data from database (Part 2) jQuery UI Accordion in ASP.NET – Client side implementation (Part 1) Using Images embedded in Project’s Assembly Macedonian Code Camp 2010 event has finished successfully Tips and Tricks: Deferred execution using LINQ Using System.Diagnostics.Stopwatch class to measure the elapsed time Speaking at Macedonian Code Camp 2010 URL Routing in ASP.NET 4.0 Web Forms Conflicts between ASP.NET AJAX UpdatePanels & jQuery functions Integration of jQuery DatePicker in ASP.NET Website – Localization (part 3) Why not to use HttpResponse.Close and HttpResponse.End Calculate Business Days using LINQ Get Distinct values of an Array using LINQ Using CodeRun browser-based IDE to create ASP.NET Web Applications Using params keyword – Methods with variable number of parameters Working with Code Snippets in VS.NET  Working with System.IO.Path static class Calculating GridView total using JavaScript/JQuery The new SortedSet<T> Collection in .NET 4.0 JavaScriptSerializer – Dictionary to JSON Serialization and Deserialization Integration of jQuery DatePicker in ASP.NET Website – JS Validation Script (part 2) Integration of jQuery DatePicker in ASP.NET Website (part 1) Transferring large data when using Web Services Forums dedicated to WebMatrix Microsoft WebMatrix – Short overview & installation Working with embedded resources in Project's assembly Debugging ASP.NET Web Services Save and Display YouTube Videos on ASP.NET Website Hello ASP.NET World... In addition, I would like to mention that I have big list of blog posts in CodeASP.NET Community (total 60 blogs) and the local MKDOT.NET Community (total 61 blogs). You may find most of my weblogs.asp.net/hajan blogs posted there too, but there you can find many others. In my blog on MKDOT.NET Community you can find most of my ASP.NET Weblog posts translated in Macedonian language, some of them posted in English and some other blogs that were posted only there. By reading my blogs, I hope you have learnt something new or at least have confirmed your knowledge. And also, if you haven't, I encourage you to start blogging and share your Microsoft Tech. thoughts with all of us... Sharing and spreading knowledge is definitely one of the noblest things which we can do in our life. "Give a man a fish and he will eat for a day. Teach a man to fish and he will eat for a lifetime" HAPPY NEW 2011 YEAR!!! Best Regards, Hajan

    Read the article

  • JavaScript: this

    - by bdukes
    JavaScript is a language steeped in juxtaposition.  It was made to “look like Java,” yet is dynamic and classless.  From this origin, we get the new operator and the this keyword.  You are probably used to this referring to the current instance of a class, so what could it mean in a language without classes? In JavaScript, this refers to the object off of which a function is referenced when it is invoked (unless it is invoked via call or apply). What this means is that this is not bound to your function, and can change depending on how your function is invoked. It also means that this changes when declaring a function inside another function (i.e. each function has its own this), such as when writing a callback. Let's see some of this in action: var obj = { count: 0, increment: function () { this.count += 1; }, logAfterTimeout = function () { setTimeout(function () { console.log(this.count); }, 1); } }; obj.increment(); console.log(obj.count); // 1 var increment = obj.increment; window.count = 'global count value: '; increment(); console.log(obj.count); // 1 console.log(window.count); // global count value: 1 var newObj = {count:50}; increment.call(newObj); console.log(newObj.count); // 51 obj.logAfterTimeout();// global count value: 1 obj.logAfterTimeout = function () { var proxiedFunction = $.proxy(function () { console.log(this.count); }, this); setTimeout(proxiedFunction, 1); }; obj.logAfterTimeout(); // 1 obj.logAfterTimeout = function () { var that = this; setTimeout(function () { console.log(that.count); }, 1); }; obj.logAfterTimeout(); // 1 The last couple of examples here demonstrate some methods for making sure you get the values you expect.  The first time logAfterTimeout is redefined, we use jQuery.proxy to create a new function which has its this permanently set to the passed in value (in this case, the current this).  The second time logAfterTimeout is redefined, we save the value of this in a variable (named that in this case, also often named self) and use the new variable in place of this. Now, all of this is to clarify what’s going on when you use this.  However, it’s pretty easy to avoid using this altogether in your code (especially in the way I’ve demonstrated above).  Instead of using this.count all over the place, it would have been much easier if I’d made count a variable instead of a property, and then I wouldn’t have to use this to refer to it.  var obj = (function () { var count = 0; return { increment: function () { count += 1; }, logAfterTimeout = function () { setTimeout(function () { console.log(count); }, 1); }, getCount: function () { return count; } }; }()); If you’re writing your code in this way, the main place you’ll run into issues with this is when handling DOM events (where this is the element on which the event occurred).  In that case, just be careful when using a callback within that event handler, that you’re not expecting this to still refer to the element (and use proxy or that/self if you need to refer to it). Finally, as demonstrated in the example, you can use call or apply on a function to set its this value.  This isn’t often needed, but you may also want to know that you can use apply to pass in an array of arguments to a function (e.g. console.log.apply(console, [1, 2, 3, 4])).

    Read the article

  • Social Media Talk: Facebook, Really?? How Has It Become This Popular??

    - by david.talamelli
    If you have read some of my previous posts over the past few years either here or on my personal blog David's Journal on Tap you will know I am a Social Media enthusiast. I use various social media sites everday in both my work and personal life. I was surprised to read today on Mashable.com that Facebook now Commands 41% of Social Media Trafic. When I think of the Social Media sites I use most, the sites that jump into my mind first are LinkedIn, Blogging and Twitter. I do use Facebook in both work and in my personal life but on the list of sites I use it probably ranks closer to the bottom of the list rather than the top. I know Facebook is engrained in everything these days - but really I am not a huge Facebook fan - and I am finding that over the past 3-6 months my interest in Facebook is going down rather than up. From a work perspective - SM sites let me connect with candidates and communities and they help me talk about the things that I am doing here at Oracle. From a personal perspective SM sites let me keep in touch with friends and family both here and overseas in a really simple and easy way. Sites like LinkedIn give me a great way to proactively talk to both active and passive candidates. Twitter is fantastic to keep in touch with industry trends and keep up to date on the latest trending topics as well as follow conversations about whatever keyword you want to follow. Blogging lets me share my thoughts and ideas with others and while FB does have some great benefits I don't think the benefits outweigh the negatives of using FB. I use TweetDeck to keep track of my twitter feeds, the latest LinkedIn updates and Facebook updates. Tweetdeck is a great tool as it consolidates these 3 SM sites for me and I can quickly scan to see the latest news on any of them. From what I have seen from Facebook it looks like 70%-80% of people are using FB to grow their farm on farmville, start a mafia war on mafiawars or read their horoscope, check their love percentage, etc...... In between all these "updates" every now and again you do see a real update from someone who actually has something to say but there is so much "white noise" on FB from all the games and apps that is hard to see the real messages from all the 'games' information. I don't like having to scroll through what seems likes pages of farmville updates only to get one real piece of information. For me this is where FB's value really drops off. While I use SM everyday I try to use SM effectively. Sifting through so much noise is not effective and really I am not all that interested in Farmville, MafiaWars or any similar game/app. But what about Groups and Facebook Ads?? Groups are ok, but I am not sure I would call them SM game changers - yes there is a group for everything out there, but a group whether it is on FB or not is only as good as the community that supports and participates in it. Many of the Groups on FB (and elsewhere) are set up and never used or promoted by the moderator. I have heard that FB ads do have an impact, and I have not really looked at them - the question of cost jumps and return on investment comes to my mind though. FB does have some benefits, it is a great way to keep in touch with people and a great way to talk to others. I think it would have been interesting to see a different statistic measuring how effective that 41% of Social Media Traffic via FB really is or is it just a case of more people jumping online to play games. To me FB does not equal SM effectiveness, at the moment it is a tool that I sometimes need to use as opposed to want to use. This article was originally posted on David Talamelli's Blog - David's Journal on Tap

    Read the article

  • EVENT RECAP: Oracle Day & Product Fair - Ft. Lauderdale

    - by cwarticki
    Are you attending any of the Oracle Days and other Events? They are fantastic!  Keep track of the Oracle Events by following @OracleEvents on Twitter.  Also, stay in the know by subscribing to one of the several Oracle Newsletters. Those will also keep you posted of upcoming in-person and webcast events. From the Oracle Events website, simply navigate to your geography and refine your options to locate what interests you. You can also perform keyword searches. Today, I had the opportunity to participate in the Oracle Day & Product Fair in Ft. Lauderdale, Florida  Thanks to those who stopped by to ask your support questions and watched me demo My Oracle Support features and best practices. (Bob Stanoch, Sales Consulting Manager giving the 2nd keynote address on Exadata below) Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4 /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0in 5.4pt 0in 5.4pt; mso-para-margin-top:0in; mso-para-margin-right:0in; mso-para-margin-bottom:10.0pt; mso-para-margin-left:0in; line-height:115%; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:minor-fareast; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:minor-bidi;} It was a pleasant surprise to run into my former Oracle colleague Josh Tieso.  Josh (pictured right) is Sr. Oracle DBA at United Healthcare. He used to work for Oracle Support years ago but for the last 6 years at UHC. Josh is a member of the ERP DBA team, working with Exalogic, Oracle ERP R12, & RAC. Along the exhibit/vendor row, I met with Marco Gangano, National Sales Manager at Mythics. It was great getting to meet Marco and I look forward to working with his company with regards to Support Best Practices. In addition, Lissette Paez (left) was representing TAM Training.  TAM Training is an Oracle University, award-winning training partner.  They cover training across the scope of Oracle products with 7 facilities in the U.S.  Lissette and I have done a couple of these Oracle Days before.  It's great to see familiar faces.  A little while ago, I was down in this area to work with Citrix with an onsite session on Support Best Practices.  Pablo Leon and Alberto Gonzalez (right)came to chat with me over at the Support booth.  They wanted to know when I was giving my session.  Unfortunately, not this time guys. I'm on booth duty only. Keep in touch. Many thanks to our sponsors: BIAS, Cloudera, Intel and TekStream Solutions.Come attend one of the many Oracle Days & other events planned for you. -Chris WartickiGlobal Customer Management

    Read the article

< Previous Page | 90 91 92 93 94 95 96 97 98 99 100 101  | Next Page >