Search Results

Search found 49677 results on 1988 pages for 'location based service'.

Page 96/1988 | < Previous Page | 92 93 94 95 96 97 98 99 100 101 102 103  | Next Page >

  • Security Updates Available for SQL Server 2008, 2008 R2, 2012, 2014

    - by AaronBertrand
    If you are running 2008 SP3, 2008 R2 SP2, 2012 SP1 (SP2 is not affected, RTM is no longer supported), or 2014, you'll want to check out Security Bulletin MS14-044 for details on a denial of service / privilege escalation issue that has been patched: http://technet.microsoft.com/en-us/library/security/MS14-044 For SQL Server 2012 and SQL Server 2014, I've blogged about recent builds and recommendations here: http://blogs.sqlsentry.com/team-posts/latest-builds-sql-server-2012/ http://blogs.sqlsentry.com/team-posts/latest-builds-sql-server-2014...(read more)

    Read the article

  • Cumulative Update packages for SQL Server 2008 are available now: CU7 for SQL2008 SP2 and CU2 for SQL2008 SP3

    - by ssqa.net
    Another instalment of Cumulative Update package for SQL Server 2008 SP3 is available now, which is CU2 and the build number is known as 10.00.5768.00. As usual this CU2 for SQL2008 SP3 contains hotfixes for issues that were fixed after the release of SQL Server 2008 Service Pack 3 (SP3). KBA2633143 list the following article numbers about more information on the fixes: VSTS bug number KB article number Description 794387 2522893 (http://support.microsoft.com/kb/2522893/ ) FIX: A backup operation...(read more)

    Read the article

  • Different location of assemblies stoped the type casting.

    - by smwikipedia
    I am writing a custom Control class in C# for my main project. There're 2 projects, one for my Control and one for my main project. These 2 projects are in the same solution. I add a reference from my main project to my Control project. I notice that the first time after I drag my Control from the Tool Panel onto my main winform, an assembly folder was generated at the C:\Users\XXX\AppData\Local\Microsoft\VisualStudio\9.0\ProjectAssemblies, and the folder name is something like "jlebh-py01". The first build is always OK, but after I rebuild my Control class or whole solution, a new assembly folder will be generated at C:\Users\XXX\AppData\Local\Microsoft\VisualStudio\9.0\ProjectAssemblies, and then problem arises, my Control fails to behave well because Visual Studio says that the two types "originates from different location". The error message is as below: [A]MyControl.TypeXXX cannot be cast to [B]MyControl.TypeXXX. Type A orginates from assemblyXXX at location 'C:\Users\XXX\AppData\Local\Microsoft\VisualStudio\9.0\ProjectAssemblies\jlebh-py01\MyControl.dll' Type B originats from assemblyXXX at location 'C:\Users\XXX\AppData\Local\Microsoft\VisualStudio\9.0\ProjectAssemblies\ue4i-z3j01\MyControl.dll' If I reference the Control DLL directly instead of through project reference, or never rebuild the Control project after use my Control in the main project, things seem to be OK. Does anyone knows why? Is it the proper way to develop a control and a main project within the same solution? Many thanks...

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • longitude and latitude for current location returned from CLLocationManager in UK region is not corr

    - by bond
    Hi I am getting latitude and longitude of current location from CLLocationManager delegate method. It works fine for some region but its giving problem in UK region. When it is used in UK region, the current location longitude and latitude returned from CLLocationManager is not proper. Thanks heres a part of the logic i am using. -(void)viewWillAppear:(BOOL)animated { [super viewWillAppear:animated]; self.locationManager = [[CLLocationManager alloc] init]; if(self.locationManager.locationServicesEnabled) { self.locationManager.delegate = self; self.locationManager.distanceFilter = kCLDistanceFilterNone; self.locationManager.desiredAccuracy = kCLLocationAccuracyBest; } } -(void)locationManager:(CLLocationManager *)manager didUpdateToLocation:(CLLocation *)newLocation fromLocation:(CLLocation *)oldLocation { NSLog(@"Updating"); //if the time interval returned from core location is more than 15 seconds //we ignore it because it might be from an old session if ( abs([newLocation.timestamp timeIntervalSinceDate: [NSDate date]]) < 15) { self.latitude = newLocation.coordinate.latitude; self.longitude = newLocation.coordinate.longitude; NSLog(@"longitude=%f-- latitude=%f--",self.longitude,self.latitude); [self.locationManager stopUpdatingLocation]; [self removeActivityIndicator]; [[self locationSaved] setHidden:NO]; [[self viewLocationInMap] setEnabled:YES]; }}

    Read the article

  • when updating location.hash in Chrome the jQuery animation "freezes" for a second

    - by ubunut
    I'm trying to create a sort of "virtual gallery". I'm using Coda Slider 2.0 & jQuery v1.4.2 It behaves perfectly in IE, FF & Safari, but Chrome seems to reload/hang for a second when setting location.hash. This causes the jQuery animation to freeze for a second :S Example: http://hardyernst.dk/gallery.html try clicking on the navigation links above the pictures. The jQuery code that is being executed when clicking a navigation link: $('#coda-nav-' + sliderCount + ' a').each(function(z) { // What happens when a nav link is clicked $(this).bind("click", function() { offset = -(panelWidth*z); navClicks++; $(this).addClass('current').parents('ul').find('a').not($(this)).removeClass('current'); alterPanelHeight(z); currentPanel = z + 1; $('.panel-container', slider).stop().animate({ left: offset }, settings.slideEaseDuration, settings.slideEaseFunction, function(){ if (!settings.crossLinking) { return false; } // Don't change the URL hash unless cross-linking is specified }); }); }); if I add return false; at the end of the function. The animation will slide smoothly :)... BUT as you might have guessed the location.hash value remains unchanged :( I have tried setting the location.hash earlier in the function alas it did not change the behavior in Chrome Would be immensely grateful for any help :) Regards Ubunut

    Read the article

  • Where to prompt for required file location at start of Win Forms application

    - by Murph
    I have an application that uses a file to store its data. I store the location of the file in the app settings so have two tests at startup: Do I have a setting for the file and Does the file (if I have a setting) exist If I fail either test I want to prompt the user for the file location - the mechanics of the are not the problem, I can read and write the app settings, fire off dialogs and otherwise request the data. If the user refuses to choose a file (or at least a file location) I want to exit the app. My problem is where to do this i.e. at what point in the flow of code. In an ideal world you start the app, show a splash screen, load the main form and run from there... I'm looking for a general pattern that allows me to slot the test for parameters into the right place so that I can prompt the user for whatever (and allowing that I have to worry about the fact that my splash screen is currently topmost for my app). I appreciate that this is a bit vague so will update this with code as we go along.

    Read the article

  • Maintaining shared service in ASP.NET MVC Application

    - by kazimanzurrashid
    Depending on the application sometimes we have to maintain some shared service throughout our application. Let’s say you are developing a multi-blog supported blog engine where both the controller and view must know the currently visiting blog, it’s setting , user information and url generation service. In this post, I will show you how you can handle this kind of case in most convenient way. First, let see the most basic way, we can create our PostController in the following way: public class PostController : Controller { public PostController(dependencies...) { } public ActionResult Index(string blogName, int? page) { BlogInfo blog = blogSerivce.FindByName(blogName); if (blog == null) { return new NotFoundResult(); } IEnumerable<PostInfo> posts = postService.FindPublished(blog.Id, PagingCalculator.StartIndex(page, blog.PostPerPage), blog.PostPerPage); int count = postService.GetPublishedCount(blog.Id); UserInfo user = null; if (HttpContext.User.Identity.IsAuthenticated) { user = userService.FindByName(HttpContext.User.Identity.Name); } return View(new IndexViewModel(urlResolver, user, blog, posts, count, page)); } public ActionResult Archive(string blogName, int? page, ArchiveDate archiveDate) { BlogInfo blog = blogSerivce.FindByName(blogName); if (blog == null) { return new NotFoundResult(); } IEnumerable<PostInfo> posts = postService.FindArchived(blog.Id, archiveDate, PagingCalculator.StartIndex(page, blog.PostPerPage), blog.PostPerPage); int count = postService.GetArchivedCount(blog.Id, archiveDate); UserInfo user = null; if (HttpContext.User.Identity.IsAuthenticated) { user = userService.FindByName(HttpContext.User.Identity.Name); } return View(new ArchiveViewModel(urlResolver, user, blog, posts, count, page, achiveDate)); } public ActionResult Tag(string blogName, string tagSlug, int? page) { BlogInfo blog = blogSerivce.FindByName(blogName); if (blog == null) { return new NotFoundResult(); } TagInfo tag = tagService.FindBySlug(blog.Id, tagSlug); if (tag == null) { return new NotFoundResult(); } IEnumerable<PostInfo> posts = postService.FindPublishedByTag(blog.Id, tag.Id, PagingCalculator.StartIndex(page, blog.PostPerPage), blog.PostPerPage); int count = postService.GetPublishedCountByTag(tag.Id); UserInfo user = null; if (HttpContext.User.Identity.IsAuthenticated) { user = userService.FindByName(HttpContext.User.Identity.Name); } return View(new TagViewModel(urlResolver, user, blog, posts, count, page, tag)); } } As you can see the above code heavily depends upon the current blog and the blog retrieval code is duplicated in all of the action methods, once the blog is retrieved the same blog is passed in the view model. Other than the blog the view also needs the current user and url resolver to render it properly. One way to remove the duplicate blog retrieval code is to create a custom model binder which converts the blog from a blog name and use the blog a parameter in the action methods instead of the string blog name, but it only helps the first half in the above scenario, the action methods still have to pass the blog, user and url resolver etc in the view model. Now lets try to improve the the above code, first lets create a new class which would contain the shared services, lets name it as BlogContext: public class BlogContext { public BlogInfo Blog { get; set; } public UserInfo User { get; set; } public IUrlResolver UrlResolver { get; set; } } Next, we will create an interface, IContextAwareService: public interface IContextAwareService { BlogContext Context { get; set; } } The idea is, whoever needs these shared services needs to implement this interface, in our case both the controller and the view model, now we will create an action filter which will be responsible for populating the context: public class PopulateBlogContextAttribute : FilterAttribute, IActionFilter { private static string blogNameRouteParameter = "blogName"; private readonly IBlogService blogService; private readonly IUserService userService; private readonly BlogContext context; public PopulateBlogContextAttribute(IBlogService blogService, IUserService userService, IUrlResolver urlResolver) { Invariant.IsNotNull(blogService, "blogService"); Invariant.IsNotNull(userService, "userService"); Invariant.IsNotNull(urlResolver, "urlResolver"); this.blogService = blogService; this.userService = userService; context = new BlogContext { UrlResolver = urlResolver }; } public static string BlogNameRouteParameter { [DebuggerStepThrough] get { return blogNameRouteParameter; } [DebuggerStepThrough] set { blogNameRouteParameter = value; } } public void OnActionExecuting(ActionExecutingContext filterContext) { string blogName = (string) filterContext.Controller.ValueProvider.GetValue(BlogNameRouteParameter).ConvertTo(typeof(string), Culture.Current); if (!string.IsNullOrWhiteSpace(blogName)) { context.Blog = blogService.FindByName(blogName); } if (context.Blog == null) { filterContext.Result = new NotFoundResult(); return; } if (filterContext.HttpContext.User.Identity.IsAuthenticated) { context.User = userService.FindByName(filterContext.HttpContext.User.Identity.Name); } IContextAwareService controller = filterContext.Controller as IContextAwareService; if (controller != null) { controller.Context = context; } } public void OnActionExecuted(ActionExecutedContext filterContext) { Invariant.IsNotNull(filterContext, "filterContext"); if ((filterContext.Exception == null) || filterContext.ExceptionHandled) { IContextAwareService model = filterContext.Controller.ViewData.Model as IContextAwareService; if (model != null) { model.Context = context; } } } } As you can see we are populating the context in the OnActionExecuting, which executes just before the controllers action methods executes, so by the time our action methods executes the context is already populated, next we are are assigning the same context in the view model in OnActionExecuted method which executes just after we set the  model and return the view in our action methods. Now, lets change the view models so that it implements this interface: public class IndexViewModel : IContextAwareService { // More Codes } public class ArchiveViewModel : IContextAwareService { // More Codes } public class TagViewModel : IContextAwareService { // More Codes } and the controller: public class PostController : Controller, IContextAwareService { public PostController(dependencies...) { } public BlogContext Context { get; set; } public ActionResult Index(int? page) { IEnumerable<PostInfo> posts = postService.FindPublished(Context.Blog.Id, PagingCalculator.StartIndex(page, Context.Blog.PostPerPage), Context.Blog.PostPerPage); int count = postService.GetPublishedCount(Context.Blog.Id); return View(new IndexViewModel(posts, count, page)); } public ActionResult Archive(int? page, ArchiveDate archiveDate) { IEnumerable<PostInfo> posts = postService.FindArchived(Context.Blog.Id, archiveDate, PagingCalculator.StartIndex(page, Context.Blog.PostPerPage), Context.Blog.PostPerPage); int count = postService.GetArchivedCount(Context.Blog.Id, archiveDate); return View(new ArchiveViewModel(posts, count, page, achiveDate)); } public ActionResult Tag(string blogName, string tagSlug, int? page) { TagInfo tag = tagService.FindBySlug(Context.Blog.Id, tagSlug); if (tag == null) { return new NotFoundResult(); } IEnumerable<PostInfo> posts = postService.FindPublishedByTag(Context.Blog.Id, tag.Id, PagingCalculator.StartIndex(page, Context.Blog.PostPerPage), Context.Blog.PostPerPage); int count = postService.GetPublishedCountByTag(tag.Id); return View(new TagViewModel(posts, count, page, tag)); } } Now, the last thing where we have to glue everything, I will be using the AspNetMvcExtensibility to register the action filter (as there is no better way to inject the dependencies in action filters). public class RegisterFilters : RegisterFiltersBase { private static readonly Type controllerType = typeof(Controller); private static readonly Type contextAwareType = typeof(IContextAwareService); protected override void Register(IFilterRegistry registry) { TypeCatalog controllers = new TypeCatalogBuilder() .Add(GetType().Assembly) .Include(type => controllerType.IsAssignableFrom(type) && contextAwareType.IsAssignableFrom(type)); registry.Register<PopulateBlogContextAttribute>(controllers); } } Thoughts and Comments?

    Read the article

  • Installing a DHCP Service On Win2k8 ( Windows Server 2008 )

    - by Akshay Deep Lamba
    Introduction Dynamic Host Configuration Protocol (DHCP) is a core infrastructure service on any network that provides IP addressing and DNS server information to PC clients and any other device. DHCP is used so that you do not have to statically assign IP addresses to every device on your network and manage the issues that static IP addressing can create. More and more, DHCP is being expanded to fit into new network services like the Windows Health Service and Network Access Protection (NAP). However, before you can use it for more advanced services, you need to first install it and configure the basics. Let’s learn how to do that. Installing Windows Server 2008 DHCP Server Installing Windows Server 2008 DCHP Server is easy. DHCP Server is now a “role” of Windows Server 2008 – not a windows component as it was in the past. To do this, you will need a Windows Server 2008 system already installed and configured with a static IP address. You will need to know your network’s IP address range, the range of IP addresses you will want to hand out to your PC clients, your DNS server IP addresses, and your default gateway. Additionally, you will want to have a plan for all subnets involved, what scopes you will want to define, and what exclusions you will want to create. To start the DHCP installation process, you can click Add Roles from the Initial Configuration Tasks window or from Server Manager à Roles à Add Roles. Figure 1: Adding a new Role in Windows Server 2008 When the Add Roles Wizard comes up, you can click Next on that screen. Next, select that you want to add the DHCP Server Role, and click Next. Figure 2: Selecting the DHCP Server Role If you do not have a static IP address assigned on your server, you will get a warning that you should not install DHCP with a dynamic IP address. At this point, you will begin being prompted for IP network information, scope information, and DNS information. If you only want to install DHCP server with no configured scopes or settings, you can just click Next through these questions and proceed with the installation. On the other hand, you can optionally configure your DHCP Server during this part of the installation. In my case, I chose to take this opportunity to configure some basic IP settings and configure my first DHCP Scope. I was shown my network connection binding and asked to verify it, like this: Figure 3: Network connection binding What the wizard is asking is, “what interface do you want to provide DHCP services on?” I took the default and clicked Next. Next, I entered my Parent Domain, Primary DNS Server, and Alternate DNS Server (as you see below) and clicked Next. Figure 4: Entering domain and DNS information I opted NOT to use WINS on my network and I clicked Next. Then, I was promoted to configure a DHCP scope for the new DHCP Server. I have opted to configure an IP address range of 192.168.1.50-100 to cover the 25+ PC Clients on my local network. To do this, I clicked Add to add a new scope. As you see below, I named the Scope WBC-Local, configured the starting and ending IP addresses of 192.168.1.50-192.168.1.100, subnet mask of 255.255.255.0, default gateway of 192.168.1.1, type of subnet (wired), and activated the scope. Figure 5: Adding a new DHCP Scope Back in the Add Scope screen, I clicked Next to add the new scope (once the DHCP Server is installed). I chose to Disable DHCPv6 stateless mode for this server and clicked Next. Then, I confirmed my DHCP Installation Selections (on the screen below) and clicked Install. Figure 6: Confirm Installation Selections After only a few seconds, the DHCP Server was installed and I saw the window, below: Figure 7: Windows Server 2008 DHCP Server Installation succeeded I clicked Close to close the installer window, then moved on to how to manage my new DHCP Server. How to Manage your new Windows Server 2008 DHCP Server Like the installation, managing Windows Server 2008 DHCP Server is also easy. Back in my Windows Server 2008 Server Manager, under Roles, I clicked on the new DHCP Server entry. Figure 8: DHCP Server management in Server Manager While I cannot manage the DHCP Server scopes and clients from here, what I can do is to manage what events, services, and resources are related to the DHCP Server installation. Thus, this is a good place to go to check the status of the DHCP Server and what events have happened around it. However, to really configure the DHCP Server and see what clients have obtained IP addresses, I need to go to the DHCP Server MMC. To do this, I went to Start à Administrative Tools à DHCP Server, like this: Figure 9: Starting the DHCP Server MMC When expanded out, the MMC offers a lot of features. Here is what it looks like: Figure 10: The Windows Server 2008 DHCP Server MMC The DHCP Server MMC offers IPv4 & IPv6 DHCP Server info including all scopes, pools, leases, reservations, scope options, and server options. If I go into the address pool and the scope options, I can see that the configuration we made when we installed the DHCP Server did, indeed, work. The scope IP address range is there, and so are the DNS Server & default gateway. Figure 11: DHCP Server Address Pool Figure 12: DHCP Server Scope Options So how do we know that this really works if we do not test it? The answer is that we do not. Now, let’s test to make sure it works. How do we test our Windows Server 2008 DHCP Server? To test this, I have a Windows Vista PC Client on the same network segment as the Windows Server 2008 DHCP server. To be safe, I have no other devices on this network segment. I did an IPCONFIG /RELEASE then an IPCONFIG /RENEW and verified that I received an IP address from the new DHCP server, as you can see below: Figure 13: Vista client received IP address from new DHCP Server Also, I went to my Windows 2008 Server and verified that the new Vista client was listed as a client on the DHCP server. This did indeed check out, as you can see below: Figure 14: Win 2008 DHCP Server has the Vista client listed under Address Leases With that, I knew that I had a working configuration and we are done!

    Read the article

  • Ajax call to wcf windows service over ssl (https)

    - by bpatrick100
    I have a windows service which exposes an endpoint over http. Again this is a windows service (not a web service hosted in iis). I then call methods from this endpoint, using javascript/ajax. Everything works perfectly, and this the code I'm using in my windows service to create the endpoint: //Create host object WebServiceHost webServiceHost = new WebServiceHost(svcHost.obj, new Uri("http://192.168.0.100:1213")); //Add Https Endpoint WebHttpBinding binding = new WebHttpBinding(); webServiceHost.AddServiceEndpoint(svcHost.serviceContract, binding, string.Empty); //Add MEX Behaivor and EndPoint ServiceMetadataBehavior metadataBehavior = new ServiceMetadataBehavior(); metadataBehavior.HttpGetEnabled = true; webServiceHost.Description.Behaviors.Add(metadataBehavior); webServiceHost.AddServiceEndpoint(ServiceMetadataBehavior.MexContractName, MetadataExchangeBindings.CreateMexHttpBinding(), "mex"); webServiceHost.Open(); Now, my goal is to get this same model working over SSL (https not http). So, I have followed the guidance of several msdn pages, like the following: http://msdn.microsoft.com/en-us/library/ms733791(VS.100).aspx I have used makecert.exe to create a test cert called "bpCertTest". I have then used netsh.exe to configure my port (1213) with the test cert I created, all with no problem. Then, I've modified the endpoint code in my windows service to be able to work over https as follows: //Create host object WebServiceHost webServiceHost = new WebServiceHost(svcHost.obj, new Uri("https://192.168.0.100:1213")); //Add Https Endpoint WebHttpBinding binding = new WebHttpBinding(); binding.Security.Mode = WebHttpSecurityMode.Transport; binding.Security.Transport.ClientCredentialType = HttpClientCredentialType.Certificate; webServiceHost.AddServiceEndpoint(svcHost.serviceContract, binding, string.Empty); webServiceHost.Credentials.ServiceCertificate.SetCertificate("CN=bpCertTest", StoreLocation.LocalMachine, StoreName.My); //Add MEX Behaivor and EndPoint ServiceMetadataBehavior metadataBehavior = new ServiceMetadataBehavior(); metadataBehavior.HttpsGetEnabled = true; webServiceHost.Description.Behaviors.Add(metadataBehavior); webServiceHost.AddServiceEndpoint(ServiceMetadataBehavior.MexContractName, MetadataExchangeBindings.CreateMexHttpsBinding(), "mex"); webServiceHost.Open(); The service creates the endpoint successfully, recognizes my cert in the SetCertificate() call, and the service starts up and running with success. Now, the problem is my javascript/ajax call cannot communicate with the service over https. I simply get some generic commication error (12031). So, as a test, I changed the port I was calling in the javascript to some other random port, and I get the same error - which tells me that I'm obviously not even reaching my service over https. I'm at a complete loss at this point, I feel like everything is in place, and I just can't see what the problem is. If anyone has experience in this scenario, please provide your insight and/or solution! Thanks!

    Read the article

  • When adding WCF service reference, configuration details are not added to web.config

    - by Mikey Cee
    Hi, I am trying to add a WCF service reference to my web application using VS2010. It seems to add OK, but the web.config is not updated, meaning I get a runtime exception: Could not find default endpoint element that references contract 'CoolService.CoolService' in the ServiceModel client configuration section. This might be because no configuration file was found for your application, or because no endpoint element matching this contract could be found in the client element. Obviously, because the service is not defined in my web.config. Steps to reproduce: Right click solution Add New Project ASP.NET Empty Web Application. Right click Service References in the new web app Add Service Reference. Enter address of my service and click Go. My service is visible in the left-hand Services section, and I can see all its operations. Type a namespace for my service. Click OK. The service reference is generated correctly, and I can open the Reference.cs file, and it all looks OK. Open the web.config file. It is still empty! <system.web> <compilation debug="true" targetFramework="4.0" /> </system.web> <system.serviceModel> <bindings /> <client /> </system.serviceModel> Why is this happening? It also happens with a console application, or any other project type I try. Any help? Here is the app.config from my WCF service: <?xml version="1.0"?> <configuration> <system.web> <compilation debug="true" /> </system.web> <!-- When deploying the service library project, the content of the config file must be added to the host's app.config file. System.Configuration does not support config files for libraries. --> <system.serviceModel> <services> <service name="CoolSQL.Server.WCF.CoolService"> <endpoint address="" binding="webHttpBinding" contract="CoolSQL.Server.WCF.CoolService" behaviorConfiguration="SilverlightFaultBehavior"> <identity> <dns value="localhost" /> </identity> </endpoint> <endpoint address="mex" binding="mexHttpBinding" contract="IMetadataExchange" /> <host> <baseAddresses> <add baseAddress="http://localhost:8732/Design_Time_Addresses/CoolSQL.Server.WCF/CoolService/" /> </baseAddresses> </host> </service> </services> <behaviors> <endpointBehaviors> <behavior name="webBehavior"> <webHttp /> </behavior> <behavior name="SilverlightFaultBehavior"> <silverlightFaults /> </behavior> </endpointBehaviors> <serviceBehaviors> <behavior name=""> <serviceMetadata httpGetEnabled="true" /> <serviceDebug includeExceptionDetailInFaults="true" /> </behavior> </serviceBehaviors> </behaviors> <bindings> <webHttpBinding> <binding name="DefaultBinding" bypassProxyOnLocal="true" useDefaultWebProxy="false" hostNameComparisonMode="WeakWildcard" sendTimeout="00:05:00" openTimeout="00:05:00" receiveTimeout="00:00:10" maxReceivedMessageSize="2147483647" transferMode="Streamed"> <readerQuotas maxArrayLength="2147483647" maxStringContentLength="2147483647" /> </binding> </webHttpBinding> </bindings> <extensions> <behaviorExtensions> <add name="silverlightFaults" type="CoolSQL.Server.WCF.SilverlightFaultBehavior, CoolSQL.Server.WCF" /> </behaviorExtensions> </extensions> <diagnostics> <messageLogging logEntireMessage="true" logMalformedMessages="false" logMessagesAtServiceLevel="true" logMessagesAtTransportLevel="false" maxMessagesToLog="3000" maxSizeOfMessageToLog="2000" /> </diagnostics> </system.serviceModel> <startup> <supportedRuntime version="v4.0" sku=".NETFramework,Version=v4.0" /> </startup> <system.diagnostics> <sources> <source name="System.ServiceModel.MessageLogging" switchValue="Information, ActivityTracing"> <listeners> <add name="messages" type="System.Diagnostics.XmlWriterTraceListener" initializeData="c:\messages.e2e" /> </listeners> </source> </sources> </system.diagnostics> </configuration>

    Read the article

  • SocketException preventing use of C# TCPListener in Windows Service

    - by JoeGeeky
    I have a Windows Service that does the following when started. When running via a Console application it works fine, but once I put in a Windows Service I get the below exception. Here is what I have tried so far: Disabled the firewall, also tried adding explicit exclusions for the exe, port, and protocol Checked CAS Policy Config, shows unrestricted rights Configured the Service to run as an Administrator Account, Local System, Local Service, and Network Service, each with the same result Tried different ports Also tried 127.0.0.1 just to see... same issue This is wrecking my head, so any help would be greatly appreciated: The Code: var _listener = new TcpListener(endpoint); //192.168.2.2:20000 _listener.Start(); The resulting Exception: Service cannot be started. System.Net.Sockets.SocketException: An attempt was made to access a socket in a way forbidden by its access permissions at System.Net.Sockets.Socket.DoBind(EndPoint endPointSnapshot, SocketAddress socketAddress) at System.Net.Sockets.Socket.Bind(EndPoint localEP) at System.Net.Sockets.TcpListener.Start(Int32 backlog) at System.Net.Sockets.TcpListener.Start() at Server.RequestHandler.StartServicingRequests(IPEndPoint endpoint) at Server.Server.StartServer(String[] args) at Server.Server.OnStart(String[] args) at System.ServiceProcess.ServiceBase.ServiceQueuedMainCallback(Object state)

    Read the article

  • java - call web service operation - wrong return type

    - by user1639680
    i have a simple web service with one method that returns List<org.company.data.mp> i've created a simple web service client and specified a web service with wsdl. in netbeans i try to call a web service operation: right click, insert code, ... and i pick my web service operation. the code gets inserted but the method's return type is not List<org.company.data.mp> but it is List<org.company.server.mp>! i don't get it.. in the package "server" there is no class called mp! i check the implementation class of my web service - it says the return type is ...data.mp not ...server.mp

    Read the article

  • Ruby New dnssd (bonjour zeroconf) service not appearing while browsing

    - by Poul
    Here is my simple zeroconf (aka bonjour dnssd) browser. If I have other services running when I start the browser I can see it (the 'resolved to' line prints to the screen). However, if I start up another service while this browser is running it will not appear. It just waits at the top of the block so I would expect it to enter the block once a new service is registered. Any ideas? require 'rubygems' require 'dnssd' browser = DNSSD::Service.new browser.browse '_http._tcp.' do |reply| #<-- code seems to wait here for more services DNSSD.resolve reply do |r| puts "resolved to: http://#{r.target}:#{r.port}" end end #example service register_service = DNSSD::register( "My Service","_http._tcp", nil, my_port) do puts "* Registering the service *" end

    Read the article

  • MVC Client Validation from Service Layer

    - by GibboK
    I'm following this article http://www.asp.net/mvc/tutorials/older-versions/models-(data)/validating-with-a-service-layer-cs to include a Service Layer with Business Logic in my MVC Web Application. I'm able to pass messages from the Service Layer to the View Model in a Html.ValidationSummary using ModelState Class. I perform basic validation logic on the View Model (using DataAnnotation attributes) and I have ClientValidation enabled by default which displaying the error message on every single field of my form. The Business logic error message which come from the Service Layer are being displayed on Html.ValidationSummary only after Posting the form to the Server. After Validation from the Service Layer I would like highlight one or more fields and have the message from the Service Layer showing on these fields instead that the Html.ValidationSummary. Any idea how to do it? Thanks

    Read the article

  • referencing a WCF web service

    - by ErnieStings
    Our current project uses an asmx service. We want to keep this service for now, but would like to add an additional wcf service for ajax calls. I followed a procedure i found online to set up the service and it works fine with javascript in aspx files within that particular project but i'm unsure how to reference it in javascript files in a different project (in the same solution). If someone could point me in the right direction it would be much appreciated. Thanks, Shawn EDIT: i wish to make calls in javascript similar to the following: function Button1_onclick() { var service = new AjaxServices.TestService(); service.wcfTest(4, onSuccess, null, null); } function onSuccess(result){ document.getElementById("ajaxPlaceHolder").innerHTML = "<p>" + result + "</p>"; } // ]]> but i'm willing to explore the jQuery option as well.

    Read the article

  • WCF service with 2 Bindings and 2 Base Addresses

    - by Sean
    I have written a WCF service (I am a newb) that I want to provide 2 endpoints for (net.tcp & basicHttp) The problem comes when I try to configure the endpoints. If I configure them as seperate services, then my service names are the same which causes a problem. I have seen recomended creating shim classes (classA : MyService, and ClassB : MyService) but that seems smelly. <services> <service name="MyWcfService.MyService" behaviorConfiguration="MyWcfService.HttpBehavior"> <endpoint name="ApplicationHttp" address="Application" binding="basicHttpBinding" bindingConfiguration="HttpBinding" contract="MyWcfService.Interfaces.IMyService" /> <endpoint address="mex" binding="mexHttpBinding" contract="IMetadataExchange" /> <host> <baseAddresses> <add baseAddress="http://localhost:8731/MyWcfService/" /> </baseAddresses> </host> </service> <service name="MyWcfService.MyService" behaviorConfiguration="MyWcfService.MyBehavior"> <endpoint name="Application" address="Application" binding="netTcpBinding" bindingConfiguration="SecuredByWindows" contract="EmsHistorianService.Interfaces.IApplicationHistorianService" /> <endpoint address="mex" binding="mexTcpBinding" contract="IMetadataExchange" /> <host> <baseAddresses> <add baseAddress="net.tcp://localhost:49153/MyWcfService" /> </baseAddresses> </host> </service> </services> I have tried using a single service with the base address integrated into the address, but that gives me errors as well <services> <service name="MyWcfService.MyService" behaviorConfiguration="MyWcfService.HttpBehavior"> <endpoint name="ApplicationHttp" address="http://localhost:8731/MyWcfService/Application" binding="basicHttpBinding" bindingConfiguration="HttpBinding" contract="MyWcfService.Interfaces.IMyService" /> <endpoint address="http://localhost:8731/MyWcfService/mex" binding="mexHttpBinding" contract="IMetadataExchange" /> <endpoint name="Application" address="net.tcp://localhost:49153/MyWcfService/Application" binding="netTcpBinding" bindingConfiguration="SecuredByWindows" contract="EmsHistorianService.Interfaces.IApplicationHistorianService" /> <endpoint address="net.tcp://localhost:49153/MyWcfService/mex" binding="mexTcpBinding" contract="IMetadataExchange" /> </service> </services> Any ideas?

    Read the article

  • WCF Service Library Reference in a Web Form (asp.net)

    - by Abu Hamzah
    i am not sure if this is the correct way of doing but i read that you not suppose to have a WCF Service Library reference in your web form project rather you add endpoints to your web.config, is that true? here is what i have done: 1) create a WCF service library project 2) create a simple service called "MyService.svc" WebForm: 1) Create a web project 2) create a WCF Service and in it i have this code <%@ ServiceHost Language="C#" Service="WCFJQuery.ContactBLL.Implementation.ContactUs" Factory="System.ServiceModel.Activation.WebScriptServiceHostFactory" %> 3) right click on the web proejct and "Add Reference" and add teh MyService.dll reference from WCF service library project. is this something how you suppose to do?

    Read the article

  • Deploying service from development server to iis7 server

    - by MindWorX
    I have a service which works perfectly on the local development server, but once moved to the remote iis7 server, it fails. I've been browsing the service in a browser manually. Here's the steps I've been taking: Open up Service.svc Open up Service.svc?wsdl Open up Service.svc?wsdl0 Open up Service.svc?xsd=xsd0 Step 4. is where it fails. If i browse on the development server it works. If i browse on the iis7 server, I get a connection reset error. Any help appreciated.

    Read the article

  • What MS technology to use for HTTP service returning XML?

    - by Borek
    I need to create a service that: accepts HTTP requests (with query string or HTTP POST parameters) does some processing on the requests (checking if the request is valid, authentication etc.) reads data from a custom store (another HTTP call in our case) returns the result as custom XML (defined with XSD) I'm trying to think of various MS technologies that could help me and how good they would be for this scenario (pretty standard one I guess). The tasks above are relatively separate, this is what comes to mind: HTTP front-end: ASP.NET Web Forms ASP.NET MVC (seems more appropriate here as I won't need server controls, view state etc.) WCF? Don't know much about it or how well it would suit my task. Custom logic on the server: this will probably be a generic C# code in all cases (sometimes "plugged into" or called from MVC controllers or some equivalent place in other technologies) Reading data from internal data stores: As said, this is another HTTP server in our case. Options that come to mind: Just read the data using something like WebClient (Just theoretically) implement a LINQ provider (Just even more theoretically) implement an EF provider Output the data as custom XML: Linq2XML Serialization? Is it flexible enough? Does WCF provide some tools for this? Some "OXM" - Object/XML mapper if there is something like that for .NET I may be wrong in many of my assumptions, this is just a quick list that comes to mind after a quick research. Some general notes / questions: Testing is important Solution with a clear domain model would be much preferred over the one without Can Entity Framework actually help somewhere in my scenario? If so, where and how? Would WCF be an appropriate technology for this? I don't know much about it.

    Read the article

  • jQuery AJAX Web service works only locally

    - by Greg
    Hi, I have a simple ASP.NET Web Service [WebService(Namespace = "http://tempuri.org/")] [WebServiceBinding(ConformsTo = WsiProfiles.BasicProfile1_1)] [System.Web.Script.Services.ScriptService] public class Service : System.Web.Services.WebService { public Service () { } [WebMethod] public string SetName(string name) { return "hello my dear friend " + name; } } For this Web Service I created Virtual Directory, so I can receive the access by taping http://localhost:89/Service.asmx. I try to call it via simple html page with jQuery. For this purpose I use function CallWS() { $.ajax({ type: "POST", data: "{'name':'Pumba'}", dataType: "json", url: "http://localhost:89/Service.asmx/SetName", contentType: "application/json; charset=utf-8", success: function (msg) { $('#DIVid').html(msg.d); }, error: function (e) { $('#DIVid').html("Error"); } }); The most interesting fact: If I create the html page in the project with my WebService and change url to Service.asmx/SetName everything works excellent. But if I try to call this webservice remotely - success function works but msg is null. After that I tried to call this service even via SOAP. It is the the same - locally it works excellent, but remotely - not at all. var ServiceUrl = 'http://localhost:89/Service.asmx?op=SetName'; function beginSetName(Name) { var soapMessage = '<?xml version="1.0" encoding="utf-8"?> <soap:Envelope xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xmlns:xsd="http://www.w3.org/2001/XMLSchema" xmlns:soap="http://schemas.xmlsoap.org/soap/envelope/"> <soap:Body> <SetName xmlns="http://tempuri.org/"> <name>' + Name + '</name> </SetName> </soap:Body> </soap:Envelope>'; $.ajax({ url: ServiceUrl, type: "POST", dataType: "xml", data: soapMessage, complete: endSetName, contentType: "text/xml; charset=\"utf-8\"" }); return false; } function endSetName(xmlHttpRequest, status) { $(xmlHttpRequest.responseXML) .find('SetNameResult') .each(function () { var name = $(this).text(); alert(name); }); } In this case status has value "parseerror". Could you please help me to resolve this problem? What should I do to call another WebService remotely by url via jQuery. Thank you in advance, Greg

    Read the article

  • Best approach to design a service oriented system

    - by Gustavo Paulillo
    Thinking about service orientation, our team are involved on new application designs. We consist in a group of 4 developers and a manager (that knows something about programming and distributed systems). Each one, having own opinion on service design. It consists in a distributed system: a user interface (web app) accessing the services in a dedicated server (inside the firewall), to obtain the business logic operations. So we got 2 main approachs that I list above : Modular services Having many modules, each one consisting of a service (WCF). Example: namespaces SystemX.DebtService, SystemX.CreditService, SystemX.SimulatorService Unique service All the business logic is centralized in a unique service. Example: SystemX.OperationService. The web app calls the same service for all operations. In your opinion, whats the best? Or having another approach is better for this scenario?

    Read the article

  • Adding x11vnc as a Solaris SMF service

    - by rojanu
    I am trying add x11vnc as SMF service but cannot get service to start. I tried googling but couldn't find anything that could help me. Here is the startup script #!/sbin/sh # # Copyright (c) 1995, 1997-1999 by Sun Microsystems, Inc. # All rights reserved. # #ident "@(#)x11vnc 1.14 06/11/17 SMI" case "$1" in 'start') #/usr/local/bin/x11vnc -geometry 1280x1024 -noshm -display :0 -ncache 10 -noshm -shared -forever -o /tmp/vnc_remote.log -bg /usr/local/bin/x11vnc -unixpw -ncache 10 -display :0 -noshm -shared -forever -o /tmp/vnc_remote.log ;; 'stop') /usr/bin/pkill -x -u 0 x11vnc ;; *) echo "Usage: $0 { start | stop }" ;; esac exit 0 and here is the manifest file <?xml version='1.0'?> <!DOCTYPE service_bundle SYSTEM '/usr/share/lib/xml/dtd/service_bundle.dtd.1'> <service_bundle type='manifest' name='vnc'> <service name='application/x11vnc' type='service' version='0'> <create_default_instance enabled='true'/> <single_instance/> <dependency name='docusp' grouping='require_all' restart_on='none' type='service'> <service_fmri value='svc:/milestone/multi-user-server:default'/> </dependency> <exec_method name='start' type='method' exec='/lib/svc/method/x11vnc' timeout_seconds='0'> <method_context/> </exec_method> <exec_method name='stop' type='method' exec=':true' timeout_seconds='10'> <method_context/> </exec_method> <stability value='Evolving' /> <property_group name='startd' type='framework'> <propval name='ignore_error' type='astring' value='core,signal'/> </property_group> </service> </service_bundle> and the log file Usage: /lib/svc/method/x11vnc { start | stop } [ Nov 16 19:35:52 Method "start" exited with status 0 ] [ Nov 16 19:35:52 Stopping because all processes in service exited. ] [ Nov 16 19:35:52 Executing stop method (:kill) ] [ Nov 16 19:35:52 Executing start method ("/lib/svc/method/x11vnc") ] Usage: /lib/svc/method/x11vnc { start | stop } [ Nov 16 19:35:52 Method "start" exited with status 0 ] [ Nov 16 19:35:52 Stopping because all processes in service exited. ] [ Nov 16 19:35:52 Executing stop method (:kill) ] [ Nov 16 19:35:52 Executing start method ("/lib/svc/method/x11vnc") ] Usage: /lib/svc/method/x11vnc { start | stop } [ Nov 16 19:35:52 Method "start" exited with status 0 ] [ Nov 16 19:35:52 Stopping because all processes in service exited. ] [ Nov 16 19:35:52 Executing stop method (:kill) ] [ Nov 16 19:35:52 Restarting too quickly, changing state to maintenance ] Any Ideas?

    Read the article

  • Just in time debugger is popping up when debugging service client

    - by MAHESH K .M
    I have created as WCF service and hosted in IIS . This service is calling from another web application. When I am trying to debug the service calling event in the web application, the Just-in-Time debugger is popping up. It is running fine in the normal mode. Only in the debug mode the service is not running and JIT debugger is popping up also Why it happens? How to debug the service call in this scenario? The service is in .NET 4 and the web application is in .net 1.1 Thanks in advance Mahesh.

    Read the article

< Previous Page | 92 93 94 95 96 97 98 99 100 101 102 103  | Next Page >