Search Results

Search found 35327 results on 1414 pages for 'string concatenation'.

Page 98/1414 | < Previous Page | 94 95 96 97 98 99 100 101 102 103 104 105  | Next Page >

  • Andorid - Display HTML Formatted String

    - by Soren
    I need an example how to display the strings that I have marked up with simple html into a TextView. I have found "Spanned fromHtml(String source)", but I don't know how to plug it into my java code. Here is my Java: package com.SorenWinslow.TriumphHistory; import android.app.ListActivity; import android.os.Bundle; import android.widget.ArrayAdapter; public class TriumphHistory extends ListActivity { String[] HistoryList; /** Called when the activity is first created. */ @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.main); ArrayAdapter<String> adapter; HistoryList = getResources().getStringArray(R.array.history); adapter = new ArrayAdapter<String> (this,R.layout.historylistlayout,HistoryList); setListAdapter(adapter); } } Here is a sample of history: <?xml version="1.0" encoding="utf-8"?> <resources> <string-array name="history"> <item><b>1883</b><br/>Some stuff happened</item> <item><b>1884</b><br/>Some more stuff happened <i>before</i> the other stuff </item> <resources> Here is my historylistlayout.xml: <?xml version="1.0" encoding="utf-8"?> <TextView xmlns:android="http://schemas.android.com/apk/res/android" android:id="@android:id/text1" android:layout_width="fill_parent" android:layout_height="wrap_content" android:textAppearance="?android:attr/textAppearanceLarge" android:gravity="center_vertical" android:textColor="#ffffff" android:background="#000050" android:layout_marginTop="5px" android:minHeight="?android:attr/listPreferredItemHeight" android:padding="3px" android:textSize="8pt" android:layout_gravity="top|left"/> And here is my main.xml <?xml version="1.0" encoding="utf-8"?> <LinearLayout xmlns:android="http://schemas.android.com/apk/res/android" android:orientation="vertical" android:textColor="#ffffff" android:background="#000080" android:isScrollContainer="true" android:layout_height="fill_parent" android:layout_width="fill_parent" android:scrollbarStyle="insideOverlay"> <ListView xmlns:android="http://schemas.android.com/apk/res/android" android:id="@android:id/list" android:layout_width="fill_parent" android:layout_height="wrap_content" android:clickable="true" android:dividerHeight="1px"/> </LinearLayout>

    Read the article

  • Issues with Rails 3.1 API with Query String to Create action on Mac OSX Mountain Lion

    - by hjaved
    Hi I've been stuck on this problem for a while and would appreciate your help. I'm writing an API to allow an external source like a Browser Query String or a smartphone to enter some model User info in a form and hit the User create action to write the data to the db. Please tell me what I'm doing wrong with the code below. I've also observed that if I have code like @user = User.new(params[:user]), that this approach only works when a user enters their data within the form. And that if I have code such as @user = User.new( name: params[:name], location: params[:location], password = params[:password], email: params[:email]), that this code ONLY works for a Query string entry, but NOT both Query string AND regular form submission. Why is that and how can I write the code above in the Users Controller Create action, so that it takes care of both situations? URL used: localhost:3000/users/create?name=John&&[email protected]&&password=secret&&location=SanFrancisco&date=06122012 The date is of type string but it doesn't show up in the database. Why? Everything else does. UsersController.rb def create @user = User.new(params[:user]) if @user.save session[:uid] = @user.id redirect_to thanks_path, notice: "Welcome #{@user.name}!" else redirect_to root_path end end New User Form: <%=u.text_field :name, placeholder: "Name"%><br> <%=u.text_field :email, placeholder: "Email"%><br> <%=u.password_field :password, placeholder: "Password"%><br> <%=u.text_field :location, placeholder: "City"%><br> <%=u.text_field :date, placeholder: "Date"%><br> <%if params[:partner_id]%> <%=u.hidden_field :partner_id, value: params[:partner_id]%> <%end%> <button class="btn btn-large btn-primary">Enter</button> I also tried to create a separate method called remotecreate for User creation for something other than a regular web form. I entered remotecreate in the Query string but it didn't work. def remotecreate @user = User.create(name: params[:name], email: params[:email], password: params[:password], location: params[:location], date: params[:date]) if @user.save session[:uid] = @user.id redirect_to thanks_path, notice: "Welcome #{@user.name}" else redirect_to root_path end end Thanks!

    Read the article

  • Silverlight 4 DataBinding: Binding to ObservableCollection<string> not working anymore

    - by Kurt
    Upgrading from SL3 - SL4. First problem: this throws a parser exception: <StackPanel Name={Binding} /> (same with x:Name) Collection is ObservableCollection<string>. Worked fine in SL3. So it seems that SL4 doen't allow binding to the Name property. Huh? So: changed to <StackPanel Tag={Binding} /> ... since I just need to ID the control in code behind. So here's the bug ('cuz this has got to be a bug!): In this frag, AllAvailableItems is an ObservableCollection<string>: <ItemsControl Name="lbItems" ItemsSource="{Binding AllAvailableItems}" Height="Auto" Width="Auto" BorderBrush="Transparent" BorderThickness="0" VerticalAlignment="Top" HorizontalAlignment="Left" Margin="12,6,0,0"> <ItemsControl.ItemTemplate> <DataTemplate> <Grid> <Grid.RowDefinitions> <RowDefinition /> <RowDefinition /> </Grid.RowDefinitions> <CheckBox Tag="{Binding}" Checked="ItemChecked_Click" Unchecked="ItemUnchecked_Click" Style="{StaticResource CheckBoxStyle}" Grid.Row="0"> <CheckBox.Content> <TextBlock Text="{Binding}" Style="{StaticResource FormLJustStyle}" /> </CheckBox.Content> </CheckBox> <StackPanel Tag="{Binding}" Orientation="Vertical" Grid.Row="1"> <configControls:ucLanguage /> <!-- simple user control --> </StackPanel> </Grid> </DataTemplate> </ItemsControl.ItemTemplate> </ItemsControl> In the code behind, I use a recursive function to find the Dependency object with either the Name or Tag property provided: public static T FindVisualChildByName<T>(DependencyObject parent, string name, DependencyProperty propToUse) where T : DependencyObject { for (int i = 0; i < VisualTreeHelper.GetChildrenCount(parent); i++) { var child = VisualTreeHelper.GetChild(parent, i); string controlName = child.GetValue(propToUse) as string; if (controlName == name) { return child as T; } else { T result = FindVisualChildByName<T>(child, name, propToUse); if (result != null) return result; } } return null; } OK, get this: in the code behind, I can get the control that is ORDERED FIRST in the XAML! In other words, if I put the CheckBox first, I can retrieve the CheckBox, but no StackPanel. And vice-versa. This all worked fine in SL3. Any help, ideas ... ? Thanks - Kurt

    Read the article

  • Help with specific Regex: need to match multiple instances of multiple formats in a single string.

    - by KevenK
    I apologize for the terrible title...it can be hard to try to summarize an entire situation into a single sentence. Let me start by saying that I'm asking because I'm just not a Regex expert. I've used it a bit here and there, but I just come up short with the correct way to meet the following requirements. The Regex that I'm attempting to write is for use in an XML schema for input validation, and used elsewhere in Javascript for the same purpose. There are two different possible formats that are supported. There is a literal string, which must be surrounded by quotation marks, and a Hex-value string which must be surrounded by braces. Some test cases: "this is a literal string" <-- Valid string, enclosed properly in "s "this should " still be correct" <-- Valid string, "s are allowed within (if possible, this requirement could be forgiven if necessary) "{00 11 22}" <-- Valid string, {}'s allow in strings. Another one that can be forgiven if necessary I am bad output <-- Invalid string, no "s "Some more problemss"you know <-- Invalid string, must be fully contained in "s {0A 68 4F 89 AC D2} <-- Valid string, hex characters enclosed in {}s {DDFF1234} <-- Valid string, spaces are ignored for Hex strings DEADBEEF <-- Invalid string, must be contained in either "s or {}s {0A 12 ZZ} <-- Invalid string, 'Z' is not a valid Hex character To satisfy these general requirements, I had come up with the following Regex that seems to work well enough. I'm still fairly new to Regex, so there could be a huge hole here that I'm missing.: &quot;.+&quot;|\{([0-9]|[a-f]|[A-F]| )+\} If I recall correctly, the XML Schema regex automatically assumes beginning and end of line (^ and $ respectively). So, essentially, this regex accepts any string that starts and ends with a ", or starts and ends with {}s and contains only valid Hexidecimal characters. This has worked well for me so far except that I had forgotten about another (although less common, and thus forgotten) input option that completely breaks my regex. Where I made my mistake: Valid input should also allow a user to separate valid strings (of either type, literal/hex) by a comma. This means that a single string should be able to contain more than one of the above valid strings, separated by commas. Luckily, however, a comma is not a supported character within a literal string (although I see that my existing regex does not care about commas). Example test cases: "some string",{0A F1} <-- Valid {1122},{face},"peanut butter" <-- Valid {0D 0A FF FE},"string",{FF FFAC19 85} <-- Valid (Spaces don't matter in Hex values) "Validation is allowed to break, if a comma is found not separating values",{0d 0a} <-- Invalid, comma is a delimiter, but "Validation is allowed to break" and "if a comma..." are not marked as separate strings with "s hi mom,"hello" <-- Invalid, String1 was not enclosed properly in "s or {}s My thoughts are that it is possible to use commas as a delimiter to check each "section" of the string to match a regex similar to the original, but I just am not that advanced in regex yet to come up with a solution on my own. Any help would be appreciated, but ultimately a final solution with an explanation would just stellar. Thanks for reading this huge wall of text!

    Read the article

  • Binding Image.Source to String in WPF ?

    - by Mohammad
    I have below XAML code : <Window x:Class="WpfApplication1.Window1" xmlns="http://schemas.microsoft.com/winfx/2006/xaml/presentation" xmlns:x="http://schemas.microsoft.com/winfx/2006/xaml" DataContext="{Binding RelativeSource={RelativeSource Self}}" WindowStartupLocation="CenterScreen" Title="Window1" Height="300" Width="300"> <Grid> <Image x:Name="TestImage" Source="{Binding Path=ImageSource}" /> </Grid> </Window> Also, there is a method that makes an Image from a Base64 string : Image Base64StringToImage(string base64ImageString) { try { byte[] b; b = Convert.FromBase64String(base64ImageString); MemoryStream ms = new System.IO.MemoryStream(b); System.Drawing.Image img = System.Drawing.Image.FromStream(ms); ////////////////////////////////////////////// //convert System.Drawing.Image to WPF image System.Drawing.Bitmap bmp = new System.Drawing.Bitmap(img); IntPtr hBitmap = bmp.GetHbitmap(); System.Windows.Media.ImageSource imageSource = System.Windows.Interop.Imaging.CreateBitmapSourceFromHBitmap(hBitmap, IntPtr.Zero, Int32Rect.Empty, BitmapSizeOptions.FromEmptyOptions()); Image wpfImage = new Image(); wpfImage.Source = imageSource; wpfImage.Width = wpfImage.Height = 16; ////////////////////////////////////////////// return wpfImage; } catch { Image img1 = new Image(); img1.Source = new BitmapImage(new Uri(@"/passwordManager;component/images/TreeView/empty-bookmark.png", UriKind.Relative)); img1.Width = img1.Height = 16; return img1; } } Now, I'm gonna bind TestImage to the output of Base64StringToImage method. I've used the following way : public string ImageSource { get; set; } ImageSource = Base64StringToImage("iVBORw0KGgoAAAANSUhEUgAAABAAAAAQCAMAAAAoLQ9TAAAABGdBTUEAAK/INwWK6QAAABl0RVh0U29mdHdhcmUAQWRvYmUgSW1hZ2VSZWFkeXHJZTwAAABjUExURXK45////6fT8PX6/bTZ8onE643F7Pf7/pDH7PP5/dns+b7e9MPh9Xq86NHo947G7Hm76NTp+PL4/bHY8ojD67rc85bK7b3e9MTh9dLo97vd8/D3/Hy96Xe76Nfr+H+/6f///1bvXooAAAAhdFJOU///////////////////////////////////////////AJ/B0CEAAACHSURBVHjaXI/ZFoMgEEMzLCqg1q37Yv//KxvAlh7zMuQeyAS8d8I2z8PT/AMDShWQfCYJHL0FmlcXSQTGi7NNLSMwR2BQaXE1IfAguPFx5UQmeqwEHSfviz7w0BIMyU86khBDZ8DLfWHOGPJahe66MKe/fIupXKst1VXxW/VgT/3utz99BBgA4P0So6hyl+QAAAAASUVORK5CYIII").Source.ToString(); but nothing happen. How can I fix it ? BTW, I'm dead sure that the base64 string is correct

    Read the article

  • Convert NSMutableArray to string and back

    - by Friendlydeveloper
    Hello, in my current project I'm facing the following problem: The app needs to exchange data with my server, which are stored inside a NSMutableArray on the iPhone. The array holds NSString, NSData and CGPoint values. Now, I thought the easiest way to achieve this, was to convert the array into a properly formatted string, send it to my server and store it inside some mySQL database. At this point I'd like to request my data from my server, receive the string, which represents contents of my array and then actually convert it back into a NSMutablArray. So far, I tried something like this: NSString *myArrayString = [myArray description]; Now I send this string to my server and store it inside my mySQL database. That part works really well. However, when I receive the string from my server, I have trouble converting it back into a NSMutableArray. Is there a method, which can easily convert array description back into an array? Unfortunately I couldn't find anything on that so far. Maybe my way of "serializing" the array is wrong right from the start and there is a smarter way to do this. Any help appreciated. Thanks in advance.

    Read the article

  • C# code to GZip and upload a string to Amazon S3

    - by BigJoe714
    Hello. I currently use the following code to retrieve and decompress string data from Amazon C#: GetObjectRequest getObjectRequest = new GetObjectRequest().WithBucketName(bucketName).WithKey(key); using (S3Response getObjectResponse = client.GetObject(getObjectRequest)) { using (Stream s = getObjectResponse.ResponseStream) { using (GZipStream gzipStream = new GZipStream(s, CompressionMode.Decompress)) { StreamReader Reader = new StreamReader(gzipStream, Encoding.Default); string Html = Reader.ReadToEnd(); parseFile(Html); } } } I want to reverse this code so that I can compress and upload string data to S3 without being written to disk. I tried the following, but I am getting an Exception: using (AmazonS3 client = Amazon.AWSClientFactory.CreateAmazonS3Client(AWSAccessKeyID, AWSSecretAccessKeyID)) { string awsPath = AWSS3PrefixPath + "/" + keyName+ ".htm.gz"; byte[] buffer = Encoding.UTF8.GetBytes(content); using (MemoryStream ms = new MemoryStream()) { using (GZipStream zip = new GZipStream(ms, CompressionMode.Compress)) { zip.Write(buffer, 0, buffer.Length); PutObjectRequest request = new PutObjectRequest(); request.InputStream = ms; request.Key = awsPath; request.BucketName = AWSS3BuckenName; using (S3Response putResponse = client.PutObject(request)) { //process response } } } } The exception I am getting is: Cannot access a closed Stream. What am I doing wrong?

    Read the article

  • Design approach, string table data, variables, stl memory usage

    - by howieh
    I have an old structure class like this: typedef vector<vector<string>> VARTYPE_T; which works as a single variable. This variable can hold from one value over a list to data like a table. Most values are long,double, string or double [3] for coordinates (x,y,z). I just convert them as needed. The variables are managed in a map like this : map<string,VARTYPE_T *> where the string holds the variable name. Sure, they are wrapped in classes. Also i have a tree of nodes, where each node can hold one of these variablemaps. Using VS 2008 SP1 for this, i detect a lot of memory fragmentation. Checking against the stlport, stlport seemed to be faster (20% ) and uses lesser memory (30%, for my test cases). So the question is: What is the best implementation to solve this requirement with fast an properly used memory ? Should i write an own allocator like a pool allocator. How would you do this ? Thanks in advance, Howie

    Read the article

  • how convert DataTable to List<String> in C#

    - by Jitendra Jadav
    Hello Everyone .. I am using C# Linq now I am converting DataTable to List and I am getting stuck... give me right direction thanks.. private void treeview1_Expanded(object sender, RoutedEventArgs e) { coa = new List<string>(); //coa = (List<string>)Application.Current.Properties["CoAFull"]; HMDAC.Hmclientdb db = new HMDAC.Hmclientdb(HMBL.Helper.GetDBPath()); var data = (from a in db.CoA where a.ParentId == 0 && a.Asset == true select new { a.Asset, a.Category, a.CoAName, a.Hide, a.Recurring, a.TaxApplicable }); DataTable dtTable = new DataTable(); dtTable.Columns.Add("Asset", typeof(bool)); dtTable.Columns.Add("Category", typeof(string)); dtTable.Columns.Add("CoAName", typeof(string)); dtTable.Columns.Add("Hide", typeof(bool)); dtTable.Columns.Add("Recurring", typeof(bool)); dtTable.Columns.Add("TaxApplicable", typeof(bool)); if (data.Count() > 0) { foreach (var item in data) { DataRow dr = dtTable.NewRow(); dr["Asset"] = item.Asset; dr["Category"] = item.Category; dr["CoAName"] = item.CoAName; dr["Hide"] = item.Hide; dr["Recurring"] = item.Recurring; dr["TaxApplicable"] = item.TaxApplicable; dtTable.Rows.Add(dr); } } coa = dtTable; }

    Read the article

  • Storing UTF8 string in a UnicodeString

    - by Mick
    In Delphi 2007 you can store a UTF8 string in a WideString and then pass that onto a Win32 function, e.g. var UnicodeStr: WideString; UTF8Str: WideString; begin UnicodeStr:='some unicode text'; UTF8Str:=UTF8Encode(UnicodeStr); Windows.SomeFunction(PWideChar(UTF8Str), ...) end; Delphi 2007 does not interfere with the contents of UTF8Str, i.e. it is left as a UTF8 encoded string stored in a WideString. But in Delphi 2010 I'm struggling to find a way to do the same thing, i.e. store a UTF8 encoded string in a WideString without it being automatically converted from UTF8. I cannot pass a pointer to UTF8 string (or RawByteString), e.g. the following will obviously not work: var UnicodeStr: WideString; UTF8Str: UTF8String; begin UnicodeStr:='some unicode text'; UTF8Str:=UTF8Encode(UnicodeStr); Windows.SomeFunction(PWideChar(UTF8Str), ...) end; Any help appreciated. Thanks.

    Read the article

  • uninstall string

    - by Sakhawat Ali
    Hi experts, I am developing an desktop based application using VB.NET, similar to add/remove program. everything was working fine until i start working on uninstall feature. Now what am i doing is that i get the uninstall string of the specific application from the registry and use System.Diagnostics.Process to run UninstallString. Dim proc As New Process() proc.StartInfo.FileName =UninstallString proc.Start() proc.WaitForExit() proc.Close() latter i found that it only work for straight file paths only, i mean with no command line argument like: C:\program files\someApp\uninstall.exe I make a list of list of all UninstallStrings of all application installed on my machine. i found few things like application installed using MSI, some were with rundll32 and few were with straight file path with some command argument like: My Silverlight SDK UninstallString, MSI Example MsiExec.exe /X{2012098D-EEE9-4769-8DD3-B038050854D4} My JetAudio UninstallString, RunDll32 Example RunDll32 C:\PROGRA~1\COMMON~1\INSTAL~1\engine\6\INTEL3~1\Ctor.dll,LaunchSetup "C:\Program Files\InstallShield Installation Information{91F34319-08DE-457A-99C0-0BCDFAC145B9}\Setup.exe" -l0x9 My Google Chrome UninstallString, straight file path with command argument example "C:\Program Files\Google\Chrome\Application\5.0.375.55\Installer\setup.exe" -uninstall The code i mentioned above does not work for these. i did some string parsing, separate two thing from UninstallString one is Filename and other is Arguments. like for MSI, filename is MSIEXEC.EXE and argument will be rest of the string, same for RunDLL32, same for straight file path with command argument. Now what am i facing is that, after every 2 or 3 days i come to know that this type of unistallstring is also not working. and why is that not working because it is a new type maybe abc C:\program files\someapp.exe -ddd so parse it too. is there any better way of doing that rather then parsing the string.

    Read the article

  • Writing String to Stream and reading it back does not work

    - by Binary255
    I want to write a String to a Stream (a MemoryStream in this case) and read the bytes one by one. stringAsStream = new MemoryStream(); UnicodeEncoding uniEncoding = new UnicodeEncoding(); String message = "Message"; stringAsStream.Write(uniEncoding.GetBytes(message), 0, message.Length); Console.WriteLine("This:\t\t" + (char)uniEncoding.GetBytes(message)[0]); Console.WriteLine("Differs from:\t" + (char)stringAsStream.ReadByte()); The (undesired) result I get is: This: M Differs from: ? It looks like it's not being read correctly, as the first char of "Message" is 'M', which works when getting the bytes from the UnicodeEncoding instance but not when reading them back from the stream. What am I doing wrong? The bigger picture: I have an algorithm which will work on the bytes of a Stream, I'd like to be as general as possible and work with any Stream. I'd like to convert an ASCII-String into a MemoryStream, or maybe use another method to be able to work on the String as a Stream. The algorithm in question will work on the bytes of the Stream.

    Read the article

  • String trouble in Rave Reports 8

    - by Jørn E. Angeltveit
    We are currently working with Delphi 2006, but we are now very ready to move on to Delphi 2010. The problem lies in our Rave reports, though... We just get to many string errors when running our reports with Rave 8. And they just don't make any sense. (The reports compile with no error, and we can even run them without any error in Rave 6.) For instance: //This event causes access violation (in rtl14.bpl) at run time { Event for Page1.OnBeforeReport } function Page1_OnBeforeReport(Self: TRavePage); var s: String; begin s := 'My text in param'; s := s + ' and som more text'; s := copy(s,1,length(s)) + ' and then some more'; RaveProject.SetParam('MyTestParam', s); end OnBeforeReport; //This event works OK { Event for Page1.OnBeforeReport } function Page1_OnBeforeReport(Self: TRavePage); var s: String; begin s := 'My text in param'; s := s + ' and som more text'; s := copy(s,1,length(s)); // + ' and then some more'; RaveProject.SetParam('MyTestParam', s); end OnBeforeReport; //This event works OK too { Event for Page1.OnBeforeReport } function Page1_OnBeforeReport(Self: TRavePage); var s: String; begin s := 'My text in param'; s := s + ' and som more text'; s := copy(s,1,length(s)) + s; RaveProject.SetParam('MyTestParam', s); end OnBeforeReport; We really want to stick to Rave, because we have a lot of reports (150+) with a lot of functionality (sql statements, events etc). Besides, we have customers who have designed their own custom reports as well. Does anybody know the reason for these errors? Is there any solution or workaround to these problems?

    Read the article

  • Issue with getting 2 chars from string using indexer

    - by Learner
    I am facing an issue in reading char values. See my program below. I want to evaluate an infix expression. As you can see I want to read '10' , '*', '20' and then use them...but if I use string indexer s[0] will be '1' and not '10' and hence I am not able to get the expected result. Can you guys suggest me something? Code is in c# class Program { static void Main(string[] args) { string infix = "10*2+20-20+3"; float result = EvaluateInfix(infix); Console.WriteLine(result); Console.ReadKey(); } public static float EvaluateInfix(string s) { Stack<float> operand = new Stack<float>(); Stack<char> operator1 = new Stack<char>(); int len = s.Length; for (int i = 0; i < len; i++) { if (isOperator(s[i])) // I am having an issue here as s[i] gives each character and I want the number 10 operator1.Push(s[i]); else { operand.Push(s[i]); if (operand.Count == 2) Compute(operand, operator1); } } return operand.Pop(); } public static void Compute(Stack<float> operand, Stack<char> operator1) { float operand1 = operand.Pop(); float operand2 = operand.Pop(); char op = operator1.Pop(); if (op == '+') operand.Push(operand1 + operand2); else if(op=='-') operand.Push(operand1 - operand2); else if(op=='*') operand.Push(operand1 * operand2); else if(op=='/') operand.Push(operand1 / operand2); } public static bool isOperator(char c) { bool result = false; if (c == '+' || c == '-' || c == '*' || c == '/') result = true; return result; } } }

    Read the article

  • Strange \n in base64 encoded string in Ruby

    - by intellidiot
    The inbuilt Base64 library in Ruby is adding some '\n's. I'm unable to find out the reason. For this special example: irb(main):001:0> require 'rubygems' => true irb(main):002:0> require 'base64' => true irb(main):003:0> str = "1110--ad6ca0b06e1fbeb7e6518a0418a73a6e04a67054" => "1110--ad6ca0b06e1fbeb7e6518a0418a73a6e04a67054" irb(main):004:0> Base64.encode64(str) => "MTExMC0tYWQ2Y2EwYjA2ZTFmYmViN2U2NTE4YTA0MThhNzNhNmUwNGE2NzA1\nNA==\n" The \n's are at the last and 6th position from end. The decoder (Base64.decode64) returns back the old string perfectly. Strange thing is, these \n's don't add any value to the encoded string. When I remove the newlines from the output string, the decoder decodes it again perfectly. irb(main):005:0> Base64.decode64(Base64.encode64(str).gsub("\n", '')) == str => true More of this, I used an another JS library to produce the base64 encoded output of the same input string, the output comes without the \n's. Is this a bug or anything else? Has anybody faced this issue before? FYI, $ ruby -v ruby 1.8.7 (2008-08-11 patchlevel 72) [i486-linux]

    Read the article

  • Matlab and .net problem with character string function input

    - by Peter
    I have a MATLAB function that I've compiled into a .net library. The function is a simple one that takes a character array as an input and a numeric array as output: function insert = money(dateLimit) .. insert = [1 2]; The function works fine when no function arguments are specified (a default argument is provided inside the function) Dim sf As New SpreadFinder.SpreadFinder Dim output = sf.money() As soon as an argument is specified .net complains. I'm thinking this should be easy and has been done before but searching through MATLAB documentation doesn't offer much help. Here's what I've tried. The sf.money() overload for the function with arguments is (numArgsOut as Integer, argsOut as MWArray, argsIn as MWArray) and hence that's what I've tried. What am I missing? Dim sf As New SpreadFinder.SpreadFinder Dim inputArgs(1) As Arrays.MWCharArray Dim dateLimitString As String = "some string" inputArgs(0) = New Arrays.MWCharArray(dateLimitString) Dim outputArgs(1) As Arrays.MWNumericArray outputArgs(0) = New Arrays.MWNumericArray() sf.money(1, outputArgs, inputArgs) Gives System.NullReferenceException : Object reference not set to an instance of an object. at MathWorks.MATLAB.NET.Utility.MWMCR.EvaluateFunction(String functionName, Int32 numArgsOut, Int32 numArgsIn, MWArray[] argsIn) at MathWorks.MATLAB.NET.Utility.MWMCR.EvaluateFunction(String functionName, Int32 numArgsOut, MWArray[]& argsOut, MWArray[] argsIn) at SpreadFinder.SpreadFinder.money(Int32 numArgsOut, MWArray[]& argsOut, MWArray[] argsIn)

    Read the article

  • ASP.NET application using old connection string.

    - by Doug S.
    I am trying to publish a website using ASP.NET MVC3 EF and CODEFIRST with a SQL Server 2008 backend. On my local machine I was using a sql express db for development, but now that I am pushing live, I want to use my hosted production database. The problem is that when I try to run the application, it is still using my local db connection string. I have completely removed the old connection string from my web.config file and am using the <clear /> tag before creating the new connection string. I have also cleaned the solution and rebuilt, but somehow it is still connecting to the old db. What am I missing? This is the new connection string: <connectionStrings> <clear /> <add name="CellularAutomataDBContext" connectionString=" Server=XXX; Database=CellularAutomata; User ID=XXX; Password=XXX; Trusted_Connection=False" providerName="System.Data.SqlClient" /> </connectionStrings>

    Read the article

  • Grouping Collection seperating numeric 5 from String "5"

    - by invertedSpear
    BackGround: I have an advanced data grid. The data provider for this ADG is an ArrayCollection. There is a grouping collection on an ID field of this AC. Example of a couple items within this AC the AC var name is "arcTemplates": (mx.collections::ArrayCollection)#0 filterFunction = (null) length = 69 list = (mx.collections::ArrayList)#1 length = 69 source = (Array)#2 [0] (Object)#3 abbreviation = "sore-throat" insertDate = "11/16/2009" name = "sore throat" templateID = 234 templateType = "New Problem" templateTypeID = 1 [32] (Object)#35 abbreviation = 123 insertDate = "03/08/2010" name = 123 templateID = 297 templateType = "New Problem" templateTypeID = 1 [55] (Object)#58 abbreviation = 1234 insertDate = "11/16/2009" name = 1234 templateID = 227 templateType = "Exam" templateTypeID = 5 [56] (Object)#59 abbreviation = "breast only" insertDate = "03/15/2005" name = "breast exam" templateID = 195 templateType = "Exam" templateTypeID = 5 Example of Flex code leading to the Grouping: <mx:AdvancedDataGrid displayItemsExpanded="true" id="gridTemplates"> <mx:dataProvider> <mx:GroupingCollection id="gc" source="{arcTemplates}"> <mx:Grouping > <mx:GroupingField name="templateTypeID" compareFunction="gcSort"> GC sort function: public function gcSort(a:Object, b:Object):int{ return ObjectUtil.stringCompare(String(a.templateTypeID + a.name).toLowerCase(), String(b.templateTypeID + b.name).toLowerCase()); } Problem: In my AC example there are a few items, items 0, 32 and 56 properly sort and group to their templateTypeID, but item 55 does something weird. It seems to sort/group on the numeric 5 instead of the string "5". Gets stranger. If I change the name property to contain text (so 1234x) it then correctly sorts/groups to the string "5" Question: What is going on here and how do I fix it?

    Read the article

  • how to push a string address to stack with assembly, machine code

    - by Yigit
    Hi all, I am changing minesweeper.exe in order to have an understanding of how code injection works. Simply, I want the minesweeper to show a message box before starting. So, I find a "cave" in the executable and then define the string to show in messagebox and call the messagebox. Additionally of course, I have to change the value at module entry point of the executable and first direct it to my additional code, then continue its own code. So at the cave what I do; "hello starbuck",0 push 0 //arg4 of MessageBoxW function push the address of my string //arg3, must be title push the address of my string //arg2, must be the message push 0 //arg1 call MessageBoxW ... Now since the memory addresses of codes in the executable change everytime it is loaded in the memory, for calling the MessageBoxW function, I give the offset of the address where MessageBoxW is defined in Import Address Table. For instance, if MessageBoxW is defined at address1 in the IAT and the instruction just after call MessageBoxW is at address2 instead of writing call MessageBoxW, I write call address2 - address1. So my question is, how do I do it for pushing the string's address to the stack? For example, if I do these changes via ollydbg, I give the immediate address of "hello starbuck" for pushing and it works. But after reloading the executable or starting it outside of ollydbg, it naturally fails, since the immediate addresses change. Thanks in advance, Yigit.

    Read the article

  • Literal ampersands in System.Uri query string

    - by Nathan Baulch
    I'm working on a client app that uses a restful service to look up companies by name. It's important that I'm able to include literal ampersands in my queries since this character is quite common in company names. However whenever I pass %26 (the URI escaped ampersand character) to System.Uri, it converts it back to a regular ampersand character! On closer inspection, the only two characters that aren't converted back are hash (%23) and percent (%25). Lets say I want to search for a company named "Pierce & Pierce": var endPoint = "http://localhost/companies?where=Name eq '{0}'"; var name = "Pierce & Pierce"; Console.WriteLine(new Uri(string.Format(endPoint, name))); Console.WriteLine(new Uri(string.Format(endPoint, Uri.EscapeUriString(name)))); Console.WriteLine(new Uri(string.Format(endPoint, Uri.EscapeDataString(name)))); All three of the above combinations return: http://localhost/companies?where=Name eq 'Pierce & Pierce' This causes errors on the server side since the ampersand is (correctly) interpreted as a query arg delimiter. What I really need it to return is the original string: http://localhost/companies?where=Name eq 'Pierce %26 Pierce' How can I work around this behavior without discarding System.Uri entirely? I can't replace all ampersands with %26 at the last moment because there will usually be multiple query args involved and I don't want to destroy their delimiters. Note: A similar problem was discussed in this question but I'm specifically referring to System.Uri.

    Read the article

  • How to decode a html string using xslt

    - by John ClearZ
    I am trying to style an rss feed using xslt. I want to display an image that is stored in the tag on the feed. The problem is it is encoded to display as text on the page instead of being rendered. The following is an example of part of the string. 1). <description>&lt;img src="http&amp;#58;&amp;#47;&amp;#47;buavhw.blu.livefilestore.com&amp;#47;y1ppCokLxFJSG2cmyPdvg... I had to add extra coding to the string above to get it to appear properly here. The string below is how it appears when I paste it directly into the text box. 2). <description><img src="http&#58;&#47;&#47;buavhw.blu.livefilestore.com&#47;y1ppCokLxFJSG2cmyPdvg... If I copy and paste it again from the preview window it only then becomes the following string. 3). <description><img src="http://buavhw.blu.livefilestore.com/y1ppCokLxFJSG2cmyPdvg...

    Read the article

  • JSF/Facelets: set `action` attribute to a dynamically evaluated string

    - by harto
    In my JSF/Facelets application, I want to dynamically generate a breadcrumb trail from a list of page IDs using a custom tag: <foo:breadcrumbs trail="foo,bar,baz"/> This should generate something like: <h:commandLink action="foo" ... /> <h:commandLink action="bar" ... /> <!-- (etc.) --> My code looks something like this: <ui:repeat value="#{fn:split(trail, ',')}" var="key"> <h:commandLink action="#{key}" ... /> </ui:repeat> The problem with this code is that #{key} is interpreted as a method binding. However, I just want the string value of #{key} to be returned as the navigation outcome. How can I achieve this? The only thing I could think of was creating a dummy managed-bean that has an outcome field and an action handler, and invoke it like so: <h:commandLink action="#{dummy.click}" ...> <f:setPropertyActionListener target="#{dummy.outcome}" value="#{key}" /> </h:commandLink> with the dummy class defined like so: public class Dummy { private String outcome; public String click() { return outcome; } public void setOutcome(String outcome) { this.outcome = outcome; } public void getOutcome() { return outcome; } } That seems ugly though, and I don't know if it would work.

    Read the article

  • Covert uiiamge into string

    - by Warrior
    I am new iphone development.Is there any possibility to covert the uiimage into string and then once again back to image. - (void)imagePickerController:(UIImagePickerController *)picker didFinishPickingImage:(UIImage *)img1 editingInfo:(NSDictionary *)editInfo { [[picker parentViewController] dismissModalViewControllerAnimated:YES]; NSData *data = UIImagePNGRepresentation(img1); NSString *str1; str1 = [[NSString alloc] initWithData:data encoding:NSASCIIStringEncoding]; MyAppAppDelegate *appDelegate = (MyAppAppDelegate *) [[UIApplication sharedApplication] delegate]; [appDelegate setCurrentLink:str1]; EmailPictureViewController *email = [[EmailPictureViewController alloc] initWithNibName:@"EmailPictureViewController" bundle:nil]; [self.navigationController pushViewController:email animated:YES]; } so i can use delegate methods to tranfer the image from one view to another view. so i should convert the string once again to image and display it in another view. In Another view - (void)viewDidLoad { MyAppAppDelegate *appDelegate =(MyAppAppDelegate *) [[UIApplication sharedApplication] delegate]; str1 = [appDelegate getCurrentLink]; NSLog(@"The String %@",str1); NSData *aData; aData = [str1 dataUsingEncoding: NSASCIIStringEncoding]; NSLog(@"The String Data %@",aData); NSLog(@"Inside Didload3"); [imgview setImage:[UIImage imageWithData:aData]]; } But this doesn't work for me.Where do i go wrong.Is there any way to solve it?.Please help me out.Thanks.

    Read the article

  • C# custom control to get internal text as string

    - by Ed Woodcock
    ok, I'm working on a custom control that can contain some javascript, and read this out of the page into a string field. This is a workaround for dynamic javascript inside an updatepanel. At the moment, I've got it working, but if I try to put a server tag inside the block: <custom:control ID="Custom" runat="server"> <%= ControlName.ClientID %> </custom:control> The compiler does not like it. I know these are generated at runtime, and so might not be compatible with what I'm doing, but does anyone have any idea how I can get that working? EDIT Error message is: Code blocks are not supported in this context EDIT 2 The control: [DataBindingHandler("System.Web.UI.Design.TextDataBindingHandler, System.Design, Version=2.0.0.0, Culture=neutral, PublicKeyToken=b03f5f7f11d50a3a"), ControlValueProperty("Text"), DefaultProperty("Text"), ParseChildren(true, "Text"), AspNetHostingPermission(SecurityAction.LinkDemand, Level = AspNetHostingPermissionLevel.Minimal), AspNetHostingPermission(SecurityAction.InheritanceDemand, Level = AspNetHostingPermissionLevel.Minimal)] public class CustomControl : Control, ITextControl { [DefaultValue(""), Bindable(true), Localizable(true)] public string Text { get { return (string)(ViewState["Text"] ?? string.Empty); } set { ViewState["Text"] = value; } } }

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

< Previous Page | 94 95 96 97 98 99 100 101 102 103 104 105  | Next Page >