Search Results

Search found 26004 results on 1041 pages for 'debian based'.

Page 983/1041 | < Previous Page | 979 980 981 982 983 984 985 986 987 988 989 990  | Next Page >

  • JButton Image Ignoring GridBagConstraints

    - by daemor
    I am working on an application and have a screen that needs to have elements (namely some custom JButtons) appear and disappear based on a user selection. However for some reason, when I add these buttons to their pane, the buttton image goes to the top corner, and leaves the text in the center, completely ignoring GridBagConstraints. I am completely stumped on this one as I have done this same exact thing dozens of times earlier in the program without any issues. Here is an image of the problem: The problem is in this method here, and occurs down towards the bottom. public void init(){ contentPane.removeAll(); // Setup jlabels JLabel countyLabel = new JLabel("County"); countyLabel.setFont(new Font("Times New Roman", Font.PLAIN, 18)); JLabel measureByLabel = new JLabel("Measure By: "); measureByLabel.setFont(new Font("Times New Roman", Font.PLAIN, 18)); String[] countyChoices = {"Washtenaw", "Oakland", "Livingston"}; // setup components JComboBox<String> countyCombo = new JComboBox<String>(countyChoices); // place baseComponents c.weightx = 0.5; c.weighty = 0.5; c.gridx = 0; c.gridy = 0; c.anchor = GridBagConstraints.NORTH; contentPane.add(countyLabel, c); c.gridx = 2; contentPane.add(countyCombo, c); c.gridy = 1; c.gridx = 0; contentPane.add(trenchButton, c); c.gridx = 2; contentPane.add(bedButton, c); c.gridy = 2; c.gridx = 1; contentPane.add(systemSelection, c); c.gridy = 3; c.gridx = 0; contentPane.add(lengthButton, c); c.fill = GridBagConstraints.BOTH; c.gridwidth = 4; c.gridy = 4; c.gridx = 0; contentPane.add(choicePane, c); GridBagConstraints con = new GridBagConstraints(); con.weightx = 0.5; con.weighty = 0.5; con.gridx = 0; con.gridy = 0; choicePane.add(lengthButton, c); // revalidate and repaint choicePane.revalidate(); choicePane.repaint(); contentPane.revalidate(); contentPane.repaint(); } I have tried doing this in separate methods, the button looks fine when added to the contentPane, the pane is for sure set to gridbagconstraints as I used the expression JPanel choicePane = new JPanel(new GridBagLayout()) to initialize it.

    Read the article

  • Changing an Action Type="click" to an auto action in SVG

    - by Dustin Myers
    I have a SVG document that I exported from Visio 2003 that would like to edit. This file has an action where you click a button it will navigate to a new screen. What I would like to do is have the navigation be based off of a data point rather than having to click the button. As an example I have a dynamic point data being brought into the SVG file and when that value changes from 0 to 1, I want this screen to automatically navigate to another screen. Below is the code I for clicking the button. <title content="structured text">Sheet.1107</title> <desc content="structured text">Button 1</desc> <v:custProps> <v:cp v:ask="false" v:langID="1033" v:invis="false" v:cal="0" v:val="VT4(Test Graphic 2)" v:type="0" v:prompt="" v:nameU="ObjRef" v:sortKey="" v:lbl="" v:format=""/> <v:cp v:ask="false" v:langID="1033" v:invis="false" v:cal="0" v:val="VT4(SF-S)" v:type="0" v:prompt="" v:nameU="DataPt" v:sortKey="" v:lbl="" v:format=""/> </v:custProps> <v:userDefs> <v:ud v:prompt="" v:nameU="NAVIGATE" v:val="VT4(NAVIGATE Test Graphic 2,&apos;&apos;,)"/> </v:userDefs> <v:textBlock v:margins="rect(4,4,4,4)"/> <v:textRect width="125.01" height="35" cx="62.5" cy="517.5"/> <rect x="0" width="125" y="500" height="35" class="st3"/> <text x="40.15" y="521.1" v:langID="1033" class="st4"><v:paragraph v:horizAlign="1"/><v:tabList/>Button 1</text> <jci:action type="click" count="1">if(evt.button == 0) nav(&apos;Test Graphic 2&apos;,&apos;&apos;,&apos;&apos;);</jci:action></g></a> In the above code I am bringing in the data value from SF-S. Once that value is equal to 1 I want this screen to automatically navigate to Test Graphic 2. I don't have any experience with coding so I am hoping someone here will be able to help me. Thanks, DMyers

    Read the article

  • JQuery Datepicker Date highlight Issue

    - by Isola Olufemi
    I have an in-line date picker in which I want to highlight some dates based on array of strings from the server side. I found out the on load of the page with the datepicker, events the matches in the current month will not be highlighted. when I click the next month button the events on the next moth will be highlighted. What I discovered that i the matching only get highlighted when I click to the next month and not when I click back to the previous month. Below is my script: var actionCalDates = new Array(); function getDates(month, year) { $.ajax({ url: "/Index/GetAllAlerts", data: { month: month, year: year }, success: function (result) { var date = new Date(); var i = new Number(date.getMonth()); i += 1; actionCalDates = result.split(","); } }); } function getTitle(ar, d) { var result = ""; for (var i = 0; i < ar.length; i++) { if (ar[i].indexOf(d) != -1) { var e = actionCalDates[i].split(";"); result += e[0] + "\n"; } } return result; } $('#calendar').datepicker({ numberOfMonths: [1, 1], showCurrentAtPos: 0, dateFormat: 'dd/mm/y', beforeShowDay: function (thedate) { var theday = thedate.getDate(); var x = new Number(thedate.getMonth()); x += 1; var date = thedate.getDate() + "/" + x + "/" + thedate.getFullYear(); getDates(x, thedate.getFullYear()); for (var i = 0; i < actionCalDates.length; i++) { var entry = actionCalDates[i].split(";"); if (date == entry[1]) { return [true, "highlight", getTitle(actionCalDates, date)]; } } return [true, "", ""]; }, onChangeMonthYear: function (year, month, inst) { getDates(month, year); }, onSelect: function (d, instance) { $.ajax({ url: '/Index/AlertConvertDate', datatype: 'text', data: { dateString: d }, error: function (xhr, ajaxOptions, thrownError) { alert(xhr.statusText); alert(thrownError); }, success: function (data) { window.SetHomeContent(data); } }); } }); Please can someone point out where I went wrong? Thank you all.

    Read the article

  • Can sorting Japanese kanji words be done programatically?

    - by Mason
    I've recently discovered, to my astonishment (having never really thought about it before), machine-sorting Japanese proper nouns is apparently not possible. I work on an application that must allow the user to select a hospital from a 3-menu interface. The first menu is Prefecture, the second is City Name, and the third is Hospital. Each menu should be sorted, as you might expect, so the user can find what they want in the menu. Let me outline what I have found, as preamble to my question: The expected sort order for Japanese words is based on their pronunciation. Kanji do not have an inherent order (there are tens of thousands of Kanji in use), but the Japanese phonetic syllabaries do have an order: ???????????????????... and on for the fifty traditional distinct sounds (a few of which are obsolete in modern Japanese). This sort order is called ???? (gojuu on jun , or '50-sound order'). Therefore, Kanji words should be sorted in the same order as they would be if they were written in hiragana. (You can represent any kanji word in phonetic hiragana in Japanese.) The kicker: there is no canonical way to determine the pronunciation of a given word written in kanji. You never know. Some kanji have ten or more different pronunciations, depending on the word. Many common words are in the dictionary, and I could probably hack together a way to look them up from one of the free dictionary databases, but proper nouns (e.g. hospital names) are not in the dictionary. So, in my application, I have a list of every prefecture, city, and hospital in Japan. In order to sort these lists, which is a requirement, I need a matching list of each of these names in phonetic form (kana). I can't come up with anything other than paying somebody fluent in Japanese (I'm only so-so) to manually transcribe them. Before I do so though: Is it possible that I am totally high on fire, and there actually is some way to do this sorting without creating my own mappings of kanji words to phonetic readings, that I have somehow overlooked? Is there a publicly available mapping of prefecture/city names, from the government or something? That would reduce the manual mapping I'd need to do to only hospital names. Does anybody have any other advice on how to approach this problem? Any programming language is fine--I'm working with Ruby on Rails but I would be delighted if I could just write a program that would take the kanji input (say 40,000 proper nouns) and then output the phonetic representations as data that I could import into my Rails app. ??????????

    Read the article

  • Converting OpenGL co-ordinates to lower UIView (and UIImagePickerController)

    - by John Qualis
    Hi, I am new to OpenGL over iPhone. I am developing an iPhone app similar to a barcode reader but with an extra OpenGL layer. The bottommost layer is UIImagePickerController, then I use UIView on top and draw a rectangle at certain co-ordinates on the iphone screen. So far everything is OK. Then I am trying to draw an OpenGL 3-D model in that rectangle. I am able to load a 3-D model in the iPhone based on this code here - http://iphonedevelopment.blogspot.com/2008/12/start-of-wavefront-obj-file-loader.html I am not able to transform the co-ordinates of the rectangle into OpenGL co-ordinates. Appreciate any help. Do I need to use a matrix to translate the currentPosition of the 3-D model so it is drawn within myRect? The code is given below.. Appreciate any help/pointers in this regards. John -(void)setupView:(GLView*)view { const GLfloat zNear = 0.01, zFar = 1000.0, fieldOfView = 45.0; GLfloat size; glEnable(GL_DEPTH_TEST); glMatrixMode(GL_PROJECTION); size = zNear * tanf(DEGREES_TO_RADIANS(fieldOfView) / 2.0); CGRect rect = view.bounds; glFrustumf(-size, size, -size / (rect.size.width / rect.size.height), size / (rect.size.width / rect.size.height), zNear, zFar); glViewport(0, 0, rect.size.width, rect.size.height); glMatrixMode(GL_MODELVIEW); glLoadIdentity(); glClearColor(0.0f, 0.0f, 0.0f, 0.0f); NSString *path = [[NSBundle mainBundle] pathForResource:@"plane" ofType:@"obj"]; OpenGLWaveFrontObject *theObject = [[OpenGLWaveFrontObject alloc] initWithPath:path]; Vertex3D position; position.z = -8.0; position.y = 3.0; position.x = 2.0; theObject.currentPosition = position; self.plane = theObject; [theObject release]; } (void)drawView:(GLView*)view; { static GLfloat rotation = 0.0; glClear(GL_COLOR_BUFFER_BIT | GL_DEPTH_BUFFER_BIT); glLoadIdentity(); glColor4f(0.0, 0.5, 1.0, 1.0); // the coordinates of the rectangle are // myRect.x, myRect.y, myRect.width, myRect.height // Do I need to use a matrix to translate the currentPosition of the // 3-D model so it is drawn within myRect? //glOrthof(-160.0f, 160.0f, -240.0f, 240.0f, -1.0f, 1.0f); [plane drawSelf]; }

    Read the article

  • Postgresql count+sort performance

    - by invictus
    I have built a small inventory system using postgresql and psycopg2. Everything works great, except, when I want to create aggregated summaries/reports of the content, I get really bad performance due to count()'ing and sorting. The DB schema is as follows: CREATE TABLE hosts ( id SERIAL PRIMARY KEY, name VARCHAR(255) ); CREATE TABLE items ( id SERIAL PRIMARY KEY, description TEXT ); CREATE TABLE host_item ( id SERIAL PRIMARY KEY, host INTEGER REFERENCES hosts(id) ON DELETE CASCADE ON UPDATE CASCADE, item INTEGER REFERENCES items(id) ON DELETE CASCADE ON UPDATE CASCADE ); There are some other fields as well, but those are not relevant. I want to extract 2 different reports: - List of all hosts with the number of items per, ordered from highest to lowest count - List of all items with the number of hosts per, ordered from highest to lowest count I have used 2 queries for the purpose: Items with host count: SELECT i.id, i.description, COUNT(hi.id) AS count FROM items AS i LEFT JOIN host_item AS hi ON (i.id=hi.item) GROUP BY i.id ORDER BY count DESC LIMIT 10; Hosts with item count: SELECT h.id, h.name, COUNT(hi.id) AS count FROM hosts AS h LEFT JOIN host_item AS hi ON (h.id=hi.host) GROUP BY h.id ORDER BY count DESC LIMIT 10; Problem is: the queries runs for 5-6 seconds before returning any data. As this is a web based application, 6 seconds are just not acceptable. The database is heavily populated with approximately 50k hosts, 1000 items and 400 000 host/items relations, and will likely increase significantly when (or perhaps if) the application will be used. After playing around, I found that by removing the "ORDER BY count DESC" part, both queries would execute instantly without any delay whatsoever (less than 20ms to finish the queries). Is there any way I can optimize these queries so that I can get the result sorted without the delay? I was trying different indexes, but seeing as the count is computed it is possible to utilize an index for this. I have read that count()'ing in postgresql is slow, but its the sorting that are causing me problems... My current workaround is to run the queries above as an hourly job, putting the result into a new table with an index on the count column for quick lookup. I use Postgresql 9.2.

    Read the article

  • Methodology for a Rails app

    - by Aaron Vegh
    I'm undertaking a rather large conversion from a legacy database-driven Windows app to a Rails app. Because of the large number of forms and database tables involved, I want to make sure I've got the right methodology before getting too far. My chief concern is minimizing the amount of code I have to write. There are many models that interact together, and I want to make sure I'm using them correctly. Here's a simplified set of models: class Patient < ActiveRecord::Base has_many :PatientAddresses has_many :PatientFileStatuses end class PatientAddress < ActiveRecord::Base belongs_to :Patient end class PatientFileStatus < ActiveRecord::Base belongs_to :Patient end The controller determines if there's a Patient selected; everything else is based on that. In the view, I will be needing data from each of these models. But it seems like I have to write an instance variable in my controller for every attribute that I want to use. So I start writing code like this: @patient = Patient.find(session[:patient]) @patient_addresses = @patient.PatientAddresses @patient_file_statuses = @patient.PatientFileStatuses @enrollment_received_when = @patient_file_statuses[0].EnrollmentReceivedWhen @consent_received = @patient_file_statuses[0].ConsentReceived @consent_received_when = @patient_file_statuses[0].ConsentReceivedWhen The first three lines grab the Patient model and its relations. The next three lines are examples of my providing values to the view from one of those relations. The view has a combination of text fields and select fields to show the data above. For example: <%= select("patientfilestatus", "ConsentReceived", {"val1"="val1", "val2"="val2", "Written"="Written"}, :include_blank=true )% <%= calendar_date_select_tag "patient_file_statuses[EnrollmentReceivedWhen]", @enrollment_complete_when, :popup=:force % (BTW, the select tag isn't really working; I think I have to use collection_select?) My questions are: Do I have to manually declare the value of every instance variable in the controller, or can/should I do it within the view? What is the proper technique for displaying a select tag for data that's not the primary model? When I go to save changes to this form, will I have to manually pick out the attributes for each model and save them individually? Or is there a way to name the fields such that ActiveRecord does the right thing? Thanks in advance, Aaron.

    Read the article

  • cflock do not throw timeout for same url called in same browser

    - by Pritesh Patel
    I am trying lock block on page test.cfm and below is code written on page. <cfscript> writeOutput("Before lock at #now()#"); lock name="threadlock" timeout="3" type="exclusive" { writeOutput("<br/>started at #now()#"); thread action="sleep" duration="10000"; writeOutput("<br/>ended at #now()#"); } writeOutput("<br/>After lock at #now()#"); </cfscript> assuming my url for page is http://localhost.local/test.cfm and running it on browser in two different tabs. I was expecting one of the url will throw timeout error after 3 second since another url lock it atleast for 10 seconds due to thread sleep. Surprisingly I do not get any timeout error rather second page call run after 10 seconds as first call finish execution. But I am appending some url parameter (e.g. http://localhost.local/test.cfm?q=1) will throw error. Also I am calling same url in different browser then one of the call will throw timeout issue. Is lock based on session and url? Update Here is output for two different cases: Case 1: TAB1 Url: http://localhost.local/test/test.cfm Before lock at {ts '2013-10-18 09:21:35'} started at {ts '2013-10-18 09:21:35'} ended at {ts '2013-10-18 09:21:45'} After lock at {ts '2013-10-18 09:21:45'} TAB2 Url: http://localhost.local/test/test.cfm Before lock at {ts '2013-10-18 09:21:45'} started at {ts '2013-10-18 09:21:45'} ended at {ts '2013-10-18 09:21:55'} After lock at {ts '2013-10-18 09:21:55'} Case 2: TAB1 Url: http://localhost.local/test/test.cfm Before lock at {ts '2013-10-18 09:27:18'} started at {ts '2013-10-18 09:27:18'} ended at {ts '2013-10-18 09:27:28'} After lock at {ts '2013-10-18 09:27:28'} TAB2 Url: http://localhost.local/test/test.cfm? (Added ? at the end) Before lock at {ts '2013-10-18 09:27:20'} A timeout occurred while attempting to lock threadlock. The error occurred in C:/inetpub/wwwroot/test/test.cfm: line 13 11 : 12 : <cfoutput>Before lock at #now()#</cfoutput> 13 : <cflock name="threadlock" timeout="3" type="exclusive"> 14 : <cfoutput><br/>started at #now()#</cfoutput> 15 : <cfthread action="sleep" duration="10000"/> ... Result for case 2 as expected. For case 1, strange thing I just noticed is tab 2 output "Before lock at {ts '2013-10-18 09:21:45'} indicates that whole request start after 10 seconds (means after the complete execution of first tab) when I have fired it in second URL just after 2 seconds of first tabs.

    Read the article

  • jQuery function execute on Button Click and Enter/Return (key)

    - by Alvin Jones
    I'm trying to create a little search box that allows you to search Twitter based on the keyword you enter in the input field. While it's work, it only works if you press the Submit button. I would also like to be able to press the Enter or Return key to initiate the search. I've tried using the .sumbit function and wrapping my input around a form element with no success. Any insight would be greatly appreciate! Live example: http://tinyurl.com/84axyym <script src="http://ajax.googleapis.com/ajax/libs/jquery/1/jquery.min.js"></script> <script> $(document).ready(function(){ function(data) { $('#startSearch').click(function(){ $('#tweets .results').remove(); var searchTerm = 'http://search.twitter.com/search.json?q=' + $('#twitterSearch').val() + '&callback=?' $.getJSON(searchTerm, function(data) { $.each(data.results, function() { $('<div class="results"></div>') .hide() .append('<a class="userPicLink" href="http://twitter.com/' + this.from_user + '">' + '<img class="userImg" src="' + this.profile_image_url + '">' + '</a>') .append('<span class="userName">' + '<a href="http://twitter.com/' + this.from_user + '">' + this.from_user + '</span>') .append('<span class="userText">' + this.text + '</span>') .append('<time class="textTime">' + relTime(this.created_at) + '</time>') .appendTo('#tweets') .fadeIn(); }); }); </script> <body> <label id="searchLabel" for="twitterSearch">Search</label> <input type="search" list="searchSugg" id="twitterSearch" placeholder="css3 animation" required aria-required="true"> <input id="startSearch" type="submit"> <datalist id="searchSugg"> <option value="css3 mulitple backgrounds"> <option value="html5 video"> <option value="responsive web design"> <option value="twitter api"> </datalist> <div id="tweets"> </div> </body>

    Read the article

  • Opinions on collision detection objects with a moving scene

    - by Evan Teran
    So my question is simple, and I guess it boils down to how anal you want to be about collision detection. To keep things simple, lets assume we're talking about 2D sprites defined by a bounding box. In addition, let's assume that my sprite object has a function to detect collisions like this: S.collidesWith(other); Finally the scene is moving and "walls" in the scene can move, an object may not touch a wall. So a simple implementation might look like this (psuedo code): moveWalls(); moveSprite(); foreach(wall as w) { if(s.collidesWith(w)) { gameover(); } } The problem with this is that if the sprite and wall move towards each other, depending on the circumstances (such as diagonal moment). They may pass though each other (unlikely but could happen). So I may do this instead. moveWalls(); foreach(wall as w) { if(s.collidesWith(w)) { gameover(); } } moveSprite(); foreach(wall as w) { if(s.collidesWith(w)) { gameover(); } } This takes care of the passing through each other issue, but another rare issue comes up. If they are adjacent to each other (literally the next pixel) and both the wall and the sprite are moving left, then I will get an invalid collision since the wall moves, checks for collision (hit) then the sprite is moved. Which seems unfair. In addition, to that, the redundant collision detection feels very inefficient. I could give the player movement priority alleviating the first issue but it is still checking twice. moveSprite(); foreach(wall as w) { if(s.collidesWith(w)) { gameover(); } } moveWalls(); foreach(wall as w) { if(s.collidesWith(w)) { gameover(); } } Am I simply over thinking this issue, should this just be chalked up to "it'll happen rare enough that no one will care"? Certainly looking at old sprite based games, I often find situations where the collision detection has subtle flaws, but I figure by now we can do better :-P. What are people's thoughts?

    Read the article

  • Is "Systems Designer" the job title that best describes what I do? [closed]

    - by ivo-rossi
    After having worked as Java developer for almost 3 years in the same company that I currently work at, I moved to a new position associated with the development of the same application. I’m in this new position for more than 1 year now. My official job title is Systems Designer, but I’m not sure this is a title that expresses well what I do. So my question here is what would be the most appropriate job title for me? I see this question as important for my career development. After all, I should be able to explain in one word what I do. And it’s no longer “Java Developer”. Well, in more than one word, this is what I do: The business analysts gather requirements / business problems to be solved with the clients and then discuss these requirements with me. Given the requirements, I design the high level solutions to be implemented in our system (e.g. a new screen on the client application, modifications to existing reports, extension to the XML export format of some objects, etc). I base my decision on the current capabilities of the system, the overall impact that the solutions would have on the system and the estimated effort to implement them (as I was a developer of this same application for almost 3 years before I moved to this position, I’m confident in my estimates). The solutions are discussed iteratively with the business analysts until we agree that they are good. The outcome of this analysis is what we call the “requirements design” document, which is written by me, shared with clients for approval and then also with the team that is going to implement the solutions and test them. Note that there are a few problems that I need to find a solution for that are non-functional. If the users are unhappy with the performance of a certain tool, I will investigate what can be done to speed it up. I will do some research – often based in the Java code itself - to identify possibilities of optimizations. But in this new position I no longer code, the main outcome of my work is really the “requirements design”. Is “Systems Designer” really the most appropriate job title?

    Read the article

  • HTTP Post requests using HttpClient take 2 seconds, why?

    - by pableu
    Update: You might better hold off this for a bit, I just noticed I could be my fault after all. Working on this all afternoon, and then I find a flaw ten minutes after posting here, ts. Hi, I'am currently coding an android app that submits stuff in the background using HTTP Post and AsyncTask. I use the org.apache.http.client Package for this. I based my code on this example. Basically, my code looks like this: public void postData() { // Create a new HttpClient and Post Header HttpClient httpclient = new DefaultHttpClient(); HttpPost httppost = new HttpPost("http://192.168.1.137:8880/form"); try { List<NameValuePair> nameValuePairs = new ArrayList<NameValuePair>(2); nameValuePairs.add(new BasicNameValuePair("id", "12345")); nameValuePairs.add(new BasicNameValuePair("stringdata", "AndDev is Cool!")); httppost.setEntity(new UrlEncodedFormEntity(nameValuePairs)); // Execute HTTP Post Request HttpResponse response = httpclient.execute(httppost); } catch (ClientProtocolException e) { Log.e(TAG,e.toString()); } catch (IOException e) { Log.e(TAG,e.toString()); } } The problem is that the httpclient.execute(..) line takes around 1.5 to 3 seconds, and I do not understand why. Just requesting a page with HTTP Get takes around 80 ms or so, so the problem doesn't seem to be the network latency itself. The problem doesn't seem to be on the server side either, I have also tried POSTing data to http://www.disney.com/ with similarly slow results. And Firebug shows 1 ms response time when POSTing data to my server locally. This happens on the Emulator and with my Nexus One (both with Android 2.2). If you want to look at the complete code, I've put it on GitHub. It's just a dummy program to do HTTP Post in the background using AsyncTask on the push of a button. It's my first Android app, and my first java code for a long time. And incidentially, also my first question on Stackoverflow ;-) Any ideas why httpclient.execute(httppost) takes so long?

    Read the article

  • NSSortDescriptor for NSFetchRequestController causes crash when value of sorted attribute is changed

    - by AJ
    I have an Core Data Entity with a number of attributes, which include amount(float), categoryTotal(float) and category(string) The initial ViewController uses a FethchedResultsController to retrieve the entities, and sorts them based on the category and then the categoryTotal. No problems so far. NSManagedObjectContext *moc = [self managedObjectContext]; NSEntityDescription *entityDescription = [NSEntityDescription entityForName:@"Transaction" inManagedObjectContext:moc]; NSFetchRequest *request = [[[NSFetchRequest alloc] init] autorelease]; [request setEntity:entityDescription]; NSPredicate *predicate = [NSPredicate predicateWithFormat:@"(dateStamp >= %@) AND (dateStamp =< %@)", startDate, endDate]; [request setPredicate:predicate]; NSSortDescriptor *sortByCategory = [[NSSortDescriptor alloc] initWithKey:@"category" ascending:sortOrder]; NSSortDescriptor *sortByTotals = [[NSSortDescriptor alloc] initWithKey:@"categoryTotal" ascending:sortOrder]; NSArray *sortDescriptors = [[NSArray alloc] initWithObjects:sortByTotals, sortByCategory, nil]; [request setSortDescriptors:sortDescriptors]; NSFetchedResultsController *aFetchedResultsController = [[NSFetchedResultsController alloc] initWithFetchRequest:request managedObjectContext:managedObjectContext sectionNameKeyPath:@"category" cacheName:nil]; aFetchedResultsController.delegate = self; self.fetchedResultsController = aFetchedResultsController; On selecting a row (tableView:didSelectRowAtIndexPath), another view controller is loaded that allows editing of the amount field for the selected entity. Before returning to the first view, categoryTotal is updated by the new ‘amount’. The problem comes when returning to the first view controller, the app bombs with *Serious application error. Exception was caught during Core Data change processing: Invalid update: invalid number of rows in section 0. The number of rows contained in an existing section after the update (1) must be equal to the number of rows contained in that section before the update (1), plus or minus the number of rows inserted or deleted from that section (0 inserted, 1 deleted). with userInfo (null) Program received signal: “EXC_BAD_ACCESS”.* This seems to be courtesy of NSSortDescriptor *sortByTotals = [[NSSortDescriptor alloc] initWithKey:@"categoryTotal" ascending:sortOrder]; If I remove this everything works as expected, but obviously without the sorting I want. I'm guessing this is to do with the sorting order changing due to categoryTotal changing (deletion / insertion) but can't find away fix this. I've verified that values are being modified correctly in the second view, so it appears down to the fetchedResultsController being confused. If the categoryAmount is changed to one that does not change the sort order, then no error is generated I'm not physically changing (ie deleting) the number of items the fetchedResultsController is returning ... the only other issue I can find that seem to generate this error Any ideas would be most welcome Thanks, AJ

    Read the article

  • deallocated memory in tableview: message sent to deallocated instance

    - by Kirn
    I tried looking up other issues but couldn't find anything to match so here goes: I'm trying to display text in the table view so I use this bit of code: // StockData is an object I created and it pulls information from Yahoo APIs based on // a stock ticker stored in NSString *heading NSArray* tickerValues = [heading componentsSeparatedByString:@" "]; StockData *chosenStock = [[StockData alloc] initWithContents:[tickerValues objectAtIndex:0]]; [chosenStock getData]; // Set up the cell... NSDictionary *tempDict = [chosenStock values]; NSArray *tempArr = [tempDict allValues]; cell.textLabel.text = [tempArr objectAtIndex:indexPath.row]; return cell; This is all under cellForRowAtIndexPath When I try to release the chosenStock object though I get this error: [CFDictionary release]: message sent to deallocated instance 0x434d3d0 Ive tried using NSZombieEnabled and Build and Analyze to detect problems but no luck thus far. Ive even gone so far as to comment bits and pieces of the code with NSLog but no luck. I'll post the code for StockData below this. As far as I can figure something is getting deallocated before I do the release but I'm not sure how. The only place I've got release in my code is under dealloc method call. Here's the StockData code: // StockData contains all stock information pulled in through Yahoo! to be displayed @implementation StockData @synthesize ticker, values; - (id) initWithContents: (NSString *)newName { if(self = [super init]){ ticker = newName; } return self; } - (void) getData { NSURL *url = [NSURL URLWithString: [NSString stringWithFormat:@"http://download.finance.yahoo.com/d/quotes.csv?s=%@&f=%@&e=.csv", ticker, @"chgvj1"]]; NSError *error; NSURLResponse *response; NSURLRequest *request = [NSURLRequest requestWithURL:url]; NSData *stockData = [NSURLConnection sendSynchronousRequest:request returningResponse:&response error:&error]; if(stockData) { NSString *tempStr = [[NSString alloc] initWithData:stockData encoding:NSASCIIStringEncoding]; NSArray *receivedValuesArr = [tempStr componentsSeparatedByString:@","]; [tempStr release]; values = [NSDictionary dictionaryWithObjects:receivedValuesArr forKeys:[@"change, high, low, volume, market" componentsSeparatedByString:@", "]]; } else { NSLog(@"Connection failed: %@", error); } } - (void)dealloc { [ticker release]; [values release]; [super dealloc]; NSLog(@"Release took place fine"); } @end

    Read the article

  • Stepping into Ruby Meta-Programming: Generating proxy methods for multiple internal methods

    - by mstksg
    Hi all; I've multiply heard Ruby touted for its super spectacular meta-programming capabilities, and I was wondering if anyone could help me get started with this problem. I have a class that works as an "archive" of sorts, with internal methods that process and output data based on an input. However, the items in the archive in the class itself are represented and processed with integers, for performance purposes. The actual items outside of the archive are known by their string representation, which is simply number_representation.to_s(36). Because of this, I have hooked up each internal method with a "proxy method" that converts the input into the integer form that the archive recognizes, runs the internal method, and converts the output (either a single other item, or a collection of them) back into strings. The naming convention is this: internal methods are represented by _method_name; their corresponding proxy method is represented by method_name, with no leading underscore. For example: class Archive ## PROXY METHODS ## ## input: string representation of id's ## output: string representation of id's def do_something_with id result = _do_something_with id.to_i(36) return nil if result == nil return result.to_s(36) end def do_something_with_pair id_1,id_2 result = _do_something_with_pair id_1.to_i(36), id_2.to_i(36) return nil if result == nil return result.to_s(36) end def do_something_with_these ids result = _do_something_with_these ids.map { |n| n.to_i(36) } return nil if result == nil return result.to_s(36) end def get_many_from id result = _get_many_from id return nil if result == nil # no sparse arrays returned return result.map { |n| n.to_s(36) } end ## INTERNAL METHODS ## ## input: integer representation of id's ## output: integer representation of id's def _do_something_with id # does something with one integer-represented id, # returning an id represented as an integer end def do_something_with_pair id_1,id_2 # does something with two integer-represented id's, # returning an id represented as an integer end def _do_something_with_these ids # does something with multiple integer ids, # returning an id represented as an integer end def _get_many_from id # does something with one integer-represented id, # returns a collection of id's represented as integers end end There are a couple of reasons why I can't just convert them if id.class == String at the beginning of the internal methods: These internal methods are somewhat computationally-intensive recursive functions, and I don't want the overhead of checking multiple times at every step There is no way, without adding an extra parameter, to tell whether or not to re-convert at the end I want to think of this as an exercise in understanding ruby meta-programming Does anyone have any ideas? edit The solution I'd like would preferably be able to take an array of method names @@PROXY_METHODS = [:do_something_with, :do_something_with_pair, :do_something_with_these, :get_many_from] iterate through them, and in each iteration, put out the proxy method. I'm not sure what would be done with the arguments, but is there a way to test for arguments of a method? If not, then simple duck typing/analogous concept would do as well.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • OpenGL, how to set a monochrome texture to a colored shape?

    - by Santiago
    I'm developing on Android with OpenGL ES, I draw some cubes and I change its colors with glColor4f. Now, what I want is to give a more realistic effect on the cubes, so I create a monochromatic 8bit depth, 64x64 pixel size PNG file. I loaded on a texture, and here is my problem, witch is the way to combine the color and the texture to get a colorized and textured cubes onto the screen? I'm not an expert on OpenGL, I tried this: On create: public void asignBitmap(GL10 gl, Bitmap bitmap) { int[] textures = new int[1]; gl.glGenTextures(1, textures, 0); mTexture = textures[0]; gl.glBindTexture(GL10.GL_TEXTURE_2D, mTexture); gl.glTexParameterf(GL10.GL_TEXTURE_2D, GL10.GL_TEXTURE_MIN_FILTER, GL10.GL_NEAREST); gl.glTexParameterf(GL10.GL_TEXTURE_2D, GL10.GL_TEXTURE_MAG_FILTER, GL10.GL_LINEAR); gl.glTexParameterf(GL10.GL_TEXTURE_2D, GL10.GL_TEXTURE_WRAP_S, GL10.GL_CLAMP_TO_EDGE); gl.glTexParameterf(GL10.GL_TEXTURE_2D, GL10.GL_TEXTURE_WRAP_T, GL10.GL_CLAMP_TO_EDGE); gl.glTexEnvf(GL10.GL_TEXTURE_ENV, GL10.GL_TEXTURE_ENV_MODE, GL10.GL_REPLACE); GLUtils.texImage2D(GL10.GL_TEXTURE_2D, 0, GL10.GL_ALPHA, bitmap, 0); ByteBuffer tbb = ByteBuffer.allocateDirect(texCoords.length * 4); tbb.order(ByteOrder.nativeOrder()); mTexBuffer = tbb.asFloatBuffer(); for (int i = 0; i < 48; i++) mTexBuffer.put(texCoords[i]); mTexBuffer.position(0); } And OnDraw: public void draw(GL10 gl, int alphawires) { gl.glColor4f(1.0f, 0.0f, 0.0f, 0.5f); //RED gl.glBindTexture(GL10.GL_TEXTURE_2D, mTexture); gl.glBlendFunc(GL10.GL_SRC_ALPHA, GL10.GL_ONE_MINUS_SRC_ALPHA); gl.glEnable(GL10.GL_TEXTURE_2D); gl.glEnable(GL10.GL_BLEND); gl.glEnableClientState(GL10.GL_TEXTURE_COORD_ARRAY); gl.glTexCoordPointer(2, GL10.GL_FLOAT, 0, mTexBuffer); //Set the face rotation gl.glFrontFace(GL10.GL_CW); //Point to our buffers gl.glVertexPointer(3, GL10.GL_FLOAT, 0, vertexBuffer); //Enable the vertex and color state gl.glEnableClientState(GL10.GL_VERTEX_ARRAY); //Draw the vertices as triangles, based on the Index Buffer information gl.glDrawElements(GL10.GL_TRIANGLES, 36, GL10.GL_UNSIGNED_BYTE, indexBuffer); //Disable the client state before leaving gl.glDisableClientState(GL10.GL_VERTEX_ARRAY); gl.glDisableClientState(GL10.GL_TEXTURE_COORD_ARRAY); gl.glDisable(GL10.GL_BLEND); gl.glDisable(GL10.GL_TEXTURE_2D); } I'm even not sure if I have to use a blend option, because I don't need transparency, but is a plus :)

    Read the article

  • Where are the function literals in c++?

    - by academicRobot
    First of all, maybe literals is not the right term for this concept, but its the closest I could think of (not literals in the sense of functions as first class citizens). The idea is that when you make a conventional function call, it compiles to something like this: callq <immediate address> But if you make a function call using a function pointer, it compiles to something like this: mov <memory location>,%rax callq *%rax Which is all well and good. However, what if I'm writing a template library that requires a callback of some sort with a specified argument list and the user of the library is expected to know what function they want to call at compile time? Then I would like to write my template to accept a function literal as a template parameter. So, similar to template <int int_literal> struct my_template {...};` I'd like to write template <func_literal_t func_literal> struct my_template {...}; and have calls to func_literal within my_template compile to callq <immediate address>. Is there a facility in C++ for this, or a work around to achieve the same effect? If not, why not (e.g. some cataclysmic side effects)? How about C++0x or another language? Solutions that are not portable are fine. Solutions that include the use of member function pointers would be ideal. I'm not particularly interested in being told "You are a <socially unacceptable term for a person of low IQ>, just use function pointers/functors." This is a curiosity based question, and it seems that it might be useful in some (albeit limited) applications. It seems like this should be possible since function names are just placeholders for a (relative) memory address, so why not allow more liberal use (e.g. aliasing) of this placeholder. p.s. I use function pointers and functions objects all the the time and they are great. But this post got me thinking about the don't pay for what you don't use principle in relation to function calls, and it seems like forcing the use of function pointers or similar facility when the function is known at compile time is a violation of this principle, though a small one.

    Read the article

  • Getting key/value pairs from plist-style xml using simplexml in php

    - by Anthony
    Here is an example bit from the xml file: <array> <dict> <key>Name</key> <string>Joe Smith</string> <key>Type</key> <string>Profile</string> <key>Role</key> <string>User</string> <key>Some Number</key> <integer>1</integer> <key>Some Boolean</key> <true/> </dict> </array> I have two separate goals. The first is to extract an array from the dictnode that would look like: [Name] => Joe Smith [Type] => Profile [Role] => User [Some Number] => 1 [Some Boolean] => true It's not crucial that the boolean be included, so if that adds too much complexity, I'd rather just know how to deal with the others for now. The second goal is to be able to select the value node (<string>, <integer>,etc) so that I can change the value. I would need to select it based on the text value of the preceding key element. I think the following XPath should work: //key[.=$keyname]/following-sibling[1] But I'm not sure. Basically, this whole system that Apple uses seems logical, but totally contrary to the XML is supposed to work. If I ran the world, the original XML would look more like: <dict type="array"> <value key="Name" type="string">Joe Smith</value> <value key="Type" type="string">Profile</value> <value key="Role type="string">User</value> <value key="Some Number" type="integer">1</value> <value key="Some Boolean" type="boolean">true</value> </dict> But since it is fairly logical, I am wondering if I'm missing some obvious way of handling it.

    Read the article

  • Converting C source to C++

    - by Barry Kelly
    How would you go about converting a reasonably large (300K), fairly mature C codebase to C++? The kind of C I have in mind is split into files roughly corresponding to modules (i.e. less granular than a typical OO class-based decomposition), using internal linkage in lieu private functions and data, and external linkage for public functions and data. Global variables are used extensively for communication between the modules. There is a very extensive integration test suite available, but no unit (i.e. module) level tests. I have in mind a general strategy: Compile everything in C++'s C subset and get that working. Convert modules into huge classes, so that all the cross-references are scoped by a class name, but leaving all functions and data as static members, and get that working. Convert huge classes into instances with appropriate constructors and initialized cross-references; replace static member accesses with indirect accesses as appropriate; and get that working. Now, approach the project as an ill-factored OO application, and write unit tests where dependencies are tractable, and decompose into separate classes where they are not; the goal here would be to move from one working program to another at each transformation. Obviously, this would be quite a bit of work. Are there any case studies / war stories out there on this kind of translation? Alternative strategies? Other useful advice? Note 1: the program is a compiler, and probably millions of other programs rely on its behaviour not changing, so wholesale rewriting is pretty much not an option. Note 2: the source is nearly 20 years old, and has perhaps 30% code churn (lines modified + added / previous total lines) per year. It is heavily maintained and extended, in other words. Thus, one of the goals would be to increase mantainability. [For the sake of the question, assume that translation into C++ is mandatory, and that leaving it in C is not an option. The point of adding this condition is to weed out the "leave it in C" answers.]

    Read the article

  • How to implement a caching model without violating MVC pattern?

    - by RPM1984
    Hi Guys, I have an ASP.NET MVC 3 (Razor) Web Application, with a particular page which is highly database intensive, and user experience is of the upmost priority. Thus, i am introducing caching on this particular page. I'm trying to figure out a way to implement this caching pattern whilst keeping my controller thin, like it currently is without caching: public PartialViewResult GetLocationStuff(SearchPreferences searchPreferences) { var results = _locationService.FindStuffByCriteria(searchPreferences); return PartialView("SearchResults", results); } As you can see, the controller is very thin, as it should be. It doesn't care about how/where it is getting it's info from - that is the job of the service. A couple of notes on the flow of control: Controllers get DI'ed a particular Service, depending on it's area. In this example, this controller get's a LocationService Services call through to an IQueryable<T> Repository and materialize results into T or ICollection<T>. How i want to implement caching: I can't use Output Caching - for a few reasons. First of all, this action method is invoked from the client-side (jQuery/AJAX), via [HttpPost], which according to HTTP standards should not be cached as a request. Secondly, i don't want to cache purely based on the HTTP request arguments - the cache logic is a lot more complicated than that - there is actually two-level caching going on. As i hint to above, i need to use regular data-caching, e.g Cache["somekey"] = someObj;. I don't want to implement a generic caching mechanism where all calls via the service go through the cache first - i only want caching on this particular action method. First thought's would tell me to create another service (which inherits LocationService), and provide the caching workflow there (check cache first, if not there call db, add to cache, return result). That has two problems: The services are basic Class Libraries - no references to anything extra. I would need to add a reference to System.Web here. I would have to access the HTTP Context outside of the web application, which is considered bad practice, not only for testability, but in general - right? I also thought about using the Models folder in the Web Application (which i currently use only for ViewModels), but having a cache service in a models folder just doesn't sound right. So - any ideas? Is there a MVC-specific thing (like Action Filter's, for example) i can use here? General advice/tips would be greatly appreciated.

    Read the article

  • How to Fix my jQuery code in IE?? Works in Firefox..

    - by scott jarvis
    I am using jQuery to show/hide a div container (#pluginOptionsContainer), and load a page (./plugin_options.php) inside it with the required POST vars sent. What POST data is sent is based on the value of a select list (#pluginDD) and the click of a button (#pluginOptionsBtn)... It works fine in Firefox, but doesn't work in IE.. The '$("#pluginOptionsContainer").load()' request never seems to finish in IE - I only see the loading message forever... bind(), empty() and append() all seem to work fine in IE.. But not load().. Here is my code: // wait for the DOM to be loaded $(document).ready(function() { // hide the plugin options $('#pluginOptionsContainer').hide(); // This is the hack for IE if ($.browser.msie) { $("#pluginDD").click(function() { this.blur(); this.focus(); }); } // set the main function $(function() { // the button shows hides the plugin options page (and its container) $("#pluginOptionsBtn") .click(function() { // show the container of the plugin options page $('#pluginOptionsContainer').empty().append('<div style="text-align:center;width:99%;">Loading...</div>'); $('#pluginOptionsContainer').toggle(); }); // set the loading message if user changes selection with either the dropdown or button $("#pluginDD,#pluginOptionsBtn").bind('change', function() { $('#pluginOptionsContainer').empty().append('<div style="text-align:center;width:99%;">Loading...</div>'); }); // then update the page when the plugin is changed when EITHER the plugin button or dropdown or clicked or changed $("#pluginDD,#pluginOptionsBtn").bind('change click', function() { // set form fields as vars in js var pid = <?=$pid;?>; var cid = <?=$contentid;?>; var pDD = $("#pluginDD").val(); // add post vars (must use JSON) to be sent into the js var 'dataString' var dataString = {plugin_options: true, pageid: pid, contentid: cid, pluginDD: pDD }; // include the plugin option page inside the container, with the required values already added into the query string $("#pluginOptionsContainer").load("/admin/inc/edit/content/plugin_options.php#pluginTop", dataString); // add this to stop page refresh return false; }); // end submit function }); // end main function }); // on DOM load Any help would be GREATLY appreciated! I hate IE!

    Read the article

  • jQuery UI dialog + WebKit + HTML response with script

    - by Anthony Koval'
    Once again I am faced with a great problem! :) So, here is the stuff: on the client side, I have a link. By clicking on it, jQuery makes a request to the server, gets response as HTML content, then popups UI dialog with that content. Here is the code of the request-function: function preview(){ $.ajax({ url: "/api/builder/", type: "post", //dataType: "html", data: {"script_tpl": $("#widget_code").text(), "widgets": $.toJSON(mwidgets), "widx": "0"}, success: function(data){ //console.log(data) $("#previewArea").dialog({ bgiframe: true, autoOpen: false, height: 600, width: 600, modal: true, buttons: { "Cancel": function() { $(this).dialog('destroy'); } } }); //console.log(data.toString()); $('#previewArea').attr("innerHTML", data.toString()); $("#previewArea").dialog("open"); }, error: function(){ console.log("shit happens"); } }) } The response (data) is: <html> <head> <meta http-equiv="Content-Type" content="text/html; charset=UTF-8"> <script type="text/javascript">var smakly_widget_sid = 0 ,widgets = [{"cols": "2","rows": "2","div_id": "smakly_widget","wid": "0","smakly_style": "small_image",}, ] </script> <script type="text/javascript" src="/media/js/smak/smakme.js"></script> </head> <body> preview <div id="smakly_widget" style="width:560px;height:550px"> </div> </body> </html> As you see, there is a script to load: smakme.js, somehow it doesn't execute in WebKit-based browsers (I tried in Safari and Chrome), but in Firefox, Internet Explorer and Opera it works as expected! Here is that script: String.prototype.format = function(){ var pattern = /\{\d+\}/g; var args = arguments; return this.replace(pattern, function(capture){ return args[capture.match(/\d+/)]; }); } var turl = "/widget" var widgetCtrl = new(function(){ this.render_widget = function (w, content){ $("#" + w.div_id).append(content); } this.build_widgets = function(){ for (var widx in widgets){ var w = widgets[widx], iurl = '{0}?sid={1}&wid={2}&w={3}&h={4}&referer=http://ya.ru&thrash={5}'.format( turl, smakly_widget_sid, w.wid, w.cols, w.rows, Math.floor(Math.random()*1000).toString()), content = $('<iframe src="{0}" width="100%" height="100%"></iframe>'.format(iurl)); this.render_widget(w, content); } } }) $(document).ready(function(){ widgetCtrl.build_widgets(); }) Is that some security issue, or anything else?

    Read the article

  • Patterns: Local Singleton vs. Global Singleton?

    - by Mike Rosenblum
    There is a pattern that I use from time to time, but I'm not quite sure what it is called. I was hoping that the SO community could help me out. The pattern is pretty simple, and consists of two parts: A singleton factory, which creates objects based on the arguments passed to the factory method. Objects created by the factory. So far this is just a standard "singleton" pattern or "factory pattern". The issue that I'm asking about, however, is that the singleton factory in this case maintains a set of references to every object that it ever creates, held within a dictionary. These references can sometimes be strong references and sometimes weak references, but it can always reference any object that it has ever created. When receiving a request for a "new" object, the factory first searches the dictionary to see if an object with the required arguments already exits. If it does, it returns that object, if not, it returns a new object and also stores a reference to the new object within the dictionary. This pattern prevents having duplicative objects representing the same underlying "thing". This is useful where the created objects are relatively expensive. It can also be useful where these objects perform event handling or messaging - having one object per item being represented can prevent multiple messages/events for a single underlying source. There are probably other reasons to use this pattern, but this is where I've found this useful. My question is: what to call this? In a sense, each object is a singleton, at least with respect to the data it contains. Each is unique. But there are multiple instances of this class, however, so it's not at all a true singleton. In my own personal terminology, I tend to call the factory method a "global singleton". I then call the created objects "local singletons". I sometimes also say that the created objects have "reference equality", meaning that if two variables reference the same data (the same underlying item) then the reference they each hold must be to the same exact object, hence "reference equality". But these are my own invented terms, and I am not sure that they are good ones. Is there standard terminology for this concept? And if not, could some naming suggestions be made? Thanks in advance...

    Read the article

  • appendTo() inside $.each in jquery seems to cause flicker....

    - by Pandiya Chendur
    appendTo() causes flicker when it is inside $.each.... $.each(jsob.Table, function(i, employee) { $('<div class="resultsdiv"><br /><span class="resultName">' + employee.Emp_Name + '</span><span class="resultfields" style="padding-left:100px;">Category&nbsp;:</span>&nbsp;<span class="resultfieldvalues">' + employee.Desig_Name + '</span><br /><br /><span id="SalaryBasis" class="resultfields">Salary Basis&nbsp;:</span>&nbsp;<span class="resultfieldvalues">' + employee.SalaryBasis + '</span><span class="resultfields" style="padding-left:25px;">Salary&nbsp;:</span>&nbsp;<span class="resultfieldvalues">' + employee.FixedSalary + '</span><span style="font-size:110%;font-weight:bolder;padding-left:25px;">Address&nbsp;:</span>&nbsp;<span class="resultfieldvalues">' + employee.Address + '</span></div>').appendTo('#ResultsDiv'); }); Right now i am appending every new div to #ResultsDiv inside$.each is it good/bad to do so... If it is bad What can be done to make my divs appendTo() after the loop so that i it wont flicker.... EDIT:(based on answer) var divs = ''; $.each(jsob.Table, function(i, employee) { divs += '<div class="resultsdiv"><br /><span class="resultName">' + employee.Emp_Name + '</span><span class="resultfields" style="padding-left:100px;">Category&nbsp;:</span>&nbsp;<span class="resultfieldvalues">' + employee.Desig_Name + '</span><br /><br /><span id="SalaryBasis" class="resultfields">Salary Basis&nbsp;:</span>&nbsp;<span class="resultfieldvalues">' + employee.SalaryBasis + '</span><span class="resultfields" style="padding-left:25px;">Salary&nbsp;:</span>&nbsp;<span class="resultfieldvalues">' + employee.FixedSalary + '</span><span style="font-size:110%;font-weight:bolder;padding-left:25px;">Address&nbsp;:</span>&nbsp;<span class="resultfieldvalues">' + employee.Address + '</span></div>'; }); $("#ResultsDiv").append(divs); But that too doesn't stop the flicker...

    Read the article

< Previous Page | 979 980 981 982 983 984 985 986 987 988 989 990  | Next Page >