Monthly Archives

Articles indexed in March 2010

Page 332/2613 | < Previous Page | 328 329 330 331 332 333 334 335 336 337 338 339  | Next Page >

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Full outer join in django

    - by Ber
    How can I create a query for a full outer join across a M2M relationchip using the django QuerySet API? It that is not supported, some hint about creating my own manager to do this would be welcome. Edited to add: @S.Lott: Thanks for the enlightenment. The need for the OUTER JOIN comes from the application. It has to generate a report showing the data entered, even if it still incomplete. I was not aware of the fact that the result would be a new class/model. Your hints will help me quite a bit.

    Read the article

  • GridView's NewValues and OldValues empty in the OnRowUpdating event.

    - by Abe Miessler
    I have the GridView below. I am binding to a custom datasource in the code behind. It gets into the "OnRowUpdating" event just fine, but there are no NewValues or OldValues. Any suggestions as to how I can get these values? <asp:GridView ID="gv_Personnel" runat="server" OnRowDataBound="gv_Personnel_DataBind" OnRowCancelingEdit="gv_Personnel_CancelEdit" OnRowEditing="gv_Personnel_EditRow" OnRowUpdating="gv_Personnel_UpdateRow" AutoGenerateColumns="false" ShowFooter="true" DataKeyNames="BudgetLineID" AutoGenerateEditButton="true" AutoGenerateDeleteButton="true" > <Columns> <asp:BoundField HeaderText="Level of Staff" DataField="LineDescription" /> <%--<asp:BoundField HeaderText="Hrs/Units requested" DataField="NumberOfUnits" />--%> <asp:TemplateField HeaderText="Hrs/Units requested"> <ItemTemplate> <%# Eval("NumberOfUnits")%> </ItemTemplate> <EditItemTemplate> <asp:TextBox ID="tb_NumUnits" runat="server" Text='<%# Bind("NumberOfUnits")%>' /> </EditItemTemplate> </asp:TemplateField> <asp:BoundField HeaderText="Hrs/Units of Applicant Cost Share" DataField="" NullDisplayText="0" /> <asp:BoundField HeaderText="Hrs/Units of Partner Cost Share" DataField="" NullDisplayText="0" /> <asp:BoundField FooterStyle-Font-Bold="true" FooterText="TOTAL PERSONNEL SERVICES:" HeaderText="Rate" DataFormatString="{0:C}" DataField="UnitPrice" /> <asp:TemplateField HeaderText="Amount Requested" ItemStyle-HorizontalAlign="Right" FooterStyle-HorizontalAlign="Right" FooterStyle-BorderWidth="2" FooterStyle-Font-Bold="true"/> <asp:TemplateField HeaderText="Applicant Cost Share" ItemStyle-HorizontalAlign="Right" FooterStyle-HorizontalAlign="Right" FooterStyle-BorderWidth="2" FooterStyle-Font-Bold="true"/> <asp:TemplateField HeaderText="Partner Cost Share" ItemStyle-HorizontalAlign="Right" FooterStyle-HorizontalAlign="Right" FooterStyle-BorderWidth="2" FooterStyle-Font-Bold="true"/> <asp:TemplateField HeaderText="Total Projet Cost" ItemStyle-HorizontalAlign="Right" FooterStyle-HorizontalAlign="Right" FooterStyle-BorderWidth="2" FooterStyle-Font-Bold="true"/> </Columns> </asp:GridView>

    Read the article

  • How to Force a Method Call on a Property or Method of an Object in PHP?

    - by Noah Goodrich
    In my View (using Zend_View so the the view is an object), I make calls to object properties and methods to populate the template like so: <?= $this->user->name ?> // Outputs John Doe <br/> <?= $this->user->getCompany()->name ?> // Outputs Acme <br/> <?= $this->method() ?> // Outputs foobar If I make it so that all property requests (like for 'user') go through __get() is there any way that I can catch the subsequent calls so that I can force a method call on the final outputted value? For example so that I could do automatic escaping of output. As I see it right now, I either have to escape the input as it goes into the database or use compiled templates like Smarty does, or switch to assigning every variable to the View object so that it has direct control to force escaping before outputting the data.

    Read the article

  • Django - How to do CSFR on public pages? Or, better yet, how should it be used period?

    - by orokusaki
    After reading this: http://docs.djangoproject.com/en/dev/ref/contrib/csrf/#how-to-use-it I came to the conclusion that it is not valid to use this except for when you trust the person who is using the page which enlists it. Is this correct? I guess I don't really understand when it's safe to use this because of this statement: This should not be done for POST forms that target external URLs, since that would cause the CSRF token to be leaked, leading to a vulnerability. The reason it's confusing is that to me an "external URL" would be on that isn't part of my domain (ie, I own www.example.com and put a form that posts to www.spamfoo.com. This obviously can't be the case since people wouldn't use Django for generating forms that post to other people's websites, but how could it be true that you can't use CSRF protection on public forms (like a login form)?

    Read the article

  • How GZipped contents are transfered on the web?

    - by PJ
    I heard that static contents like CSS and JavaScript can be better delivered in GZip format. And Content Developer Network (CDN) always does so. However I don't understand how the format works. First when I tried making a gzipped file via command-line. The file extension is .gz. This is different from .css and .js. How do browsers recognize which file is gzipped or not. Second, how browsers "decompress" files? I dragged my index.html.gz onto my browsers. But no one worked. How do such gzipped work in the real world? What do I need to do if I want to serve CSS/JavaScript using Gzipped format.

    Read the article

  • Cisco PIX to Juniper Netscreen Policy-based VPN fails Phase 2 Proposal

    - by elint
    I've followed the instructions to configure a VPN between a netscreen device and a Cisco PIX as directed by Cisco's [netscreen to PIX VPN]http://www.cisco.com/en/US/tech/tk583/tk372/technologies_configuration_example09186a00801c4445.shtml article. The only differences are that I'm running PIX 6.3(5) and Juniper Netscreen 6.1.0r2.0 (Firewall+VPN). I followed both configurations exactly, and when I try to connect, the Juniper returns with: 2010-02-21 12:54:28 information IKE: Removed Phase 2 SAs after receiving a notification message. 2010-02-21 12:54:28 information IKE pix_public_IP: Received a notification message for DOI 1 14 NO-PROPOSAL-CHOSEN. 2010-02-21 12:54:28 information IKE pix_public_IP Phase 2: Initiated negotiations. On the Netscreen, I've created a Phase 2 Proposal called ToCorpOffice using DH Group#2, 3DES-CBC, and SHA-1, and when configuring the AutoKey IKE, I chose ToCorpOffice and removed all other transforms. I believe I've configured the same on the PIX with: sysopt connection permit-ipsec crypto ipsec transform-set mytrans esp-3des esp-sha-hmac crypto map mymap 10 ipsec-isakmp crypto map mymap 10 match address nonat crypto map mymap 10 set pfs group2 crypto map mymap 10 set peer netscreen_public_ip crypto map mymap 10 set transform-set mytrans crypto map mymap interface outside Saved that and rebooted, so here's the cryptomap info: PIX-FW1# show crypto map Crypto Map: "mymap" interfaces: { outside } Crypto Map "mymap" 10 ipsec-isakmp Peer = netscreen_public_ip access-list nonat; 1 elements access-list nonat line 1 permit ip 192.168.1.0 255.255.255.0 192.168.2.0 255.255.255.0 (hitcnt=0) Current peer: netscreen_public_ip Security association lifetime: 4608000 kilobytes/28800 seconds PFS (Y/N): Y DH group: group2 Transform sets={ mytrans, } PIX-FW1# Any idea why I'm getting a NO-PROPOSAL-CHOSEN error?

    Read the article

  • SQL Server Instancing: Should I use multiple instances or databases?

    - by Spence
    I have a reasonable server connected to a SAN which will be running SQL servers for multiples of the same application. There are no security issues with one application being able to read anothers database. We are unfortunately in 32 bit windows as well. I'm of the opinion that it would be better to use one instance on the server, enable AWE so that the server instance can use almost all of the ram we have and then run each of the databases in the one instance. However I've been overruled by the gods of the IT department on this one, so I'm really curious to hear your thoughts on this. From a performance point of view, am I incorrect that one instance of SQL is better than two? I know that we could do some failover stuff, but doing that on one blade only seems like overkill to me..

    Read the article

  • Do I need to release a copied NSObjects - Objective-c

    - by ncohen
    Hi everyone, I was wondering if I need to release a copied NSObject? For example, I create only one dictionary that I copy into an array: Code: for (int num = 0; num < [object count]; num++) { [dictionary setObject:[object objectAtIndex:num] forKey:@"x"]; [array addObject:[dictionary copy]]; } Do I have to release the dictionary? If yes, when? Thanks

    Read the article

  • Binding a list belonging to another object in a custom model binder in ASP.NET MVC

    - by Dan
    I realize something like this has been asked, but this may be a little different Below is my Event object: Event : IEvent public int Id public string Title public List<EventContact> Contacts And EventContact: EventContact public int Id public string Name So, an Event has a list of EventContact' objects. Now, Event also implements IEvent - hence the custom model binder. I useIEventinstead of Event, so when the default model binder tries to do its thing, it lets me know it can't create anIEvent'. I have my view with populated with the contact info: <input type="text" name="contact[0].Name" value="DB Value"/> <input type="text" name="contact[1].Name" value="DB Value"/> <input type="text" name="contact[2].Name" value="DB Value"/> <!-- Event fields, etc --> So, in my custom model binder I am able to see all the value - sweet! The only thing is, I'm really not sure how to get all the contact fields and create a list of contacts from them, along with binding all the Event fields. Any and all help is appreciated!

    Read the article

  • [PHP, CSS, & ?] fixed width div, resizing text on the fly based on length

    - by Andrew Heath
    Let's say you've got a simple fixed-width layout that pulls a title from a MySQL database. CSS: #wrapper { width: 800px; } h1 { width: 100%; } HTML: <html> <body> <div id="wrapper"> <h1> $titleString </h1> </div> </body> </html> But the catch is, the length of the title string pulled from your MySQL database varies wildly. Sometimes it might be 10 characters, sometimes it might be 80. It's possible to establish a min & max character count. How, if at all possible, do I get the text-size of my <h1>$titleString</h1> to enlarge/decrease on-the-fly such that the string is only ever on one line and best fit to that line length? I've seen a lot of questions about resizing the div - but in my case the div must always be 100% (800px) and I want to best-fit the title. Obviously a maximum text-size value would have to be set so 5 character strings don't become gargantuan. Does anyone have a suggestion? I'm only using PHP/MySQL/CSS on this page at the moment, but incorporation of another language is fine if it means I can solve the problem. The only thing I can think of is a bruteforce approach whereby through trial and error I establish acceptable string character count ranges matched with CSS em sizes, but that'd be a pretty ugly implementation from the code side.

    Read the article

  • Firefox drags div like it was an image, javascript event handlers possibly to blame

    - by user281434
    Hi, I'm using this HTML,CSS and Javascript code (in one document together if you want to test it out): <style type="text/css"> #slider_container { width: 200px; height: 30px; background-color: red; display:block; } #slider { width: 20px; height: 30px; background-color: blue; display:block; position:absolute; left:0; } </style> <script type="text/javascript" src="../../js/libs/jquery-1.4.2.min.js"></script> <script type="text/javascript"> $(document).ready(function() { $("#slider").mousedown(function() { $(document).mousemove(function(evnt) { $("#test").html("sliding"); }).mouseup(function() { $("#test").html("not sliding"); $(document).unbind("mousemove mouseup"); });}); }); </script> <div id="test">a</div> <div id="slider_container"> <div id="slider"></div> </div> Everything (surprisingly) works fine in IE, but firefox seems to totally clusterf*ck when this javascript is used. The first "slide" is okay, you drag, it says "sliding", you drop, it says "not sliding". On the second "slide" (or mousedown if you will), firefox suddenly thinks the div is an image or link and wants to drag it around. Screenshot of the dragging: http://i.imgur.com/nPJxZ.jpg Obviously the blue div half-positioned in the red div is the one being dragged. Windows does not capture the cursor when you take a screenshot, but it's a stop sign. Is there someway to prevent this default behaviour?

    Read the article

  • Wordpress Custom Themes > How to script Categories, Tags and Excerpt options to appear on "page" edi

    - by Scott B
    I'm using custom WordPress categories for some probably unintended functions, I will admit (things like marking a post no/index just by adding it to my custom "no-index" category, etc). But it sucks that WordPress does not enable pages with all the little extras you get with posts. For example, while the post editor gives you convenient access to Tags, Categories, and a Post excerpt field, pages get left out in the cold. I'd like to know if its possible to add the These items to the Post editor via add_action() directive from a custom theme.

    Read the article

  • Need help understanding "TypeError: default __new__ takes no parameters" error in python

    - by Gordon Fontenot
    For some reason I am having trouble getting my head around __init__ and __new__. I have a bunch of code that runs fine from the terminal, but when I load it as a plugin for Google Quick Search Box, I get the error TypeError: default __new__ takes no parameters. I have been reading about the error, and it's kind of making my brain spin. As it stands I have 3 classes, with no sub-classes, each class has it's own defs. I never use def __init__ or def __new__, but I have gotten the distinct feeling that these are the functions (or the lack thereof) that would be giving me the error. I have no idea how to summarize the code down to a snippet that would be helpful here, since I'm a bit over my head, but the entire script can be found at github. Not expecting anyone to bugfix my code for me, I am just at my wit's end on this. A simple (plain english, not the quote from the python docs which I have read 20 times and still don't really understand) explination of why this error would pop up, or why I should be, or not be, using the __init__ and/or __new__ functions would be seriously appreciated. Thanks for any help you can give in advance.

    Read the article

  • Chinese encoding issue while listing files

    - by Null Pointer
    I am running a Java application on a Solaris10 with Chinese. Now there are some files in a directory with chinese filenames. When I do files = new File(dir).list() where "dir" is the parent directory containing that chinese file, I get the result filename files[0] as ?????(some junk characters). Now the deal is that my programs file.encoding property is already set to GBK and I also do Charset.isSupported("GBK") and it returns true too. So where could be the problem. I am running out of ideas. NOTE: I am not trying to print the filename anywhere or copy the file or something. I am simply openeing a stream to it, something like below: files = new File(dir).list(); new FileInputStream(files[0]); Now this gives me a FileNotFoundExcpetion, so I debug just to find that value inside files[0] is "??????".

    Read the article

  • Why does fprintf start printing out of order or not at all?

    - by Steve Melvin
    This code should take an integer, create pipes, spawn two children, wait until they are dead, and start all over again. However, around the third time around the loop I lose my prompt to enter a number and it no longer prints the number I've entered. Any ideas? #include <stdio.h> #include <stdlib.h> #include <unistd.h> #include <errno.h> #define WRITE 1 #define READ 0 int main (int argc, const char * argv[]) { //Pipe file-descriptor array unsigned int isChildA = 0; int pipeA[2]; int pipeB[2]; int num = 0; while(1){ fprintf(stderr,"Enter an integer: "); scanf("%i", &num); if(num == 0){ fprintf(stderr,"You entered zero, exiting...\n"); exit(0); } //Open Pipes if(pipe(pipeA) < 0){ fprintf(stderr,"Could not create pipe A.\n"); exit(1); } if(pipe(pipeB) < 0){ fprintf(stderr,"Could not create pipe B.\n"); exit(1); } fprintf(stderr,"Value read: %i \n", num); fprintf(stderr,"Parent PID: %i\n", getpid()); pid_t procID = fork(); switch (procID) { case -1: fprintf(stderr,"Fork error, quitting...\n"); exit(1); break; case 0: isChildA = 1; break; default: procID = fork(); if (procID<0) { fprintf(stderr,"Fork error, quitting...\n"); exit(1); } else if(procID == 0){ isChildA = 0; } else { write(pipeA[WRITE], &num, sizeof(int)); close(pipeA[WRITE]); close(pipeA[READ]); close(pipeB[WRITE]); close(pipeB[READ]); pid_t pid; while (pid = waitpid(-1, NULL, 0)) { if (errno == ECHILD) { break; } } } break; } if (procID == 0) { //We're a child, do kid-stuff. ssize_t bytesRead = 0; int response; while (1) { while (bytesRead == 0) { bytesRead = read((isChildA?pipeA[READ]:pipeB[READ]), &response, sizeof(int)); } if (response < 2) { //Kill other child and self fprintf(stderr, "Terminating PROCID: %i\n", getpid()); write((isChildA?pipeB[WRITE]:pipeA[WRITE]), &response, sizeof(int)); close(pipeA[WRITE]); close(pipeA[READ]); close(pipeB[WRITE]); close(pipeB[READ]); return 0; } else if(!(response%2)){ //Even response/=2; fprintf(stderr,"PROCID: %i, VALUE: %i\n", getpid(), response); write((isChildA?pipeB[WRITE]:pipeA[WRITE]), &response, sizeof(int)); bytesRead = 0; } else { //Odd response*=3; response++; fprintf(stderr,"PROCID: %i, VALUE: %i\n", getpid(), response); write((isChildA?pipeB[WRITE]:pipeA[WRITE]), &response, sizeof(int)); bytesRead = 0; } } } } return 0; } This is the output I am getting... bash-3.00$ ./proj2 Enter an integer: 101 Value read: 101 Parent PID: 9379 PROCID: 9380, VALUE: 304 PROCID: 9381, VALUE: 152 PROCID: 9380, VALUE: 76 PROCID: 9381, VALUE: 38 PROCID: 9380, VALUE: 19 PROCID: 9381, VALUE: 58 PROCID: 9380, VALUE: 29 PROCID: 9381, VALUE: 88 PROCID: 9380, VALUE: 44 PROCID: 9381, VALUE: 22 PROCID: 9380, VALUE: 11 PROCID: 9381, VALUE: 34 PROCID: 9380, VALUE: 17 PROCID: 9381, VALUE: 52 PROCID: 9380, VALUE: 26 PROCID: 9381, VALUE: 13 PROCID: 9380, VALUE: 40 PROCID: 9381, VALUE: 20 PROCID: 9380, VALUE: 10 PROCID: 9381, VALUE: 5 PROCID: 9380, VALUE: 16 PROCID: 9381, VALUE: 8 PROCID: 9380, VALUE: 4 PROCID: 9381, VALUE: 2 PROCID: 9380, VALUE: 1 Terminating PROCID: 9381 Terminating PROCID: 9380 Enter an integer: 102 Value read: 102 Parent PID: 9379 PROCID: 9386, VALUE: 51 PROCID: 9387, VALUE: 154 PROCID: 9386, VALUE: 77 PROCID: 9387, VALUE: 232 PROCID: 9386, VALUE: 116 PROCID: 9387, VALUE: 58 PROCID: 9386, VALUE: 29 PROCID: 9387, VALUE: 88 PROCID: 9386, VALUE: 44 PROCID: 9387, VALUE: 22 PROCID: 9386, VALUE: 11 PROCID: 9387, VALUE: 34 PROCID: 9386, VALUE: 17 PROCID: 9387, VALUE: 52 PROCID: 9386, VALUE: 26 PROCID: 9387, VALUE: 13 PROCID: 9386, VALUE: 40 PROCID: 9387, VALUE: 20 PROCID: 9386, VALUE: 10 PROCID: 9387, VALUE: 5 PROCID: 9386, VALUE: 16 PROCID: 9387, VALUE: 8 PROCID: 9386, VALUE: 4 PROCID: 9387, VALUE: 2 PROCID: 9386, VALUE: 1 Terminating PROCID: 9387 Terminating PROCID: 9386 Enter an integer: 104 Value read: 104 Parent PID: 9379 Enter an integer: PROCID: 9388, VALUE: 52 PROCID: 9389, VALUE: 26 PROCID: 9388, VALUE: 13 PROCID: 9389, VALUE: 40 PROCID: 9388, VALUE: 20 PROCID: 9389, VALUE: 10 PROCID: 9388, VALUE: 5 PROCID: 9389, VALUE: 16 PROCID: 9388, VALUE: 8 PROCID: 9389, VALUE: 4 PROCID: 9388, VALUE: 2 PROCID: 9389, VALUE: 1 Terminating PROCID: 9388 Terminating PROCID: 9389 105 Value read: 105 Parent PID: 9379 Enter an integer: PROCID: 9395, VALUE: 316 PROCID: 9396, VALUE: 158 PROCID: 9395, VALUE: 79 PROCID: 9396, VALUE: 238 PROCID: 9395, VALUE: 119 PROCID: 9396, VALUE: 358 PROCID: 9395, VALUE: 179 PROCID: 9396, VALUE: 538 PROCID: 9395, VALUE: 269 PROCID: 9396, VALUE: 808 PROCID: 9395, VALUE: 404 PROCID: 9396, VALUE: 202 PROCID: 9395, VALUE: 101 PROCID: 9396, VALUE: 304 PROCID: 9395, VALUE: 152 PROCID: 9396, VALUE: 76 PROCID: 9395, VALUE: 38 PROCID: 9396, VALUE: 19 PROCID: 9395, VALUE: 58 PROCID: 9396, VALUE: 29 PROCID: 9395, VALUE: 88 PROCID: 9396, VALUE: 44 PROCID: 9395, VALUE: 22 PROCID: 9396, VALUE: 11 PROCID: 9395, VALUE: 34 PROCID: 9396, VALUE: 17 PROCID: 9395, VALUE: 52 PROCID: 9396, VALUE: 26 PROCID: 9395, VALUE: 13 PROCID: 9396, VALUE: 40 PROCID: 9395, VALUE: 20 PROCID: 9396, VALUE: 10 PROCID: 9395, VALUE: 5 PROCID: 9396, VALUE: 16 PROCID: 9395, VALUE: 8 PROCID: 9396, VALUE: 4 PROCID: 9395, VALUE: 2 PROCID: 9396, VALUE: 1 Terminating PROCID: 9395 Terminating PROCID: 9396 105 Value read: 105 Parent PID: 9379 Enter an integer: PROCID: 9397, VALUE: 316 PROCID: 9398, VALUE: 158 PROCID: 9397, VALUE: 79 PROCID: 9398, VALUE: 238 PROCID: 9397, VALUE: 119 PROCID: 9398, VALUE: 358 PROCID: 9397, VALUE: 179 PROCID: 9398, VALUE: 538 PROCID: 9397, VALUE: 269 PROCID: 9398, VALUE: 808 PROCID: 9397, VALUE: 404 PROCID: 9398, VALUE: 202 PROCID: 9397, VALUE: 101 PROCID: 9398, VALUE: 304 PROCID: 9397, VALUE: 152 PROCID: 9398, VALUE: 76 PROCID: 9397, VALUE: 38 PROCID: 9398, VALUE: 19 PROCID: 9397, VALUE: 58 PROCID: 9398, VALUE: 29 PROCID: 9397, VALUE: 88 PROCID: 9398, VALUE: 44 PROCID: 9397, VALUE: 22 PROCID: 9398, VALUE: 11 PROCID: 9397, VALUE: 34 PROCID: 9398, VALUE: 17 PROCID: 9397, VALUE: 52 PROCID: 9398, VALUE: 26 PROCID: 9397, VALUE: 13 PROCID: 9398, VALUE: 40 PROCID: 9397, VALUE: 20 PROCID: 9398, VALUE: 10 PROCID: 9397, VALUE: 5 PROCID: 9398, VALUE: 16 PROCID: 9397, VALUE: 8 PROCID: 9398, VALUE: 4 PROCID: 9397, VALUE: 2 PROCID: 9398, VALUE: 1 Terminating PROCID: 9397 Terminating PROCID: 9398 106 Value read: 106 Parent PID: 9379 Enter an integer: PROCID: 9399, VALUE: 53 PROCID: 9400, VALUE: 160 PROCID: 9399, VALUE: 80 PROCID: 9400, VALUE: 40 PROCID: 9399, VALUE: 20 PROCID: 9400, VALUE: 10 PROCID: 9399, VALUE: 5 PROCID: 9400, VALUE: 16 PROCID: 9399, VALUE: 8 PROCID: 9400, VALUE: 4 PROCID: 9399, VALUE: 2 PROCID: 9400, VALUE: 1 Terminating PROCID: 9399 Terminating PROCID: 9400 ^C Another thing that's strange, when ran from within XCode it behaves normally. However, when ran from bash on Solaris or OSX it acts up.

    Read the article

  • C++ Testing framework integrated with Eclipse

    - by Mike
    I'm writing a C++ unit testing framework and I would like it if it could be integrated with Eclipse CDT. In other testing suites that work with Eclipse, JUnit for example, the user is provided a graphical list of all test cases and their results. Something like this would be the ideal. I'm just getting into this, so I need some advice on getting started. There are two approaches I see Use an existing Eclipse testing plugin (such as JUnit) and make the framework return output in the same format as the plugin's input. Write a plugin from scratch that can work with my framework (seems like it would take a lot of time) Thoughts appreciated

    Read the article

  • Problem running iPhone application on iPhone from Xcode (and in Instruments)

    - by Ben
    Hi I have a problem running one application on the iPhone from Xcode (or Instruments). When I try to run the app I get the error message Failed to upload XXX.app in the bottom left corner of Xcode. The strange thing is it actually uploaded the app to the iPhone but it doesn't start it (after this I can start the app by hand on the iPhone). So without being able to start the app from Xcode or instruments I have no chance of debugging/performance testing. Any advice on what might be going wrong here? The iPhone console shows me this: Thu Oct 1 14:25:18 unknown mobile_installationd[1976] <Error>: 00808e00 install_embedded_profile: Skipping the installation of the embedded profile Thu Oct 1 14:25:23 unknown SpringBoard[25] <Warning>: Reloading and rendering all application icons. Other applications work fine. I've tried this on two iPhones (both 3.1) with the same result. I am running Xcode 3.2 on SnowLeopard. Regards

    Read the article

< Previous Page | 328 329 330 331 332 333 334 335 336 337 338 339  | Next Page >