Monthly Archives

Articles indexed in September 2012

Page 373/470 | < Previous Page | 369 370 371 372 373 374 375 376 377 378 379 380  | Next Page >

  • Make Virtualhost detect Wildcard with and without preceding www

    - by jasondavis
    In my Apache (Xampp) httpd-vhosts.conf file I have added this Virtualhost It allows me to use Wildcard names like testserver1.dev and testserver2.dev I just have to make sure to add the name to my Windows Hosts file. <VirtualHost *:80> VirtualDocumentRoot E:/Server/htdocs/projects/%1/www ServerAlias *.dev </VirtualHost> What I would like to do though is add to this funtionality and make it work if the name begins with a www so testserver1.dev would also work as www.testserver1.dev The way it currently is set up, if I tried to access that URL, it would look in a folder called www.testserver1 instead of the folder testserver1

    Read the article

  • Moving from ColdFusion 8 to ColdFusion 10 - Migration Fails

    - by XenoFoxx
    After having made several attempts to migrate from a ColdFusion 8 Standard server to a ColdFusion 10 Standard server, it feels like I am "almost" there. I'm using the 64 bit installer from Adobe's website. I'm using a Windows Server 2008 (64 bit) server with IIS 7.0. The installation itself goes smooth and the services start and are running. But at the end of the installation it says "ColdFusion Installed, but with errors" and it generates a log file. The log file reads: Migration Error: : Check that "C:\ColdFusion8" is a valid directory and is an installation of either ColdFusion MX 6 or ColdFusionMX 7 and further down says: Status: WARNING Additional Notes: WARNING - Could not migrate settings from previous version of ColdFusion Custom Action: com.macromedia.ia.action.MigrateColdFusionAction Status: ERROR Additional Notes: ERROR - class com.macromedia.ia.action.MigrateColdFusionAction NonfatalInstallException null The applicationHost.config file has new XML referencing the ColdFusion 10 directory, but IIS is still using ColdFusion 8. I'm also going to guess that the settings in the CF Administrator have not been migrated based on the message in the log above. I've followed the instructions on Adobe's site, including ensuring that ASP.NET, CGI, ISAPI Extensions, and ISAPI Filters are all enabled. I've also enabled IIS 6 Metabase Compatibility even though I don't think it's needed. Has anyone else had similar issues with ColdFusion 10 and IIS 7. Currently I have uninstalled CF 10 and reverted back to

    Read the article

  • Coldfusion 8 crash

    - by Denis Topa
    I have a very big problem with coldfusion 8 on Windows server 2008 with IIS7. They are in production server and sometimes the the site is not available, I have to manually end the jrun.exe process from task manager and then the site is available. I realize that the process jrun.exe has abut 1.3Gb of memory used at the time it crash's. It happens 2-3 times a day, I have looking in the coldfusion logs and I did not found anything strange beside some warnings that some job exceeded the 300 sec of time execution. I forgot to mention that coldfusion is a 32bit application but the windows is a 64bit, this may be the problem? I'm not such good in coldfusion, so If someone knows how to troubleshoot please let me know Thanks!

    Read the article

  • ProFTPd with sftp first login fails, seconds succeeds

    - by Nahrub
    We are working with ProFTPd and SFTP module enabled. We have a problem with using the sftp module. When we try to connect to server in FileZilla we need to enter the password to the server twice, upon connection and upon each file upload, which is very undesired. How can we help this? any idea's? suggestions? when we use the interactive login type in FileZilla, it works when we enter the username and password twice.

    Read the article

  • LDAP ACLs with ldapmodify & .ldif file grand user access only

    - by plaetzchen
    I want to change the settings my new LDAP server let only users of the server read entries and not anonymous. Currently my olcAccess looks like this: olcAccess: {0} to attrs=userPassword,shadowLastChange by self write by anonymous auth by dn="cn=admin,dc=example,dc=com" write by * none olcAccess: {1} to * by self write by dn="cn=admin,dc=example,dc=com" write by * read I tried to change it like so: olcAccess: {0}to attrs=userPassword,shadowLastChange by self write by anonymous auth by dn="cn=admin,dc=example,dc=com" write by * none olcAccess: {1} to * by self write by dn="cn=admin,dc=exampme,dc=com" write by users read But that gives me no access at all. Can someone help me on this? thanks UPDATE: This is the log read after the changes mentioned by userxxx Sep 30 10:47:21 j16354 slapd[11805]: conn=1437 fd=28 ACCEPT from IP=87.149.169.6:64121 (IP=0.0.0.0:389) Sep 30 10:47:21 j16354 slapd[11805]: conn=1437 op=0 do_bind: invalid dn (pbrechler) Sep 30 10:47:21 j16354 slapd[11805]: conn=1437 op=0 RESULT tag=97 err=34 text=invalid DN Sep 30 10:47:21 j16354 slapd[11805]: conn=1437 op=1 UNBIND Sep 30 10:47:21 j16354 slapd[11805]: conn=1437 fd=28 closed Sep 30 10:47:21 j16354 slapd[11805]: conn=1438 fd=28 ACCEPT from IP=87.149.169.6:64122 (IP=0.0.0.0:389) Sep 30 10:47:21 j16354 slapd[11805]: conn=1438 op=0 do_bind: invalid dn (pbrechler) Sep 30 10:47:21 j16354 slapd[11805]: conn=1438 op=0 RESULT tag=97 err=34 text=invalid DN Sep 30 10:47:21 j16354 slapd[11805]: conn=1438 op=1 UNBIND Sep 30 10:47:21 j16354 slapd[11805]: conn=1438 fd=28 closed pbrechler should be a valid user but has no system user (we don't need it) admin does't work also List item

    Read the article

  • phpMyAdmin says mcrypt is missing, but it's not; cannot log in

    - by GradysGhost
    I've just compiled a web stack on Solaris 10. This is a fairly standard Apache 2 / MySQL 5 / PHP 5 stack with all the most recent stable versions. I dropped phpMyAdmin on the server and set up httpd.conf to get that online. When I browse to the page, login fails, and a persistent message appears beneath the login form: The mcrypt extension is missing. Please check your PHP configuration. However, I compiled PHP with the --with-mcrypt flag. A file, info.php: <?php phpinfo(); ?> shows that mcrypt support is enabled. Running: php -m on the command line shows that mcrypt is loaded. Google hasn't been much help, and I was hoping someone around these parts could throw some help my way. If I need to provide any further detail, please let me know what you need to know.

    Read the article

  • Configuring jdbc-pool (tomcat 7)

    - by john
    i'm having some problems with tomcat 7 for configuring jdbc-pool : i`ve tried to follow this example: http://www.tomcatexpert.com/blog/2010/04/01/configuring-jdbc-pool-high-concurrency so i have: conf/server.xml <GlobalNamingResources> <Resource type="javax.sql.DataSource" name="jdbc/DB" factory="org.apache.tomcat.jdbc.pool.DataSourceFactory" driverClassName="com.mysql.jdbc.Driver" url="jdbc:mysql://localhost:3306/mydb" username="user" password="password" /> </GlobalNamingResources> conf/context.xml <Context> <ResourceLink type="javax.sql.DataSource" name="jdbc/LocalDB" global="jdbc/DB" /> <Context> and when i try to do this: Context initContext = new InitialContext(); Context envContext = (Context)initContext.lookup("java:/comp/env"); DataSource datasource = (DataSource)envContext.lookup("jdbc/LocalDB"); Connection con = datasource.getConnection(); i keep getting this error: javax.naming.NameNotFoundException: Name jdbc is not bound in this Context at org.apache.naming.NamingContext.lookup(NamingContext.java:803) at org.apache.naming.NamingContext.lookup(NamingContext.java:159) pls help tnx

    Read the article

  • Bad to be logged in as admin all the time?

    - by poke
    At the office where I work, three of the other members of the IT staff are logged into their computers all the time with accounts that are members of the domain administrators group. I have serious concerns about being logged in with admin rights (either local or for the domain). As such, for everyday computer use, I use an account that just has regular user privelages. I also have an different account that is part of the domain admins group. I use this account when I need to do something that requires elevated privilages on my computer, one of the servers, or on another user's computer. What is the best practice here? Should network admins be logged in with rights to the entire network all the time (or even their local computer for that matter)?

    Read the article

  • URL Rewrite in IIS7 Web Service - WebService.asmx => WebService in the SOAP doc

    - by Robert Kaucher
    I have an IIS7.5 (Server 2008 R2) based web service that I would like to make as independant on the current implementations technology as possible. I am using the URL rewrite module (http://learn.iis.net/page.aspx/734/url-rewrite-module/) to remove the .asmx portion of the URL and that is working fine for the HTTP request portion. However, I still see .asmx in the WSDL file when I access it. I was wondering if anyone has done this and if so, what advice could be offered. It doesn't seem like a hard problem to solve. But I have tries a number of things with "custom tags" and can't seem to get it working to save my life.

    Read the article

  • How to fade away the icon in the dock when close the program in Mac OSX

    - by Magic
    I'm using Mac OSX Mountain Lion. But some program in the dock confusing me. When I close some program(upper left close button). The icon in the dock fade away. That mean the process close. But some program doesn't fade away(mean the process still alive), And I don't select the "Show in Dock" option. Like Microsoft Office(Word, Excel). It's too annoying. What I want is when I click the upper left close button. The icon will fade away and the program close?

    Read the article

  • UPS: Do i require a special extension cord for power in?

    - by rism
    I have a couple of Tripplite UPS systems. The power in cables are bright orange and about 2 meters in length. I want to put the system on the other side of the room but for some reason the UPS keep "going off" over there. So I guess the wall power sockets on that side of the room are a little dodgy. So i figured Id just go online and get some replacement UPS power IN (from wall to UPS) cables of an appropriate length. But i cant find any anywhere. (auction sites, tripplite store, cable websites). So now I'm wondering if that's just because you can use a standard extension cord of an appropriate wattage? I thought the UPS power IN cables were "special". Is that not so?

    Read the article

  • SSH into VirtualBox Guest: Connection Refused

    - by Eric J.
    Setup Windows 7 64-bit host OS running VirtualBox 4.2, with Ubuntu 12.04 guest OS. OpenSSH server is installed and running (ssh -v localhost connects locally in the guest machine). Can SSH to external servers (no outbound Windows firewall rule blocking port 22) Can ping the IP of the guest (192.168.56.101) Problem Using PuTTY to SSH to the IP of the guest OS (192.168.56.101), PuTTY returns almost immediately with Network error: connection refused How can I diagnose & resolve this issue?

    Read the article

  • Find Search Replace from landmark to landmark - including everything in between

    - by Erick Tronboll
    Appreciate some Jedi help... I have the following string: gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR repeating sporadically throughout my document and want to remove everything from: gi|37463 to the AAMGR sequence but, I want to keep the blocks where JQ250 appears: gi|374638936|gb|*JQ250*332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC and remove only the lines that have AEZ554 gi|374638939|gb|*AEZ554*52.1| myosin light chain 2, partial [Batrachoseps major] AAMGR ..................................... So, ideally the following block: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638935|gb|AEZ55450.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638937|gb|AEZ55451.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR Would be left as just: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC ................................many thanks as I help a struggling Grad Student

    Read the article

  • I want to change DPI with Imagemagick without changing the actual byte-size of the image data

    - by user1694803
    I feel so horribly sorry that I have to ask this question here, but after hours of researching how to do an actually very simple task I'm still failing... In Gimp there is a very simple way to do what I want. I only have the German dialog installed but I'll try to translate it. I'm talking about going to "Picture-PrintingSize" and then adjusting the Values "X-Resolution" and "Y-Resolution" which are known to me as so called DPI values. You can also choose the format which by default is "Pixel/Inch". (In German the dialog is "Bild-Druckgröße" and there "X-Auflösung" and "Y-Auflösung") Ok, the values there are often "72" by default. When I change them to e.g. "300" this has the effect that the image stays the same on the computer, but if I print it, it will be smaller if you look at it, but all the details are still there, just smaller - it has a higher resolution on the printed paper (but smaller size... which is fine for me). I am often doing that when I am working with LaTeX, or to be exact with the command "pdflatex" on a recent Ubuntu-Machine. When I'm doing the above process with Gimp manually everything works just fine. The images will appear smaller in the resulting PDF but with high printing quality. What I am trying to do is to automate the process of going into Gimp and adjusting the DPI values. Since Imagemagick is known to be superb and I used it for many other tasks I tried to achieve my goal with this tool. But it does just not do what I want. After trying a lot of things I think this actually is be the command that should be my friend: convert input.png -density 300 output.png This should set the DPI to 300, as I can read everywhere in the web. It seems to work. When I check the file it stays the same. file input.png output.png input.png: PNG image data, 611 x 453, 8-bit grayscale, non-interlaced output.png: PNG image data, 611 x 453, 8-bit grayscale, non-interlaced When I use this command, it seems like it did what I wanted: identify -verbose output.png | grep 300 Resolution: 300x300 PNG:pHYs : x_res=300, y_res=300, units=0 (Funny enough, the same output comes for input.png which confuses me... so this might be the wrong parameters to watch?) But when I now render my TeX with "pdflatex" the image is still big and blurry. Also when I open the image with Gimp again the DPI values are set to "72" instead of "300". So there actually was no effect at all. Now what is the problem here. Am I getting something completely wrong? I can't be that wrong since everything works just fine with Gimp... Thanks for any help in this. I am also open to other automated solutions which are easily done on a Linux system...

    Read the article

  • Open Office crashes, recovers, crashes again

    - by Daniel R Hicks
    After completely reinstalling my laptop due to apparent registry corruption, I've encountered a problem with Open Office: I open a simple Calc spreadsheet, it comes up normally, but then after anywhere from 5 seconds to several minutes (without even touching the Calc window) OO crashes, then comes up through recovery. If I let it "recover" it will do so and bring the spreadsheet up again, only to repeat the crash scenario again. If I kept clicking "OK" it would apparently do this all day. I reinstalled OO once and the problem went away for awhile, but it came back. I then attempted to "reset" my profile (ie, rename the OO user directory in App Data), but OO crashed during the first startup after that, then resumed the original behavior. If I open the same file using Excel it complains of errors in the file, and "recovers" them, but the "error report" it generates contains no details. If I save the "recovered" file then OO Calc will open it, but the problem returns after saving again. Any ideas? (The system is Vista SP2, running OO 3.4.1) How to reproduce: Start Open Office Calc. Save workspace as "CrashTest.ods" From Task Manager kill Open Office (soffice.exe/bin -- one of each) Double click on the saved "CrashTest.ods" in Explorer. OO puts up a message that recovery will occur -- allow it. When the Calc window comes up, don't touch it -- just wait about 10 seconds. Calc window closes and OO puts up a message that recovery will occur -- from now on the sequence will repeat. I suspect this behavior is limited to a few (recent) versions of OO, and very possibly only Calc. Reported as Open Office Bug 1211094. Sigh!! As much as it irritates me, I'm having to switch over to Excel for several things I used to do with Calc. Excel has a miserable UI, but at least it says up for longer than 10 seconds.

    Read the article

  • How do I get my Nvidia monitor position settings (in Linux) to persist after a restart?

    - by machineghost
    I have two monitors, and I run them both in Linux using the proprietary Nvidia drivers with "TwinView". I just installed Linux Mint 13, and since the install after every reboot my monitors come up in the wrong position (the computer thinks the left monitor is on the right). After boot-up I can run the Nvidia config and fix the monitors' position, and I can even save the configuration file successfully. But as soon as I restart again, the monitors re-appear switched. Does anyone have any idea what might be causing this (and more importantly, how I can solve it?)

    Read the article

  • Mac OS X behind OpenLDAP and Samba

    - by Sam Hammamy
    I have been battling for a week now to get my Mac (Mountain Lion) to authenticate on my home network's OpenLDAP and Samba. From several sources, like the Ubuntu community docs, and other blogs, and after a hell of a lot of trial and error and piecing things together, I have created a samba.ldif that will pass the smbldap-populate when combined with apple.ldif and I have a fully functional OpenLDAP server and a Samba PDC that uses LDAP to authenticate the OS X Machine. The problem is that when I login, the home directory is not created or pulled from the server. I get the following in system.log Sep 21 06:09:15 Sams-MacBook-Pro.local SecurityAgent[265]: User info context values set for sam Sep 21 06:09:15 Sams-MacBook-Pro.local authorizationhost[270]: in pam_sm_authenticate(): Got user: sam Sep 21 06:09:15 Sams-MacBook-Pro.local authorizationhost[270]: in pam_sm_authenticate(): Got ruser: (null) Sep 21 06:09:15 Sams-MacBook-Pro.local authorizationhost[270]: in pam_sm_authenticate(): Got service: authorization Sep 21 06:09:15 Sams-MacBook-Pro.local authorizationhost[270]: in od_principal_for_user(): no authauth availale for user. Sep 21 06:09:15 Sams-MacBook-Pro.local authorizationhost[270]: in od_principal_for_user(): failed: 7 Sep 21 06:09:15 Sams-MacBook-Pro.local authorizationhost[270]: in pam_sm_authenticate(): Failed to determine Kerberos principal name. Sep 21 06:09:15 Sams-MacBook-Pro.local authorizationhost[270]: in pam_sm_authenticate(): Done cleanup3 Sep 21 06:09:15 Sams-MacBook-Pro.local authorizationhost[270]: in pam_sm_authenticate(): Kerberos 5 refuses you Sep 21 06:09:15 Sams-MacBook-Pro.local authorizationhost[270]: in pam_sm_authenticate(): pam_sm_authenticate: ntlm Sep 21 06:09:15 Sams-MacBook-Pro.local authorizationhost[270]: in pam_sm_acct_mgmt(): OpenDirectory - Membership cache TTL set to 1800. Sep 21 06:09:15 Sams-MacBook-Pro.local authorizationhost[270]: in od_record_check_pwpolicy(): retval: 0 Sep 21 06:09:15 Sams-MacBook-Pro.local authorizationhost[270]: in pam_sm_setcred(): Establishing credentials Sep 21 06:09:15 Sams-MacBook-Pro.local authorizationhost[270]: in pam_sm_setcred(): Got user: sam Sep 21 06:09:15 Sams-MacBook-Pro.local authorizationhost[270]: in pam_sm_setcred(): Context initialised Sep 21 06:09:15 Sams-MacBook-Pro.local authorizationhost[270]: in pam_sm_setcred(): pam_sm_setcred: ntlm user sam doesn't have auth authority All that's great and good and I authenticate. Then I get CFPreferences: user home directory for user kCFPreferencesCurrentUser at /Network/Servers/172.17.148.186/home/sam is unavailable. User domains will be volatile. Failed looking up user domain root; url='file://localhost/Network/Servers/172.17.148.186/home/sam/' path=/Network/Servers/172.17.148.186/home/sam/ err=-43 uid=9000 euid=9000 If you're wondering where /Network/Servers/IP/home/sam comes from, it's from a couple of blogs that said the OpenLDAP attribute apple-user-homeDirectory should have that value and the NFSHomeDirectory on the mac should point to apple-user-homeDirectory I also set the attr apple-user-homeurl to <home_dir><url>smb://172.17.148.186/sam/</url><path></path></home_dir> which I found on this forum. Any help is appreciated, because I'm banging my head against the wall at this point. By the way, I intend to create a blog on my vps just for this, and create an install script in python that people can download so no one has to go through what I've had to go through this week :) After some sleep I am going to try to login from a windows machine and report back here. Thanks Sam

    Read the article

  • Gmail and FB is not rendering properly in Firefox

    - by Andy
    I am unable read Gmail in my Firefox browser on my laptop. However, there are no problems when I try to access Gmail on my office desktop. In fact, Gmail renders fine on IE on both computers. Things I have tried: Uninstalling and reinstalling Firefox. Using Firefox 3.6.26 and Firefox 10; same problem. Clearing the cache. But all to no avail. For starters: My background image does not get loaded. It says "Oops. Your selected image failed to load". The buttons for the new look do not get rendered, but when I do a mouse-over I see text which helps me navigate. When I try to read a message, I see the subject line and I see the reply / forward box. The message body does not get rendered, it seems like a styling error. Check this screenshot where the icons in the GMail new look are not rendered properly Check this screenshot where even facebook is not getting rendered properly EDIT: 25th Feb 2012 GMAIL is getting rendered fine in the old look

    Read the article

  • Can ping device from one computer and not the other

    - by Sean Duggan
    I've recently been assigned to work on a diagnostic program done in C++ which communicates with a piece of electronic equipment. Our normal scenario involves communicating via an RS232 interface, but I've been asked to make our program work over ethernet, source code having been done in Visual Basic. After much thrashing about trying to get the code to work and continuing to get 10049 Winsock errors when I tried to connect, I tried pinging the switch. From the computer the VB program is running on, I can see the switch via ping, nslookup, tracert, and pathping (I was going down the list of programs) and I can do this via URI or IP address. From my laptop, sending the same commands fails every time. They're both using the same network cable and the same USB-to-Ethernet device (I've been swapping them between tests) but one can see the switch and the other cannot. I'm working on the programming end, but the ping results makes me think that there might be a network issue stymieing me. wry grin I'm not much of a network guy, so I'm appealing to expert assistance. Both computers are running Windows XP if that helps. The connection is to an "IP-RS8" device which then connects to our VCU-C units. Each unit is accessible via URI or IP address on the desktop computer we usually have connected to the units (it's running the older VB program that I was asked to lift the networking code from). The connection is made via a USB-to-Ethernet adapter so as to leave the regular Ethernet port available for connecting to the company network. Hmm... come to think of it, I've probably been confusing the issue, talking about pinging "the switch" rather than indicating that it's the devices. My apologies. Communication is generally done with a DLL that uses Winsock functions to make queries for data from the VCU and then to receive. I'm failing when connecting. I haven't found anything on the firewall which should block these commands, but I'll keep poking. I don't know if it's potentially relevant, but on the desktop, the adapter maps to Local Area Connection 3 while on the laptop, it consistently maps to Local Area Connection 2. Currently reading up on DHCP. IPConfig /all results: Desktop Host Name . . . . . . . . . . . . : AMERDAEXXXXXX Primary Dns Suffix . . . . . . . : amer.example.com Node Type . . . . . . . . . . . . : Hybrid IP Routing Enabled. . . . . . . . : No WINS Proxy Enabled. . . . . . . . : No DNS Suffix Search List. . . . . . : COMPANY.com amer.example.com atle.example.com cone.example.com apac.example.com scan.example.com bYX.example.com Ethernet adapter Local Area Connection X: Connection-specific DNS Suffix . : amer.example.com Description . . . . . . . . . . . : Broadcom NetXtreme XYxx Gigabit Controller Physical Address. . . . . . . . . : YY-XX-YB-XX-XX-XX Dhcp Enabled. . . . . . . . . . . : Yes Autoconfiguration Enabled . . . . : Yes IP Address. . . . . . . . . . . . : XYY.XXX.XY.XXX Subnet Mask . . . . . . . . . . . : XXX.XXX.XXY.Y Default Gateway . . . . . . . . . : XYY.XXX.XY.X DHCP Server . . . . . . . . . . . : XY.XXX.XXY.XX DNS Servers . . . . . . . . . . . : XY.XXX.XXY.XX XY.XXY.XXY.XX Primary WINS Server . . . . . . . : XY.XXX.XXY.X Secondary WINS Server . . . . . . : XY.XXY.XXY.X Lease Obtained. . . . . . . . . . : Thursday, July XX, XYXX XY:XX:XX AM Lease Expires . . . . . . . . . . : Sunday, July XX, XYXX XY:XX:XX AM Ethernet adapter Local Area Connection X: Connection-specific DNS Suffix . : Description . . . . . . . . . . . : ASIX axYYYYX USBX.Y to Fast Ethernet Adapter Physical Address. . . . . . . . . : YY-XY-BY-YX-XY-AY Dhcp Enabled. . . . . . . . . . . : Yes Autoconfiguration Enabled . . . . : Yes IP Address. . . . . . . . . . . . : XY.Y.Y.X Subnet Mask . . . . . . . . . . . : XXX.XXX.XXY.Y Default Gateway . . . . . . . . . : XY.Y.Y.X DHCP Server . . . . . . . . . . . : XY.Y.Y.XY DNS Servers . . . . . . . . . . . : XY.Y.Y.X Lease Obtained. . . . . . . . . . : Thursday, July XX, XYXX XY:XX:XY AM Lease Expires . . . . . . . . . . : Tuesday, August YX, XYXX XX:XY:XY AM Laptop Windows IP Configuration Host Name . . . . . . . . . . . . : AMERLAFYYXXYX Primary Dns Suffix . . . . . . . : amer.example.com Node Type . . . . . . . . . . . . : Hybrid IP Routing Enabled. . . . . . . . : No WINS Proxy Enabled. . . . . . . . : No DNS Suffix Search List. . . . . . : COMPANY.com amer.example.com atle.example.com cone.example.com apac.example.com scan.example.com bYX.example.com Ethernet adapter Local Area Connection: Connection-specific DNS Suffix . : amer.example.com Description . . . . . . . . . . . : Intel(R) 82567LM Gigabit Network Connection Physical Address. . . . . . . . . : YY-XY-BY-DY-XB-YX Dhcp Enabled. . . . . . . . . . . : Yes Autoconfiguration Enabled . . . . : Yes IP Address. . . . . . . . . . . . : XYY.XXX.XY.XY Subnet Mask . . . . . . . . . . . : XXX.XXX.XXY.Y Default Gateway . . . . . . . . . : XYY.XXX.XY.X DHCP Server . . . . . . . . . . . : XY.XXX.XXY.XX DNS Servers . . . . . . . . . . . : XY.XXX.XXY.XX XY.XXY.XXY.XX Primary WINS Server . . . . . . . : XY.XXX.XXY.X Secondary WINS Server . . . . . . : XY.XXY.XXY.X Lease Obtained. . . . . . . . . . : Thursday, July XX, XYXX XX:XX:XX AM Lease Expires . . . . . . . . . . : Sunday, July XX, XYXX XX:XX:XX AM Ethernet adapter {XYXAAYXX-YEDY-XXYX-YYEX-BYXYXXYEEYEX}: Connection-specific DNS Suffix . : Description . . . . . . . . . . . : Nortel IPSECSHM Adapter - Packet Scheduler iniport Physical Address. . . . . . . . . : XX-XX-XX-XX-XX-YY Dhcp Enabled. . . . . . . . . . . : No IP Address. . . . . . . . . . . . : Y.Y.Y.Y Subnet Mask . . . . . . . . . . . : Y.Y.Y.Y Default Gateway . . . . . . . . . : Ethernet adapter Leaf Networks Adapter: Connection-specific DNS Suffix . : Description . . . . . . . . . . . : Leaf Networks Adapter Physical Address. . . . . . . . . : YY-FF-FA-BC-YF-AY Dhcp Enabled. . . . . . . . . . . : No IP Address. . . . . . . . . . . . : X.XYY.XY.XX Subnet Mask . . . . . . . . . . . : XXX.Y.Y.Y Default Gateway . . . . . . . . . : Ethernet adapter Local Area Connection 3: Media State . . . . . . . . . . . : Media disconnected Description . . . . . . . . . . . : Bluetooth LAN Access Server Driver Physical Address. . . . . . . . . : YY-FX-AX-YA-BY-CA Ethernet adapter Wireless Network Connection 2: Media State . . . . . . . . . . . : Media disconnected Description . . . . . . . . . . . : Intel(R) WiFi Link 5300 AGN Physical Address. . . . . . . . . : YY-XX-YA-CX-FC-YE Ethernet adapter Local Area Connection 2: Connection-specific DNS Suffix . : Description . . . . . . . . . . . : ASIX ax88772 USB2.0 to Fast Ethernet Adapter Physical Address. . . . . . . . . : YY-XY-BY-YX-XY-AY Dhcp Enabled. . . . . . . . . . . : No IP Address. . . . . . . . . . . . : XYX.XYY.X.X Subnet Mask . . . . . . . . . . . : XXX.XXX.XXX.Y Default Gateway . . . . . . . . . :

    Read the article

  • Run Java Project from Ubuntu Terminal?

    - by Christopher Gwilliams
    I have a small java project that handle connections. In order to run it from the terminal I have to cd into the folder that contains the source and run the following command: java -cp classes com.packagename.mainclass Where classes is the folder that contains the classes. I want ubuntu to run this application on startup, is there a Java command I can use? Or am I just better off creating a shell script? Thanks!

    Read the article

  • SQL SERVER – Basic Calculation and PEMDAS Order of Operation

    - by pinaldave
    After thinking a long time, I have decided to write about this blog post. I had no plan to create a blog post about this subject but the amount of conversation this one has created on my Facebook page, I decided to bring up a few of the question and concerns discussed on the Facebook page. There are more than 10,000 comments here so far. There are lots of discussion about what should be the answer. Well, as far as I can tell there is a big debate going on on Facebook, for educational purpose you should go ahead and read some of the comments. They are very interesting and for sure teach some new stuff. Even though some of the comments are clearly wrong they have made some good points and I believe it for sure develops some logic. Here is my take on this subject. I believe the answer is 9 as I follow PEMDAS  Order of Operation. PEMDAS stands for  parentheses, exponents, multiplication, division, addition, subtraction. PEMDAS is commonly known as BODMAS in India. BODMAS stands for Brackets, Orders (ie Powers and Square Roots, etc), Division, Multiplication,  Addition and Subtraction. PEMDAS and BODMAS are almost same and both of them follow the operation order from LEFT to RIGHT. Let us try to simplify above statement using the PEMDAS or BODMAS (whatever you prefer to call). Step 1: 6 ÷ 2 (1+2) (parentheses first) Step 2: = 6 ÷ 2 * (1+2) (adding multiplication sign for further clarification) Step 3: = 6 ÷ 2* (3) (single digit in parentheses – simplify using operator) Step 4: = 6 ÷ 2 * 3 (Remember next Operation should be LEFT to RIGHT) Step 5: = 3 * 3 (because 6 ÷ 2 = 3; remember LEFT to RIGHT) Step 6: = 9 (final answer) Some often find Step 4 confusing and often ended up multiplying 2 and 3 resulting Step 5 to be 6 ÷ 6, this is incorrect because in this case we did not follow the order of LEFT to RIGHT. When we do not follow the order of operation from LEFT to RIGHT we end up with the answer 1 which is incorrect. Let us see what SQL Server returns as a result. I executed following statement in SQL Server Management Studio SELECT 6/2*(1+2) It is clear that SQL Server also thinks that the answer should be 9. Let us go ahead and ask Google what will be the answer of above question in Google I have searched for the following term: 6/2(1+2) The result also says the answer should be 9. If you want a further reference here is a great video which describes why the answer should be 9 and not 1. And here is a fantastic conversation on Google Groups. Well, now what is your take on this subject? You are welcome to share constructive feedback and your answer may be different from my answer. NOTE: A healthy conversation about this subject is indeed encouraged but if there is a single bad word or comment is flaming it will be deleted without any notification (it does not matter how valuable information it contains). Reference: Pinal Dave (http://blog.SQLAuthority.com) Filed under: About Me, PostADay, SQL, SQL Authority, SQL Query, SQL Server, SQL Tips and Tricks, T SQL, Technology

    Read the article

  • Unleash the Power of Cryptography on SPARC T4

    - by B.Koch
    by Rob Ludeman Oracle’s SPARC T4 systems are architected to deliver enhanced value for customer via the inclusion of many integrated features.  One of the best examples of this approach is demonstrated in the on-chip cryptographic support that delivers wire speed encryption capabilities without any impact to application performance.  The Evolution of SPARC Encryption SPARC T-Series systems have a long history of providing this capability, dating back to the release of the first T2000 systems that featured support for on-chip RSA encryption directly in the UltraSPARC T1 processor.  Successive generations have built on this approach by support for additional encryption ciphers that are tightly coupled with the Oracle Solaris 10 and Solaris 11 encryption framework.  While earlier versions of this technology were implemented using co-processors, the SPARC T4 was redesigned with new crypto instructions to eliminate some of the performance overhead associated with the former approach, resulting in much higher performance for encrypted workloads. The Superiority of the SPARC T4 Approach to Crypto As companies continue to engage in more and more e-commerce, the need to provide greater degrees of security for these transactions is more critical than ever before.  Traditional methods of securing data in transit by applications have a number of drawbacks that are addressed by the SPARC T4 cryptographic approach. 1. Performance degradation – cryptography is highly compute intensive and therefore, there is a significant cost when using other architectures without embedded crypto functionality.  This performance penalty impacts the entire system, slowing down performance of web servers (SSL), for example, and potentially bogging down the speed of other business applications.  The SPARC T4 processor enables customers to deliver high levels of security to internal and external customers while not incurring an impact to overall SLAs in their IT environment. 2. Added cost – one of the methods to avoid performance degradation is the addition of add-in cryptographic accelerator cards or external offload engines in other systems.  While these solutions provide a brute force mechanism to avoid the problem of slower system performance, it usually comes at an added cost.  Customers looking to encrypt datacenter traffic without the overhead and expenditure of extra hardware can rely on SPARC T4 systems to deliver the performance necessary without the need to purchase other hardware or add-on cards. 3. Higher complexity – the addition of cryptographic cards or leveraging load balancers to perform encryption tasks results in added complexity from a management standpoint.  With SPARC T4, encryption keys and the framework built into Solaris 10 and 11 means that administrators generally don’t need to spend extra cycles determining how to perform cryptographic functions.  In fact, many of the instructions are built-in and require no user intervention to be utilized.  For example, For OpenSSL on Solaris 11, SPARC T4 crypto is available directly with a new built-in OpenSSL 1.0 engine, called the "t4 engine."  For a deeper technical dive into the new instructions included in SPARC T4, consult Dan Anderson’s blog. Conclusion In summary, SPARC T4 systems offer customers much more value for applications than just increased performance. The integration of key virtualization technologies, embedded encryption, and a true Enterprise Operating System, Oracle Solaris, provides direct business benefits that supersedes the commodity approach to data center computing.   SPARC T4 removes the roadblocks to secure computing by offering integrated crypto accelerators that can save IT organizations in operating cost while delivering higher levels of performance and meeting objectives around compliance. For more on the SPARC T4 family of products, go to here.

    Read the article

  • JCP Open EC Meeting on 30 September 2012

    - by heathervc
    The JCP program office and Executive Committee invites all Java Community members to attend the OPEN EC Meeting on Sunday, 30 September at the Clift Hotel in San Francisco.  The meeting is adjacent to The Zone at JavaOne, but no JavaOne (or any other kind) of pass is required to attend.  It is OPEN to all!  Agenda topics include: JCP.Next status/overview of JSRs 355 and 358, improving communications between the EC and the community; Open Q&A and reminders of JCP events at JavaOne & Annual awards.  Any other suggestions?  This meeting is for you.  Let us know your questions pmo at jcp.org. Or bring them with you.  Details below. JCP Public Executive Committee Face-to-Face Meeting Open to Executive Committee Members and the Java Developer Community Location: Clift Hotel, 495 Geary Street, San Francisco - Rita Room (downstairs from Lobby) Date and Time: 9/30/12, 2:00 PM - 3:30 PM See you there.  Check out all of the JCP @ JavaOne events.

    Read the article

  • OpenJDK 6 B26 Available

    - by user9158633
    On September 21, 2012 the source bundle for OpenJDK 6 b26 was published at http://download.java.net/openjdk/jdk6/. The main changes in b26 are the latest round of security updates and a number of other fixes. For more information see the detailed list of all the changes in OpenJDK 6 B26. Test Results: All the jdk regression tests run with  make test passed on linux. cd jdk6 make make test For the current list of excluded tests see  jdk6/jdk/test/ProblemList.txt file:  ProblemList.html in B26 |  Latest ProblemList.txt (in the tip revision). Special thanks to Kelly O'Hair for his contributions to the project and Dave Katleman for his Release Engineering work.

    Read the article

  • Oracle Linux Pavilion is Back for Oracle OpenWorld

    - by Oracle OpenWorld Blog Team
    By Zeynep Koch Back by popular demand, Oracle will again host the Oracle Linux Pavilion at Oracle OpenWorld from October 1-3. The pavilion will be located in the Exhibition Hall at Moscone South, Booth 1033, next to the Oracle DEMOgrounds and Oracle Linux demopods. At the pavilion a select group of ISVs, IHVs, and SIs will showcase their products that have been Oracle Linux- and/or Oracle VM-certified. These certified products enable customer applications to run faster, thereby saving money.Partners exhibiting their solutions in the Oracle Linux Pavilion include: BeyondTrust: context-aware security intelligence for dynamic IT infrastructures such as cloud, mobile, and virtual technologies Centrify: control, secure, and audit access to cross-platform systems, mobile devices, and applications Data Intensity: cloud services and application management Fujitsu: technology platforms, private cloud, services, ubiquitous and device solutions HP: converged cloud, converged infrastructure, application transformation, and information optimization LSI: intelligent solid-state storage solutions for breakthrough database acceleration Mellanox: InfiniBand and Ethernet end-to-end server and storage interconnect solutions and services for data centers Micro Focus: mainframe solutions, application modernization and development tools, software quality tools NetApp: storage and data management QLogic: high performance networking Teleran: BI and data warehouse management solutions for Oracle Exadata Database Machine and Oracle Database Be sure to pick up your free Oracle Linux and Oracle VM DVD Kit if you visit one of these partners. We look forward to seeing you at the pavilion.

    Read the article

< Previous Page | 369 370 371 372 373 374 375 376 377 378 379 380  | Next Page >