Daily Archives

Articles indexed Tuesday June 15 2010

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 98/118 | < Previous Page | 94 95 96 97 98 99 100 101 102 103 104 105  | Next Page >

  • What to use to wait on a indeterminate number of tasks?

    - by Scott Chamberlain
    I am still fairly new to parallel computing so I am not too sure which tool to use for the job. I have a System.Threading.Tasks.Task that needs to wait for n number number of tasks to finish before starting. The tricky part is some of its dependencies may start after this task starts (You are guaranteed to never hit 0 dependent tasks until they are all done). Here is kind of what is happening Parent thread creates somewhere between 1 and (NUMBER_OF_CPU_CORES - 1) tasks. Parent thread creates task to be run when all of the worker tasks are finished. Parent thread creates a monitoring thread Monitoring thread may kill a worker task or spawn a new task depending on load. I can figure out everything up to step 4. How do I get the task from step 2 to wait to run until any new worker threads created in step 4 finish?

    Read the article

  • coldfusion class path for multiple services - only recognizing first directory

    - by ffc
    Hi, I am trying to use multiple web services on a single CF page. I have entered the stubs directory for each of the web services in the ColdFusion Class Path within administrator server settings java and jvm paths are listed separated by commas: c:\coldfusion9\stubs\ws1,c:\coldfusion9\stubs\ws2 for some reason, only the web service whose stub path is listed first will work. When I try to call the second web service, I get a "web service operation ... cannot be found" but if i switch the order of paths listed in the admin settings and restart the service, the web service listed first now will work. any ideas on how to manage multiple web services and their stubs ? thanks!

    Read the article

  • DES_KEY_SZ delphi

    - by steve0
    hey folks i am coding opera recovery tool in my delphi i am using c++ which is already exist http://pastebin.com/ViPf0yn6 but i didnt get whats DES_KEY_SZ in that code . i think they are present in des.h ,but i couldnt found same des.pas :( can any one help me please regards

    Read the article

  • cygwin sed substitution against commands in history

    - by Ira
    I couldn't find an answer for this exact problem, so I'll ask it. I'm working in Cygwin and want to reference previous commands using !n notation, e.g., if command 5 was which ls, then !5 runs the same command. The problem is when trying to do substitution, so running: !5:s/which \([a-z]\)/\1/ should just run ls, or whatever the argument was for which for command number 5. I've tried several ways of doing this kind of substitution and get the same error: bash: :s/which \([a-z]*\)/\1/: substitution failed

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Firefox and Flash requires 2 clicks after Scrolling?

    - by Kerry
    I've noticed this with me and my partners computers, take a look at this: http://www.uploadify.com/demo/ Those buttons are flash. If you scroll (scroll to the bottom then back up, using your mouse scroll) then hover over a button, it is a normal pointer, not a hand. If you click on the button, then it turns into a hand, then you can click on it to trigger the browse files window. Is there any way to fix this? Is this a Firefox bug (doesn't happen in Chrome or IE8)?

    Read the article

  • virtual box strectch to fit resolution

    - by Scarface
    Hey guys I have a really annoying problem, that I hope someone has figured out. I just installed ubuntu on virtual box and installed the guest additions so everything was great. I had a resolution that stretched across my screen from left to right and the only virtual box components that were visible were the windows vista title bar : minimize/exit/maximize buttons and virtual box controls at the bottom. Now all of a sudden now that I have installed the ubuntu 170mb of automatic updates, I see vertical and horizontal scroll bars that are part of virtual box and the ubuntu resolution will not stretch across my screen anymore. What I want is a ubuntu resolution that will stretch to fit the maximized window of virtual box, and remove the scroll bars. If anyone has any ideas, I would really appreciate it.

    Read the article

  • Mint Linux - Downgrade Java to 1.5

    - by Chrisc
    Hello, I posted this over at stack overflow, but had a suggestion to post it here for better help. Currently, I am running Mint Linux (Release 9). I need to downgrade Java from version 1.6 to 1.5, and have been trying to figure out how to go about this. So far, I've had no luck. The package manager doesn't seem to have it. Does anyone have any suggestions? Thanks, - Chris

    Read the article

  • How to temporary disable a mirror video driver in windows xp registry

    - by happy clicker
    Because its a lot of text, I will ask first my question and then explain what the base problem is. Perhaps someone can give me a solution to the base problem: Is there is a way to temporary disable mirror video drivers (through registry or so), without uninstalling the corresponding software. I tested changing the enumeration in LocalMachine\Hardware\DeviceMap\Video but after reboot always the old configuration is restored. Explanation of the base problem We are working on a wpf-project for a department of a big company. There we have the problem that WPF renders only in software mode, although the hardware they have, must support hardware rendering (Tier 2). After searching for a solution to the problem, we found out that direct 3d does not work properly and we think thats why WPF can only use SW-rendering. In dxdiag.exe the direct3d-acceleration is enabled, but if we start the test-routine it always fails saying that it has not enough memory (it says memory, not video memory!). I have seen there 3 different types of pc’s (they have some hundreds of each type) and every type shows the exactly same behavior. We tried to update all the drivers, also dx (Version 9.0c) and we searched a lot in the web but could not find a solution. All the pcs have Intel Dual-Core processors or better, one type has an Intel gma 9000 graphics card the other two types have actual ATI and NVidia graphic-cards with 256MB onboard memory. Also the system memory is at least 2GB. Windows is XPSP3. The pc’s are of two different manufacturers. Because we see the exactly same behavior on every computer of this three very different computer-types, we don’t think that this is a driver or a direct x problem. What we’ve found in other newsgroups is, that direct x could be disturbed through mirror-video drivers such as NetMeeting, VNC and other remote desktop-installations. In the registry, we see under LocalMachine\Hardware\DeviceMap\Video a lot of such mirror-entries and we find also the definitions in the CurrentControlSet\Control\Video-Section (However this drivers are not shown in the hardware panel of the os). We can have admin-rights to one of these computers to test if disabling these drivers would help, but we must not change the configuration so that some software does not work after the tests. Therefore I cannot uninstall any software because I have not the mediums, licenses or knowhow to reinstall those apps. The support of this company however will only begin to work, if I can tell them what the real problem is. Thats why we search for a way to disable these mirror-drivers (or a hint to solve the dx problem if we are on a false trace)

    Read the article

  • Makefile and rm -f file.{ext1,ext2,ext3} issue

    - by ak91
    Hello, Could you explain me, why Makefile rule: clean: rm -f foo.{bar1,bar2,bar3} does not result in removing files: foo.bar1 foo.bar2 and foo.bar3? I believe I saw pattern like that many times in various Makefiles, but I'm currently writing my own Makefile and can't make that rule work correctly (no files are removed). I'm using: gnu make 3.81 gnu bash 4.1.5 Bash evals that pattern as I suspect: $ echo test.{a,b,c} test.a test.b test.c Thanks!

    Read the article

  • Perl, get all hash values

    - by Mike
    Let's say in Perl I have a list of hash references, and each is required to contain a certain field, let's say foo. I want to create a list that contains all the mappings of foo. If there is a hash that does not contain foo the process should fail. @hash_list = ( {foo=>1}, {foo=>2} ); my @list = (); foreach my $item (@hash_list) { push(@list,$item->{foo}); } #list should be (1,2); Is there a more concise way of doing this in Perl?

    Read the article

  • If/Then in SQL Embedded in VBA

    - by Daniel
    I've got a string like this in my Excel VBA: strSQL = "SELECT * FROM Total WHERE (SimulationID = (" & TextBox1.Text & ") And Test1 = (" & Example & "))" However, sometimes Test will be 'is null', which makes the query And Example = is NULL How can I change it to add an if/then statement or something to make it say And Example is null when Example has a value of "is null"?

    Read the article

  • Handling return value from Web Service Call Wrapper

    - by coffeeaddict
    I created this method below which makes an HTTP call to a 3rd party API. I just want opinions on if I'm handling this the best way. If the call fails, I need to return the ExistsInList bool value only if the response is not null. But in the last return statement, wouldn't I have to essentially do another return selectResponse == null ? false : selectResponse.ExistsInList; to check for null first just like the previous return in the catch? Just seems redundant the way I'm approaching this and I don't know if I really need to check for null again in the final return but I figure yes, because you can't always rely on the response to give you a valid response even if there were no errors picked up. public static bool UserExistsInList(string email, string listID) { SelectRecipientRequest selectRequest = new SelectRecipientRequest(email, listID); SelectRecipientResponse selectResponse = null; try { selectResponse = (SelectRecipientResponse)selectRequest.SendRequest(); } catch (Exception) { return selectResponse == null ? false : selectResponse.ExistsInList; } return selectResponse.ExistsInList; }

    Read the article

  • How to read any email account from a domain using C#?

    - by Brendan Enrick
    I guess this is sort of two questions that are tied together. Related questions have discussed how to read and parse email using pop3. I need to be able to do this, however, I want this to be able to work with any email address I need. I am trying to allow users to submit content by emailing it to a unique email address, which will automatically know to which account the content should be associated. Is there a good way to create these email addresses on the fly and check these email accounts so for content submissions? Alternatively is there a way to make a "wildcard" email account which gets all of the email sent to the domain and allows me to see what the to address was?

    Read the article

  • How to tell MATLAB to open and save specific files in the same directory

    - by its-me
    I have to run an image processing algorithm on numerous images in a directory. An image is saved as name_typeX.tif, so there are X different type of images for a given name. The image processing algorithm takes an input image and outputs an image result. I need to save this result as name_typeX_number.tif, where 'number' is also an output from the algorithm for a given image. Now.. How do I tell MATLAB to open a specific 'typeX' file? Also note that there are other non-tif files in the same directory. How to save the result as name_typeX_number.tif? The results have to be saved in the same directory where the input images are present. How do I tell MATLAB NOT to treat the results that have been saved as an input images? I have to run this as background code on a server... so no user inputs allowed Thanks

    Read the article

  • iterating through an array

    - by Farstucker
    Iterating though an array isn’t a problem but what if I only wanted to incremented only when the method is called? Im not even sure if this would work but is there an easier way of doing this int counter; string[] myArray = {"foo", "bar", "something", "else", "here"}; private string GetNext() { string myValue = string.Empty; if (counter < myArray.Length) { myValue = myArray [counter]; } else { counter = 0; } counter++; return myValue; }

    Read the article

  • Struts2 Converting Enum Array fills array with single null value

    - by Kyle Partridge
    For a simple action class with these member variables: ... private TestConverterEnum test; private TestConverterEnum[] tests; private List<TestConverterEnum> tList; ... And a simple enum: public enum TestConverterEnum { A, B, C; } Using the default struts2 enum conversion, when I send the request like so: TestConterter.action?test=&tests=&tList=&b=asdf For test I get a null value, which is expected. For the Array and List, however, I get and Array (or list) with one null element. Is this what is expected? Is there a way to prevent this. We recently upgraded our struts2 version, and we had our own converters, which also don't work in this case, so I was hoping to use the default conversion method. We already have code that is validating these arrays for null and length, and I don't want to have to add another condition to these branches. Is there a way to prevent this bevavior?

    Read the article

  • Isn't it better to create the subview hierarchy in -viewDidLoad rather than in -loadView?

    - by dontWatchMyProfile
    The docs say that the whole subview hierarchy can be created in -loadView. But there's also this -viewDidLoad method which sounds nice to ovewrite for actually building the hierarchy, when the view loaded. I guess it's a matter of taste only. But maybe doing so in -viewDidLoad hast the advantage that the view controller already adjusted the frame of the view correctly to accomodate for the status bar or any other kind of bar like tab bar or tool bar?

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 94 95 96 97 98 99 100 101 102 103 104 105  | Next Page >