Search Results

Search found 16807 results on 673 pages for 'david given'.

Page 10/673 | < Previous Page | 6 7 8 9 10 11 12 13 14 15 16 17  | Next Page >

  • Find model records by ID in the order the array of IDs were given

    - by defaye
    I have a query to get the IDs of people in a particular order, say: ids = [1, 3, 5, 9, 6, 2] I then want to fetch those people by Person.find(ids) But they are always fetched in numerical order, I know this by performing: people = Person.find(ids).map(&:id) => [1, 2, 3, 5, 6, 9] How can I run this query so that the order is the same as the order of the ids array? I made this task more difficult as I wanted to only perform the query to fetch people once, from the IDs given. So, performing multiple queries is out of the question. I tried something like: ids.each do |i| person = people.where('id = ?', i) But I don't think this works.

    Read the article

  • Compact a given array problem

    - by Bragaadeesh
    Dont know whether this is a duplicate, but this was an interview question asked to me. Given an array of random numbers and -1 placed inbetween, I have to compact the array meaning all the -1s are to be replaced and the final output should be the last valid index with the fresh array. For example. Input: 3 4 -1 -1 -1 5 8 -1 8 Output: 3 4 5 8 8 5 8 -1 8 and last valid index is 4 Input: -1 -1 -1 -1 -1 2 Output: 2 -1 -1 -1 -1 2 and last valid index is 0 Input: -1 -1 -1 3 3 3 Output: 3 3 3 3 3 3 and last valid index is 2 You should not swap the values just the last valid index along with the array is enough to decipher the non negative values.

    Read the article

  • Dynamically determining table name given field name in SQL server

    - by Salman A
    Strange situation: I am trying to remove some hard coding from my code. There is a situation where I have a field, lets say "CityID", and using this information, I want to find out which table contains a primary key called CityID. Logically, you'd say that it's probably a table called "City" but it's not... that table is called "Cities". There are some other inconsistencies in database naming hence I can never be sure if removing the string "ID" and finding out the plural will be sufficient. Note: Once I figure out that CityID refers to a table called Cities, I will perform a join to replace CityID with city name on the fly. I will appreciate if someonw can also tell me how to find out the first varchar field in a table given its name.

    Read the article

  • Flex: Result event given multiple times

    - by Tom
    Hello everybody!! I am trying to learn Flex and now i have the next code: http://pastebin.com/rZwxF7w1 This code is for my login component. I want to get a special string for encrypting my password. This string is given by my authservice. But when i login i get a multiple times a alert with Done(line 69 in the pastebin code or line 4 in the code on the bottom of this question). But i want that it shows one single time. Does someone know what is wrong with this code? Tom protected function tryLogin():void { encryptStringResult.addEventListener('result', function(event:ResultEvent):void { var encryptString:String = event.result.toString(); Alert.show('Done'); }); encryptStringResult.token = auth.getEncryptString(); }

    Read the article

  • calculating a gps coordinate given a point, bearing and distance

    - by user530509
    Hello, I have a problem which draws my back in some project for some time now. Im basically looking to trap a polygon using x,y points drawn by some script ive written. lat1,lon1 are the center gps cords of the polygon and im looking for its surrounding polygon. here is a part of my code in python: def getcords(lat1,lon1,dr,bearing): lat2=asin(sin(lat1)*cos(dr)+cos(lat1)*sin(dr)*cos(bearing)) lon2=lon1+atan2(sin(bearing)*sin(dr)*cos(lat1),cos(dr)-sin(lat1)*sin(lat2)) return [lat2,lon2] my input goes like this: lat1,lon1 - are given in decimal degrees. -dr is the angular computed by dividing the distance in miles by the earth's -raiuds(=3958.82) -bearing between 0-360 degrees. however for the input getcorsds1(42.189275,-76.85823,0.5/3958.82,30) i get [-1.3485899508698462, -76.8576637627568], however [42.2516666666667,-76.8097222222222] is the right answer. as for the angular distance i calculate it simply by dividing the distance in miles by the earth's raiuds(=3958.82). anybody?

    Read the article

  • What is the better approach to find if a given set is a perfect subset of a set - If given subset is

    - by Microkernel
    Hi guys, What is the best approach to find if a given set(unsorted) is a perfect subset of a main set. I got to do some validation in my program where I got to compare the clients request set with the registered internal capability set. I thought of doing by having internal capability set sorted(will not change once registered) and do Binary search for each element in the client's request set. Is it the best I could get? I suspected that there might be better approach. Any idea? Regards, Microkernel

    Read the article

  • Python: Getting the attribute name that the created object will be given

    - by cool-RR
    Before I ask this, do note: I want this for debugging purposes. I know that this is going to be some bad black magic, but I want to use it just during debugging so I could identify my objects more easily. It's like this. I have some object from class A that creates a few B instances as attributes: class A(object): def __init__(self) self.vanilla_b = B() self.chocolate_b = B() class B(object): def __init__(self): # ... What I want is that in B.__init__, it will figure out the "vanilla_b" or whatever attribute name it was given, and then put that as the .name attribute to this specific B. Then in debugging when I see some B object floating around, I could know which one it is. Is there any way to do this?

    Read the article

  • Given a Member Access lambda expression, convert it to a specific string representation with full ac

    - by Nathan
    Given an Expression<Func<T, object>> (e.g. x = x.Prop1.SubProp), I want to create a string "Prop1.SubProp" for as deep as necessary. In the case of a single access (e.g. x = x.Prop1), I can easily do this with: MemberExpression body = (expression.Body.NodeType == ExpressionType.Convert) ? (MemberExpression)((UnaryExpression)expression.Body).Operand : (MemberExpression)expression.Body; return body.Member.Name; However, if there is deeper nesting, e.g. x = x.Prop1.SubProp1, this only gets the most deeply nested name, e.g. "SubProp1" instead of "Prop1.SubProp1" Is there anyway to access the full property path of a lambda expression?

    Read the article

  • Continue NSURLConnection/NSURLRequest from a given Byte

    - by Sj
    I am working with a web service right now that requires me to upload video binaries straight to their web form via the iPhone SDK. Simple enough. The part that is getting me though is when the connection is interrupted, they want me to be able to continue the upload from a given byte. So here is what I have: the original data & the last byte uploaded What I need to know: how can I continue the data from that byte? I seems like it would be something similar to truncating NSData by the byte but I do not know how to do that for an NSURLConnection/NSURLRequest. Thank you!

    Read the article

  • smallest perimiter rectangle with given integer area and integer sides

    - by remuladgryta
    Given an integer area A, how can one find integer sides w and h of a rectangle such that w*h = A and w+h is as small as possible? I'd rather the algorithm be simple than efficient (although within reasonable efficiency). What would be the best way to accomplish this? Finding out the prime factors of A, then combining them in some way that tries to balance w and h? Finding the two squares with integer sides with areas closest to A and then somehow interpolating between them? Any other method i'm not thinking of?

    Read the article

  • Best approach to limit users to a single node of a given content type in Drupal

    - by Chaulky
    I need to limit users to a single node of a given content type. So a user can only create one node of TypeX. I've come up with two approaches. Which would be better to use... 1) Edit the node/add/typex menu item to check the database to see if the user has already created a node of TypeX, as well as if they have permissions to create it. 2) When a user creates a node of TypeX, assign them to a different role that doesn't have permissions to create that type of node. In approach 1, I have to make an additional database call on every page load to see if they should be able to see the "Create TypeX" (node/add/typex). But in approach 2, I have to maintain two separate roles. Which approach would you use?

    Read the article

  • How to extract link when given partial link value

    - by mrjames
    hi, I am using PHP 4, that is what the host has at the moment. How can I extract link from a string when given part of the link to find. Example $find_string = 'http://www.mysite.com/apple'; $string = 'Something and something else < a href="http://www.mysite.com/apple_banana"testlink< /a something else and so forth < a href="http://www.mysite.com/orange"orange< /a In this case I would like to extract only the links that has http:// www.mysite.com/apple in it so it would retrieve http://www.mysite.com/apple_bananan Any help would be greatly appreciated.

    Read the article

  • ASP.NET/VB/SQL: trying to insert data, getting error "no value given for required parameters"

    - by Sara
    I am pretty sure this is a basic syntax error, I am new at this and basically figuring things out by trial and error... I am trying to insert data from textboxes into an Access database, where the primary key fields in tableCourse are prefix and course_number. It keeps giving me the "no value given for one or more required parameters" error. Here is my codebehind: Protected Sub Wizard1_FinishButtonClick(ByVal sender As Object, ByVal e As System.Web.UI.WebControls.WizardNavigationEventArgs) Handles Wizard1.FinishButtonClick 'Collect Data Dim myDept = txtDept.Text Dim myFirst = txtFirstName.Text Dim myLast = txtLastName.Text Dim myPrefix = txtCoursePrefix.Text Dim myNum = txtCourseNum.Text 'Define Connection Dim myConn As New OleDbConnection myConn.ConnectionString = AccessDataSource1.ConnectionString 'Create commands Dim myIns1 As New OleDbCommand("INSERT INTO tableCourse (department, name_first, name_last, prefix, course_number) VALUES (@myDept, @myFirst, @myLast, @myPrefix, @myNum)", myConn) 'Execute the commands myConn.Open() myIns1.ExecuteNonQuery() End Sub

    Read the article

  • Selecting item from set given distribution

    - by JH
    I have a set of X items such as {blower, mower, stove} and each item has a certain percentage of times it should be selected from the overall set {blower=25%,mower=25%,stove=75%} along with a certain distribution that these items should follow (blower should be selected more at the beginning of selection and stove more at the end). We are given a number of objects to be overall selected (ie 100) and a overall time to do this in (say 100 seconds). I was thinking of using a roulette wheel algorithm where the weights on the wheel are affected by the current distribution as a function of the elapsed time (and the allowed duration) so that simple functions could be used to determine the weight. Are there any common approaches to problems like this that anyone is aware of? Currently i have programmed something similar to this in java using functions such as x^2 (with correct normalization for the weights) to ensure that a good distribution occurs. Other suggestions or common practices would be welcome :-)

    Read the article

  • Count number of given object in a list with LINQ

    - by Aaginor
    I have a list which can contain multiple occurrences of the same object. Now I need to count, how often the given object is contained in this list. int count = 0; foreach (IMyObject item in myList) if (item == object2Count) count++; I am sure that this can be done nicer with LINQ, but LINQ is still a mystery to me. My first question is: How would I count the objects via LINQ and the second question: Will this LINQ version be slower or faster? I am using a ObservableCollection and the number of items in the list is usally rather small ... usally not more then 20. Thanks in advance, Frank

    Read the article

  • Partition a rectangle into near-squares of given areas

    - by Marko Dumic
    I have a set of N positive numbers, and a rectangle of dimensions X and Y that I need to partition it in N smaller rectangles such that: the surface area of each smaller rectangle is proportional to it's corresponding number in given set all space of big rectangle is occupied and there is no leftover space between smaller rectangles each small rectangle should be shaped as close to square as feasible the execution time should be reasonably small I need directions on this. Do you know of such algorithm described on the web? Do you have any ideas (pseudo-code is fine)? Thanks.

    Read the article

  • How to find the largest power of 2 less than the given number

    - by nazar_art
    I need to find the largest power of 2 less than the given number. And I stuck and can't find any solution. Code: public class MathPow { public int largestPowerOf2 (int n) { int res = 2; while (res < n) { res =(int)Math.pow(res, 2); } return res; } } This doesn't work correctly. Testing output: Arguments Actual Expected ------------------------- 9 16 8 100 256 64 1000 65536 512 64 256 32 How to solve this issue?

    Read the article

  • Finding the index of a given value in a pre-sorted array

    - by bobo
    Today, I went for an interview and the interviewer asked me how I would find the index of a given value (number) in a pre-sorted array like this: $preSortedArr=array(23,32,36,41,45,54); He also said that using recursion is not allowed. I think the function should look like this: function findIndexByValue($preSortedArray,$value){ //some codes here } What solution do you think he was expecting from me? EDIT: sorry, I forgot to add that, he originally asked me to write psuedo codes but I said I don't know. I tried to write in PHP, but I think he's expecting a language-independent solution.

    Read the article

  • Given a document select a relevant snippet.

    - by BCS
    When I ask a question here, the tool tips for the question returned by the auto search given the first little bit of the question, but a decent percentage of them don't give any text that is any more useful for understanding the question than the title. Does anyone have an idea about how to make a filter to trim out useless bits of a question? My first idea is to trim any leading sentences that contain only words in some list (for instance, stop words, plus words from the title, plus words from the SO corpus that have very weak correlation with tags, that is that are equally likely to occur in any question regardless of it's tags)

    Read the article

  • Count double palindromes in given int sequence

    - by jakubmal
    For a given int sequence check number of double palindromes, where by double palindrome we mean sequence of two same palindromes without break between them. So for example: in 1 0 1 1 0 1 we have 1 0 1 as a palindrome which appears 2 times without a break, in 1 0 1 5 1 0 1 we have 1 0 1 but it's separated (apart from the other palindromes in these sequences) Problem example test data is: 3 12 0 1 1 0 0 1 1 0 0 1 1 0 12 1 0 1 0 1 0 1 0 1 0 1 0 6 3 3 3 3 3 3 with answers 8 0 9 Manacher is obvious for the begging, but I'm not sure what to do next. Any ideas appreciated. Complexity should be below n^2 I guess. EDIT: int is here treated as single element of alphabet

    Read the article

  • TypeError: init_animals() takes 1 positional arguments but 2 were given

    - by libra
    I know this title look familiar to some old questions, but i've looked at every single one of them, none of them solves. And here is my codes: class Island (object):E,W,R,P def __init__(self, x, y): self.init_animals(y) def init_animals(y): pass isle = Island(x,y) However, i got the following error: Traceback (most recent call last): File "<stdin>", line 1, in <module> File "<stdin>", line 3, in __init__ TypeError: init_animals() takes 1 positional arguments but 2 were given Please tell me if i got any mistakes, im so confused by this. Best regards

    Read the article

  • Returning and instance of a Class given its .class (MyClass.class)

    - by jax
    I have an enum that will hold my algorithms. I cannot instantiate these classes because I need the application context which is only available once the application has started. I want to load the class at runtime when I choose by calling getAlgorithm(Context cnx). How do I easily instantiate a class at runtime given its .class (and my constructor takes arguments)? All my classes are subclasses of Algorithm. public enum AlgorithmTypes { ALL_FROM_9_AND_LAST_FROM_10_ID(AlgorithmFactory.AlgorithmAllFrom9AndLastFrom10Impl.class), ALL_FROM_9_AND_LAST_FROM_10_CURRENCY_ID(AlgorithmFactory.AlgorithmAllFrom9AndLastFrom10Impl.class), DIVIDE_BY_9_LESS_THAN_100(AlgorithmFactory.AlgorithmAllFrom9AndLastFrom10Impl.class), TABLES_BEYOND_5_BY_5(AlgorithmFactory.AlgorithmAllFrom9AndLastFrom10Impl.class); private Class<? extends Algorithm> algorithm; AlgorithmTypes(Class<? extends Algorithm> c) { algorithm = c; } public Algorithm getAlgorithm(Context cnx) { return //needs to return the current algoriths constructor which takes the Context Algorithm(Context cnx); } }

    Read the article

  • R: Given a set of random numbers drawn from a continuous univariate distribution, find the distribut

    - by knorv
    Given a set of real numbers drawn from a unknown continuous univariate distribution (let's say is is one of beta, Cauchy, chi-square, exponential, F, gamma, Laplace, log-normal, normal, Pareto, Student's t, uniform and Weibull).. x <- c(15.771062,14.741310,9.081269,11.276436,11.534672,17.980860,13.550017,13.853336,11.262280,11.049087,14.752701,4.481159,11.680758,11.451909,10.001488,11.106817,7.999088,10.591574,8.141551,12.401899,11.215275,13.358770,8.388508,11.875838,3.137448,8.675275,17.381322,12.362328,10.987731,7.600881,14.360674,5.443649,16.024247,11.247233,9.549301,9.709091,13.642511,10.892652,11.760685,11.717966,11.373979,10.543105,10.230631,9.918293,10.565087,8.891209,10.021141,9.152660,10.384917,8.739189,5.554605,8.575793,12.016232,10.862214,4.938752,14.046626,5.279255,11.907347,8.621476,7.933702,10.799049,8.567466,9.914821,7.483575,11.098477,8.033768,10.954300,8.031797,14.288100,9.813787,5.883826,7.829455,9.462013,9.176897,10.153627,4.922607,6.818439,9.480758,8.166601,12.017158,13.279630,14.464876,13.319124,12.331335,3.194438,9.866487,11.337083,8.958164,8.241395,4.289313,5.508243,4.737891,7.577698,9.626720,16.558392,10.309173,11.740863,8.761573,7.099866,10.032640) .. is there some easy way in R to programmatically and automatically find the most likely distribution and the estimated distribution parameters?

    Read the article

  • finding the numbers in a given range?

    - by Jamis
    Hi Friends, kindly tel me the concept to write a perl program behind this ? 167 GATCAAAATACTTGCTGGA 185 192 TAGTAGATAGATAGATAGTAGTAG 228 in a fileA i ve a range from 167 to 185 as given as above and also 192 to 228 in another fileB i ve set of numbers 2 3 4 5 6 7 8 168 169 179 185 193 1000 now from the above set of numbers in file B, i need to find out which are the numbers present between the range of 167 to 185 and print those numbers in the output. so, output will be 168,169,179,185, 193 what will be the concept behind writing this program?

    Read the article

< Previous Page | 6 7 8 9 10 11 12 13 14 15 16 17  | Next Page >