Search Results

Search found 858 results on 35 pages for 'vincent of earth'.

Page 10/35 | < Previous Page | 6 7 8 9 10 11 12 13 14 15 16 17  | Next Page >

  • Graceful termination of NSApplication with Core Data and Grand Central Dispatch (GCD)

    - by Vincent Mac
    I have an Cocoa Application (Mac OS X SDK 10.7) that is performing some processes via Grand Central Dispatch (GCD). These processes are manipulating some Core Data NSManagedObjects (non-document-based) in a manner that I believe is thread safe (creating a new managedObjectContext for use in this thread). The problem I have is when the user tries to quit the application while the dispatch queue is still running. The NSApplication delegate is being called before actually quitting. - (NSApplicationTerminateReply)applicationShouldTerminate:(NSApplication *)sender I get an error "Could not merge changes." Which is somewhat expected since there are still operations being performed through the different managedObjectContext. I am then presented with the NSAlert from the template that is generated with a core data application. In the Threading Programming Guide there is a section called "Be Aware of Thread Behaviors at Quit Time" which alludes to using replyToApplicationShouldTerminate: method. I'm having a little trouble implementing this. What I would like is for my application to complete processing the queued items and then terminate without presenting an error message to the user. It would also be helpful to update the view or use a sheet to let the user know that the app is performing some action and will terminate when the action is complete. Where and how would I implement this behavior?

    Read the article

  • How to debug packet loss ?

    - by Gene Vincent
    I wrote a C++ application (running on Linux) that serves an RTP stream of about 400 kbps. To most destinations this works fine, but some destinations expericence packet loss. The problematic destinations seem to have a slower connection in common, but it should be plenty fast enough for the stream I'm sending. Since these destinations are able to receive similar RTP streams for other applications without packet loss, my application might be at fault. I already verified a few things: - in a tcpdump, I see all RTP packets going out on the sending machine - there is a UDP send buffer in place (I tried sizes between 64KB and 300KB) - the RTP packets mostly stay below 1400 bytes to avoid fragmentation What can a sending application do to minimize the possibility of packet loss and what would be the best way to debug such a situation ?

    Read the article

  • Zend_Soap_Client - Ignore HTTPS verification

    - by Vincent
    All, I want to use Zend_Soap_Client class to load WSDL from an HTTPS url. Currently, if I call like this, it gives me an error even if the WSDL is perfectly valid: $wsdlUrl = "https://abc.xyz.com/webservices/WeatherService.php?wsdl"; $soapClient = new Zend_Soap_Client($wsdlUrl); The error I receive is: SOAP-ERROR: Parsing WSDL: Couldn't load from 'https://abc.xyz.com/webservices /WeatherService.php?wsdl' : Start tag expected, '<' not found If I browse to the WSDL url in the browser, it loads up the WSDL just fine. I think Zend_Soap_Client is trying to validate the certificate and failing. Is there a way to set the SOAP option to ignore the HTTPS verification and just load the WSDL? Thanks

    Read the article

  • Jquery - Loop through Checkboxes and Multiple elements

    - by Vincent
    All, I have a set of elements like this in a form: <input type="checkbox" name="chk[140]"> <input type="hidden" value="3" name="ctcount[140]"> <input type="hidden" value="Apples" name="catname[140]"> <input type="checkbox" name="chk[142]"> <input type="hidden" value="20" name="ctcount[142]"> <input type="hidden" value="Bananas" name="catname[142]"> <input type="checkbox" name="chk[144]"> <input type="hidden" value="200" name="ctcount[144]"> <input type="hidden" value="Strawberries" name="catname[144]"> <input type="checkbox" name="chk[145]"> <input type="hidden" value="0" name="ctcount[145]"> <input type="hidden" value="Carrots" name="catname[145]"> When a user clicks a button, I want the Javascript to: 1. Loop through all the checkboxes 2. For all the checked checkboxes, 2a. Get ctcount value 2b. Get catname value 2c. If ctcount value > 50, alert a message saying "Unable to add item as max limit for 'catname' has reached. 2d. Break the loop after it encountered first ctcount value that is greater than 50. I am new to JQuery..have the following code so far: var checklimit = 50; $('#frmTest input:checkbox:checked').each(function(i) { alert(this.value); }); How do I do this using JQuery? Thanks

    Read the article

  • CURL - https - solaris

    - by Vincent
    All, I am receiving the following error when I use PHP to curl to a https site. Both PHP and the https site are hosted on Solaris. This error seems to occur occassionally but frequently. error:80089077:lib(128):func(137):reason(119) This is the curl code I am using: $ch = curl_init(); $devnull = fopen('/tmp/cookie.txt', 'w'); curl_setopt($ch, CURLOPT_STDERR, $devnull); curl_setopt($ch, CURLOPT_POST, 1); curl_setopt($ch, CURLOPT_URL, $desturl); curl_setopt($ch, CURLOPT_RETURNTRANSFER, 1); curl_setopt($ch, CURLOPT_SSL_VERIFYPEER, false); curl_setopt($ch, CURLOPT_SSL_VERIFYHOST, false); curl_setopt($ch, CURLOPT_HEADER, false); curl_setopt($ch, CURLOPT_FOLLOWLOCATION, 0); curl_setopt($ch, CURLOPT_CONNECTTIMEOUT,800); curl_setopt($ch, CURLOPT_AUTOREFERER, true); curl_setopt($ch, CURLOPT_ENCODING, 'gzip,deflate'); curl_setopt($ch, CURLOPT_POSTFIELDS, $postdata); $retVal = curl_exec($ch); print_r(curl_error($ch)); curl_close($ch); if ($devnull) { fclose($devnull); } How can I fix this error? If not, is there an alternative to curl?

    Read the article

  • Solve the IE select overlap bug

    - by Vincent Robert
    When using IE, you cannot put an absolutely positioned div over a select input element. That's because the select element is considered an ActiveX object and is on top of every HTML element in the page. I already saw people hiding selects when opening a popup div, that leads to pretty bad user experience having controls disappearing. FogBugz actually had a pretty smart solution (before v6) of turning every select into text boxes when a popup was displayed. This solved the bug and tricked the user eye but the behavior was not perfect. Another solution is in FogBugz 6 where they no more use the select element and recoded it everywhere. Last solution I currently use is messing up the IE rendering engine and force it to render the absolutely positioned div as an ActiveX element too, ensuring it can live over a select element. This is achieved by placing an invisible iframe inside the div and styling it with: #MyDiv iframe { position: absolute; z-index: -1; filter: mask(); border: 0; margin: 0; padding: 0; top: 0; left: 0; width: 9999px; height: 9999px; overflow: hidden; } Anyone has a even better solution than this one ? EDIT: The purpose of this question is as much informative as it is a real question. I find the iframe trick to be a good solution but I am still looking for improvement like removing this ugly useless iframe tag that degrade accessibility.

    Read the article

  • CSS for https urls

    - by Vincent
    Hello, looking for some help with images referenced within the stylesheet. I have no problems with these from non secure locations within the site but only from https. The stylesheet loads fine and displays everything correctly except for the images. example: body { margin: 0; padding: 0; background: url(/img/background_tile.gif) top left repeat-x; text-align: center; background-color: #fff; } All my css files and other image paths inside the code use relative urls to images. How can I make sure they all work fine without hard coding my image paths with https or http? I want the code to work fine with http and https. Thanks

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Pear SOAP and XAMPP on Ubuntu

    - by Vincent
    All, I have installed xampp for linux on ubuntu 9.10. The installation directory is /opt/lampp. The xampp website says PEAR comes with the installation.. I am relatively new to PEAR and want to know the answers for following: Is PEAR installed with xampp or need to be installed separately using synaptic package manager? I browse to /opt/lampp/bin directory and see "pear" there, but when i type it in the command line, it says "The program 'pear' is currently not installed. You can install it by typing: sudo apt-get install php-pear pear: command not found " I want to use PEAR:SOAP package in my PHP code. How to use that? Do I need to set any paths to the pear in my php.ini? Thanks

    Read the article

  • merge() multiple data frames (do.call ?)

    - by Vincent
    Hi everyone, here's my very simple question: merge() only takes two data frames as input. I need to merge a series of data frames from a list, using the same keys for every merge operation. Given a list named "test", I want to do something like: do.call("merge", test). I could write some kind of loop, but I'm wondering if there's a standard or built-in way to do this more efficiently. Any advice is appreciated. Thanks! Here's a subset of the dataset in dput format (note that merging on country is trivial in this case, but that there are more countries in the original data): test <- list(structure(list(country = c("United States", "United States", "United States", "United States", "United States"), NY.GNS.ICTR.GN.ZS = c(13.5054687, 14.7608697, 14.1115876, 13.3389063, 12.9048351), year = c(2007, 2006, 2005, 2004, 2003)), .Names = c("country", "NY.GNS.ICTR.GN.ZS", "year"), row.names = c(NA, 5L), class = "data.frame"), structure(list( country = c("United States", "United States", "United States", "United States", "United States"), NE.TRD.GNFS.ZS = c(29.3459277, 28.352838, 26.9861939, 25.6231246, 23.6615328), year = c(2007, 2006, 2005, 2004, 2003)), .Names = c("country", "NE.TRD.GNFS.ZS", "year"), row.names = c(NA, 5L), class = "data.frame"), structure(list( country = c("United States", "United States", "United States", "United States", "United States"), NY.GDP.MKTP.CD = c(1.37416e+13, 1.31165e+13, 1.23641e+13, 1.16309e+13, 1.0908e+13), year = c(2007, 2006, 2005, 2004, 2003)), .Names = c("country", "NY.GDP.MKTP.CD", "year"), row.names = c(NA, 5L), class = "data.frame"))

    Read the article

  • Launch Apple's Stocks app, with a particular stock selected

    - by Vincent Gable
    I would like to launch Apple's Stocks app to show information for a particular stock, on a non-jailbroken phone. I'm not interesting in how to get a quote or graph a stock myself, just opening Stocks.app. I was hoping that the Stocks app would have a custom URL format, so opening a URL like stocks://AAPL would do the trick. But I haven't found anything documenting such a scheme, and suspect it doesn't exist. Any other ideas, or is it impossible to integrate with the native Stocks app?

    Read the article

  • Updating with Related Entities - Entity Framework v4

    - by Vincent BOUZON
    Hi, I use Entity Framework V4 and i want to update Customer who have Visits. My code : EntityKey key; object originalItem; key = this._modelContainer.CreateEntityKey("Customers", customer); if (this._modelContainer.TryGetObjectByKey(key, out originalItem)) { this._modelContainer.ApplyCurrentValues(key.EntitySetName, customer); } this._modelContainer.SaveChanges(); It works for Scalar Property only. The customers.Visits collection is not updated. Best Regards :)

    Read the article

  • JQuery - Nested AJAX

    - by Vincent
    All, I am trying to perform a nested AJAX call using the following code. The nested call doesn't seem to work. Am I doing anything wrong? $.ajax({ type: 'GET', url: "/public/customcontroller/dosomething", cache: false, dataType: "html", success: function(html_input) { $.ajax({ type: 'GET', url: "/public/customcontroller/getjobstatus", cache: false, dataType: "html", success: function(html_input){ alert(html_input); } }); } }); Thanks

    Read the article

  • Ruby use method only if condition is true

    - by Vincent
    So I have this code: class Door # ... def info attr = "" return { "width" => @width, "height" => @height, "color" => @color }[attr] if attr != "" end end mydoor = Door.new(100, 100, "red") puts mydoor.info("width") puts mydoor.info The method "info" should return the hash if no argument is provided, otherwise the value of the argument in the hash. How can I achieve that?

    Read the article

  • SQL Server: Check if table exists

    - by Vincent
    I would like this to be the ultimate discussion on how to check if a table exists in SQL Server 2000/2005 using SQL Statement. When you Google for the answer, you get so many different answers. Is there an official/backward & forward compatible way of doing it? Here are two ways to start discussion: IF EXISTS (SELECT 1 FROM INFORMATION_SCHEMA.TABLES WHERE TABLE_TYPE='BASE TABLE' AND TABLE_NAME='mytablename') SELECT 1 AS res ELSE SELECT 0 AS res; IF OBJECT_ID (N'".$table_name."', N'U') IS NOT NULL SELECT 1 AS res ELSE SELECT 0 AS res; MySQL provides a nice SHOW TABLES LIKE '%tablename%'; statement. I am looking for something similar.

    Read the article

  • What to do of exceptions when implementing java.lang.Iterator

    - by Vincent Robert
    The java.lang.Iterator interface has 3 methods: hasNext, next and remove. In order to implement a read-only iterator, you have to provide an implementation for 2 of those: hasNext and next. My problem is that these methods does not declare any exceptions. So if my code inside the iteration process declares exceptions, I must enclose my iteration code inside a try/catch block. My current policy has been to rethrow the exception enclosed in a RuntimeException. But this has issues because the checked exceptions are lost and the client code no longer can catch those exceptions explicitly. How can I work around this limitation in the Iterator class? Here is a sample code for clarity: class MyIterator implements Iterator { @Override public boolean hasNext() { try { return implementation.testForNext(); } catch ( SomethingBadException e ) { throw new RuntimeException(e); } } @Override public boolean next() { try { return implementation.getNext(); } catch ( SomethingBadException e ) { throw new RuntimeException(e); } } ... }

    Read the article

  • Excel 2007 Visual Basic Editor: eats spaces, throws cursor around

    - by Vincent
    I can't resolve this issue, I found a similar question here but: setting the workbook to Manual calculation (alt-m-x-m or alt-t-oformulas) didn't work Setting editor options to disable: Auto syntax check & Background compile didn't work anybody have any idea how to fix this very annoying behaviour, I'm used to quickly pop up VBA (alt-f11), f7 to get into code and write some quick procedures there... and it's hard to get out of that habit, I don't want to write any office extension to just add a single quote to every cell in the range For Each rg In Selection rg = chr(39) & rg.value Next F5, done...

    Read the article

  • Set compression level when generating a ZIP file using RubyZip

    - by Vincent Robert
    Hi, I have a Ruby program that zips a directory tree of XML files using the rubyzip gem. My problem is that the file is starting to be heavy and I would like to increase the compression level, since compression time is not an issue. I could not find in the rubyzip documentation a way to specify the compression level for the created ZIP file. Anyone know how to change this setting?

    Read the article

  • ICalendar parser in PHP that supports timezones

    - by Vincent Robert
    I am looking for a PHP class that can parse an ICalendar (ICS) file and correctly handle timezones. I already created an ICS parser myself but it can only handle timezones known to PHP (like 'Europe/Paris'). Unfortunately, ICS file generated by Evolution (default calendar software of Ubuntu) does not use default timezone IDs. It exports events with its a specific timezone ID exporting also the full definition of the timezone: daylight saving dates, recurrence rule and all the hard stuff to understand about timezones. This is too much for me. Since it was only a small utility for my girlfriend, I won't have time to investigate further the ICalendar specification and create a full blown ICalendar parser myself. So is there any known implementation in PHP of ICalendar file format that can parse timezones definitions?

    Read the article

  • Calculating distance from latitude, longitude and height using a geocentric co-ordinate system

    - by Sarge
    I've implemented this method in Javascript and I'm roughly 2.5% out and I'd like to understand why. My input data is an array of points represented as latitude, longitude and the height above the WGS84 ellipsoid. These points are taken from data collected from a wrist-mounted GPS device during a marathon race. My algorithm was to convert each point to cartesian geocentric co-ordinates and then compute the Euclidean distance (c.f Pythagoras). Cartesian geocentric is also known as Earth Centred Earth Fixed. i.e. it's an X, Y, Z co-ordinate system which rotates with the earth. My test data was the data from a marathon and so the distance should be very close to 42.26km. However, the distance comes to about 43.4km. I've tried various approaches and nothing changes the result by more than a metre. e.g. I replaced the height data with data from the NASA SRTM mission, I've set the height to zero, etc. Using Google, I found two points in the literature where lat, lon, height had been transformed and my transformation algorithm is matching. What could explain this? Am I expecting too much from Javascript's double representation? (The X, Y, Z numbers are very big but the differences between two points is very small). My alternative is to move to computing the geodesic across the WGS84 ellipsoid using Vincenty's algorithm (or similar) and then calculating the Euclidean distance with the two heights but this seems inaccurate. Thanks in advance for your help!

    Read the article

  • Hibernate many-to-many mapping not saved in pivot table

    - by vincent
    I having problems saving many to many relationships to a pivot table. The way the pojos are created is unfortunately a pretty long process which spans over a couple of different threads which work on the (to this point un-saved) object until it is finally persisted. I associate the related objects to one another right after they are created and when debugging I can see the List of related object populated with their respective objects. So basically all is fine to this point. When I persist the object everything get saved except the relations in the pivot table. mapping files: <?xml version="1.0" encoding="UTF-8"?> <!DOCTYPE hibernate-mapping PUBLIC "-//Hibernate/Hibernate Mapping DTD 3.0//EN" "http://hibernate.sourceforge.net/hibernate-mapping-3.0.dtd"> <hibernate-mapping package="com.thebeansgroup.jwinston.plugin.orm.hibernate.object"> <class name="ShowObject" table="show_object"> <id name="id"> <generator class="native" /> </id> <property name="name" /> <set cascade="all" inverse="true" name="venues" table="venue_show"> <key column="show_id"/> <many-to-many class="VenueObject"/> </set> </class> </hibernate-mapping> and the other <?xml version="1.0" encoding="UTF-8"?> <!DOCTYPE hibernate-mapping PUBLIC "-//Hibernate/Hibernate Mapping DTD 3.0//EN" "http://hibernate.sourceforge.net/hibernate-mapping-3.0.dtd"> <hibernate-mapping package="com.thebeansgroup.jwinston.plugin.orm.hibernate.object"> <class name="VenueObject" table="venue_object"> <id name="id"> <generator class="native"/> </id> <property name="name"/> <property name="latitude" type="integer"/> <property name="longitude" type="integer"/> <set cascade="all" inverse="true" name="shows" table="venue_show"> <key column="venue_id"/> <many-to-many class="ShowObject"/> </set> </class> </hibernate-mapping> pojos: public class ShowObject extends OrmObject { private Long id; private String name; private Set venues; public ShowObject() { } public Long getId() { return id; } public void setId(Long id) { this.id = id; } public String getName() { return name; } public void setName(String name) { this.name = name; } public Set getVenues() { return venues; } public void setVenues(Set venues) { this.venues = venues; } } and the other: public class VenueObject extends OrmObject { private Long id; private String name; private int latitude; private int longitude; private Set shows = new HashSet(); public VenueObject() { } @Id @GeneratedValue(strategy = GenerationType.AUTO) public Long getId() { return id; } public void setId(Long id) { this.id = id; } public int getLatitude() { return latitude; } public void setLatitude(int latitude) { this.latitude = latitude; } public int getLongitude() { return longitude; } public void setLongitude(int longitude) { this.longitude = longitude; } public String getName() { return name; } public void setName(String name) { this.name = name; } public Set getShows() { return shows; } public void setShows(Set shows) { this.shows = shows; } } Might the problem be related to the lack of annotations?

    Read the article

  • Hibernate constraint ConstraintViolationException. Is there an easy way to ignore duplicate entries?

    - by vincent
    Basically I've got the below schema and I'm inserting records if they don't exists. However when it comes to inserting a duplicate it throws and error as I would expect. My question is whether there is an easy way to make Hibernate to just ignore inserts which would in effect insert duplicates? CREATE TABLE IF NOT EXISTS `method` ( `id` bigint(20) NOT NULL AUTO_INCREMENT, `name` varchar(10) DEFAULT NULL, PRIMARY KEY (`id`), UNIQUE KEY `name` (`name`) ) ENGINE=MyISAM DEFAULT CHARSET=latin1 AUTO_INCREMENT=2 ; SEVERE: Duplicate entry 'GET' for key 'name' Exception in thread "pool-11-thread-4" org.hibernate.exception.ConstraintViolationException: could not insert:

    Read the article

< Previous Page | 6 7 8 9 10 11 12 13 14 15 16 17  | Next Page >