Search Results

Search found 37883 results on 1516 pages for 'sparse files'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 105/1516 | < Previous Page | 101 102 103 104 105 106 107 108 109 110 111 112  | Next Page >

  • Encrypt shared files on AD Domain.

    - by Walter
    Can I encrypt shared files on windows server and allow only authenticated domain users have access to these files? The scenario as follows: I have a software development company, and I would like to protect my source code from being copied by my programmers. One problem is that some programmers use their own laptops to developing the company's software. In this scenario it's impossible to prevent developers from copying the source code for their laptops. In this case I thought about the following solution, but i don't know if it's possible to implement. The idea is to encrypt the source code and they are accessible (decrypted) only when developers are logged into the AD domain, ie if they are not logged into the AD domain, the source code would be encrypted be useless. How can be implemented this using EFS?

    Read the article

  • puppet agent doesn't retrieve files from master

    - by nicmon
    I have a very basic question regarding to Puppet 3.0.1 configuration. I setup a puppet master server (CentOS) with 2 agents (CentOS and Windows 7), all 3 can ping and access each other. There is no error at all. I have copied a file under /etc/puppet/files/test2.txt my site.pp (/etc/puppet/manifests) contains these lines: node default { include test file { "/tmp/testmaster.txt": owner => root, group => root, mode => 644, source => "puppet:///files/test2.txt" } } but there will no file be created on agent servers under /tmp/ once I run "puppet agent --test" here is the output: [root@agent1 ~]# puppet agent --test Info: Retrieving plugin Info: Caching catalog for agent1.mydomain.com Info: Applying configuration version '1354267916' Finished catalog run in 0.02 seconds "puppet apply /etc/puppet/manifests/site.pp" creates the testmaster.txt under /tmp/ on master.

    Read the article

  • Replace files with symlink

    - by soandos
    This question is intended to be the inverse of Replace Symbolic Links with Files, but for windows. I have started running out of space on my SSD drive, and I found that about 12% of used space is in my installer folder (holds the .msi files for all the programs that I have installed) I am looking for two things: A way to move this (or any) folder via symlink. Ideally, some powershell function that I could use to just designate a folder, a destination, and the symlink would be created in the original (pointing to the destination) In this particular case, a registry change that would allow the location to be move would also be helpful, but I would still prefer solution 1. How can this be done?

    Read the article

  • EF 4.x generated entity classes (POCO) and Map files

    - by JBeckton
    I have an MVC 4 app that I am working on and using the code first implementation except I cheated a bit and created my database first then generated my entity classes (poco) from my database using the EF power tools (reverse engineer). I guess you can say I did database first method but I have no edmx file just the context class and my entity classes (poco) I have a few projects in the works using MVC and EF with pocos but just the one project I used the tool to generate my pocos from the database. My question is about the mapping files that get created when I generate my pocos using the tool. What is the purpose of these Map files? I figured the map files are needed when generating the db from the model like with the true code first method, in my case where I am using a tool to generate my model from the database do the map files have any influence on how my app uses the entity classes?

    Read the article

  • Haskell lazy I/O and closing files

    - by Jesse
    I've written a small Haskell program to print the MD5 checksums of all files in the current directory (searched recursively). Basically a Haskell version of md5deep. All is fine and dandy except if the current directory has a very large number of files, in which case I get an error like: <program>: <currentFile>: openBinaryFile: resource exhausted (Too many open files) It seems Haskell's laziness is causing it not to close files, even after its corresponding line of output has been completed. The relevant code is below. The function of interest is getList. import qualified Data.ByteString.Lazy as BS main :: IO () main = putStr . unlines =<< getList "." getList :: FilePath -> IO [String] getList p = let getFileLine path = liftM (\c -> (hex $ hash $ BS.unpack c) ++ " " ++ path) (BS.readFile path) in mapM getFileLine =<< getRecursiveContents p hex :: [Word8] -> String hex = concatMap (\x -> printf "%0.2x" (toInteger x)) getRecursiveContents :: FilePath -> IO [FilePath] -- ^ Just gets the paths to all the files in the given directory. Are there any ideas on how I could solve this problem? The entire program is available here: http://haskell.pastebin.com/PAZm0Dcb

    Read the article

  • get a set of files that have been modified after a certain date

    - by jcollum
    Does anyone have a handy powershell script that gets a set of files from TFS based on a modification date? I'd like to say "give me all the files in this folder (or subfolder) that were modified after X/Y/ZZZZ" and dump those files to a folder other than the folder they would normally go to. I know enough powershell to hack about and get this done, eventually, but I'm hoping to avoid that.

    Read the article

  • Combine and compress script files in asp.net mvc

    - by victor_foster
    I am working in Visual Studio 2008, IIS7 and using asp.net MVC. I would like to know the best way to combine all of my Javascript files into one file to reduce the number of HTTP requests to the server. I have seen many articles on this subject but I'm not sure which one I should look at first (many of them are over a year old). Here are the things I would like to do: Combine my Javascript and css files Safely compress my Javascript files when I publish, but keep them uncompressed while I am debugging Cache my Css and Javascript files but allow them to refreshed with a hard refresh when they are updated without having to rename them.

    Read the article

  • Seemingly random 404's for static files in Pyramid project

    - by seth
    I'm running a Pyramid project with mod_wsgi. Some of the files in my static directory (images, stylesheets, javascript) load fine, but others are coming up as not found. The files that are not working are all web fonts (otf, svg, woff and eot). I tried adding a text file into the static directory where the fonts are to see if I could access it, but it also came back with 404. The same text file also can't be accessed when put in the images folder. From what I'm looking at, it doesn't seem to be a permissions issue. Any ideas?

    Read the article

  • Getting data from closed files with concatenate formula

    - by Pav
    Each day a program is creating an excel file for me with some data for the current day. Like what is the price for products, how many people are available today and things like that. Based on all this I need to make some forecasts and workplace allocations for workers. The problem is, that I need to drag all this information manually all the time. So to make it automatic I placed the formula in cells like: ='c:\ABC\[ABC 29-01-14.xlsx]sheet'!a1 Everything works fine, but next day I have to change file name for "ABC 30-01-14" for each cell, what is the same as entering the data manually. So I used "concatenate" formula to change date according to today's date automatically. I used "indirect" formula to turn it in to a real formula, not text string, and realized that it is working only for open files, not closed. Is there any way to do this for closed files without VBA, because I don't know it, or with VBA but explained for an idiot.

    Read the article

  • tool for advanced ID3 tags handling and audio files ordering

    - by Juhele
    I have following problem – some of my files do not have complete ID3 tags and some have typos or small differences in writing - so finally, my portable player sees “Mr. President” as different artist from “Mr President” and so on. I would need some tool which could search similar tags and then allow me to correct the typos or for example override “artist” in all selected files by manually entered text. The same with empty tag items – sometimes, the track name, album etc. is OK, but artist is missing etc. Without touching the audio quality, of course (but this should be no problem, I think). I already tried tools in Winamp, Songbird and other players and currently most advanced free tool I tried is Tagscanner. However, it is not able to to solve the problem with similar tags. Do you know such tool? Preferably free and for Windows, if possible. However, if you know some commercial app able to do this, please let me know.

    Read the article

  • Search Files (Preferably with index) on Windows 2000 Server

    - by ThinkBohemian
    I have many files on a windows server 2000 machine that is setup to act as a networked disk drive, is there anyway I can index the files and make that index available as a search to more people than just me? Bonus if the index can look inside of documents such as readme.txt? If there is no easy way to do this globaly (for all users) Is there a way I could generate and store an index locally on my computer? If this is the wrong place to ask this question, any advice on community more suited?

    Read the article

  • CVS list of files only in working directories

    - by Joshua Berry
    Is it possible to get a list of files that are in the working directory tree, but not in the current branch/tag? I currently diff the working copy with another directory updated to the same module and tag/branch but without the local non-repo files. It works, but doesn't honor the .cvsignore files. I figure there must be an option using a variation of 'cvs diff'. Thanks in advance.

    Read the article

  • best way to record local modifications to an application's configuration files

    - by Menelaos Perdikeas
    I often install applications in Linux which don't come in package form but rather one just downloads a tarball, unpacks it, and runs the app out of the exploded folder. To adjust the application to my environment I need to modify the default configuration files, perhaps add an odd script of my own and I would like to have a way to record all these modifications automatically so I can apply them to another environment. Clearly, the modifications can not be reproduced verbatim as things like IP addresses or username need to change from system to system; still an exhaustive record to what was changed and added would be useful. My solution is to use a pattern involving git. Basically after I explode the tarball I do a git init and an initial commit and then I can save to a file the output of git diff and a cat of all files appearing as new in the git status -s. But I am sure there are more efficient ways. ???

    Read the article

  • Windows script to create directories of 3,000 files

    - by uhpl1
    We have some email archiving that is dumping all the emails into a directory. Because of some performance reasons with the server, I want to setup an automated task that will run a script once a day and if there is more than 3,000 (or whatever number) of files in the main directory, create a new directory with the date and move all the main directory files into it. I'm sure someone has already written something similar, so if anyone could point me at it that would be great. Batch file or Powershell would both be fine.

    Read the article

  • multiple FileSystemWatchers to monitor files on local system?

    - by Jason Crowes
    We're writing a text editor like tool for our internal accounting package system that has actions that can be done by our own Xml language specs. These macro commands are specified in Xml files and we need the ability to monitor if files openned have bean modified externally. The only problem is that there maybe 20-30 files with different paths openned at any one time. Would it be good to use multiple FileSystemWatchers for this scenario? Or would it be better to monitor the root drive and catch specific events that match an open file in the editor (though lots of events could be raised). Some are local drives (C,D,E) others are their network drives (U,X,G,H). Files are quite chunky too about 300-400Kb.

    Read the article

  • Using rsync to synchronise folders without overwriting files of same name on Mac OS X

    - by Adam
    I would like to synchronise the contents of two directories. Without overwriting but to create a copy if two files have the same name, but different sizes Without duplicating if two files have the same name and size. To work recursively So far I have found the following command which might work $ rsync -varE --progress ~/folder /volumes/server/folder But I'm not entirely sure what the -E flag does. It was suggested by a user on bananica.com but couldn't see a description for it in the manual. Would this do what I require successfully? Thanks

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Advanced ID3 tags handling and audio files ordering

    - by Juhele
    Some of my files do not have complete ID3 tags and some have typos or small differences in writing – so finally, my portable player sees “Mr. President” as different artist from “Mr President” and so on. I would need some tool which could search similar tags and then allow me to correct the typos or for example override artist in all selected files by manually entered text. The same with empty tag items – sometimes, the track name, album etc. is OK, but the artist is missing etc. I'd like to do this without touching the audio quality, of course (but this should be no problem, I think). I already tried tools like: Winamp Songbird other players Tagscanner – the most advanced free tool I tried. However, it is not able to to solve the problem with similar tags. Do you know such tool? Preferably free and for Windows, if possible. However, if you know some commercial app able to do this, please let me know.

    Read the article

  • How to programmatically cut/copy/get files to/from Windows clipboard in a systam standard compliand

    - by Ivan
    How to put a cut/copy reference to specific files and/or folders into Windows clipboard so that when I open standard Windows Explorer window, go to somewhere and press Ctrl+V - the files are pasted? If I copy or cut some files/folders in Windows Explorer, how do I get this info (full names and whether they were cut or copied) in my Program? I program in C#4, but other languages ways are also interesting to know.

    Read the article

  • Prevent Chrome from automatically opening downloaded PDF and Image files

    - by Phoenix
    When I download a PDF or image in Google Chrome on my Mac, is it possible to prevent Chrome from automatically opening it in my default application for that file type (e.g., Preview)? I notice that Chrome does not do this for other downloaded files such as audio and ZIP archives. I still want to be able to preview files in Chrome; I just want to prevent it from automatically launching my image/PDF viewer application after I download them. For example: I click on a link in an email to a PDF document or an image file. Chrome displays the contents in the browser. I press Cmd-S and save the file to my computer. When the download finishes, the file opens automatically in Preview.app. It's that last step that I would like to bypass.

    Read the article

  • Using windows CopyFile function to copy all files with certain name format

    - by Ben313
    Hello! I am updating some C code that copys files with a certain name. basically, I have a directory with a bunch of files named like so: AAAAA.1.XYZ AAAAA.2.ZYX AAAAA.3.YZX BBBBB.1.XYZ BBBBB.2.ZYX Now, In the old code, they just used a call to ShellExecute and used xcopy.exe. to get all the files starting with AAAAA, they just gave xcopy the name of the file as AAAAA.* and it knew to copy all of the files starting with AAAAA. now, im trying to get it to copy with out having to use the command line, and I am running into trouble. I was hoping CopyFile would be smart enough to handle AAAAA.* as the file to be copied, but it doesnt at all do what xcopy did. So, any Ideas on how to do this without the external call to xcopy.exe?

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 101 102 103 104 105 106 107 108 109 110 111 112  | Next Page >