Search Results

Search found 15206 results on 609 pages for 'identity map pattern'.

Page 108/609 | < Previous Page | 104 105 106 107 108 109 110 111 112 113 114 115  | Next Page >

  • How to get identities of inserted data records using SQL bulk copy

    - by Olga
    Hello I have a ADO.NET dataTable with about 100.000 records. In this table there is a column "xyID" which has no values in it, because they are generated by insertion into my MSSQL Database. Now i have the problem, that i need this IDs for other processes. I am looking for a way to bulk copy this dataTable into the MSSQL database, and within the same "step" to "fill" my dataTable with the generated IDs. Thank you for your answers!

    Read the article

  • [C++] Index strings by other strings

    - by mcco
    Hello, I need to index specific strings with other strings and I can't really find a good way to do so. I tried to use tr1::unordered_map, but I'm having some difficulties using it. If someone could tell me what is the best way to do that I'd be really grateful :) I also need to index objects by a number (numbers are not in order so I can't use a vector)

    Read the article

  • What is good practice in .NET system architecture design concerning multiple models and aggregates

    - by BuzzBubba
    I'm designing a larger enterprise architecture and I'm in a doubt about how to separate the models and design those. There are several points I'd like suggestions for: - models to define - way to define models Currently my idea is to define: Core (domain) model Repositories to get data to that domain model from a database or other store Business logic model that would contain business logic, validation logic and more specific versions of forms of data retrieval methods View models prepared for specifically formated data output that would be parsed by views of different kind (web, silverlight, etc). For the first model I'm puzzled at what to use and how to define the mode. Should this model entities contain collections and in what form? IList, IEnumerable or IQueryable collections? - I'm thinking of immutable collections which IEnumerable is, but I'd like to avoid huge data collections and to offer my Business logic layer access with LINQ expressions so that query trees get executed at Data level and retrieve only really required data for situations like the one when I'm retrieving a very specific subset of elements amongst thousands or hundreds of thousands. What if I have an item with several thousands of bids? I can't just make an IEnumerable collection of those on the model and then retrieve an item list in some Repository method or even Business model method. Should it be IQueryable so that I actually pass my queries to Repository all the way from the Business logic model layer? Should I just avoid collections in my domain model? Should I void only some collections? Should I separate Domain model and BusinessLogic model or integrate those? Data would be dealt trough repositories which would use Domain model classes. Should repositories be used directly using only classes from domain model like data containers? This is an example of what I had in mind: So, my Domain objects would look like (e.g.) public class Item { public string ItemName { get; set; } public int Price { get; set; } public bool Available { get; set; } private IList<Bid> _bids; public IQueryable<Bid> Bids { get { return _bids.AsQueryable(); } private set { _bids = value; } } public AddNewBid(Bid newBid) { _bids.Add(new Bid {.... } } Where Bid would be defined as a normal class. Repositories would be defined as data retrieval factories and used to get data into another (Business logic) model which would again be used to get data to ViewModels which would then be rendered by different consumers. I would define IQueryable interfaces for all aggregating collections to get flexibility and minimize data retrieved from real data store. Or should I make Domain Model "anemic" with pure data store entities and all collections define for business logic model? One of the most important questions is, where to have IQueryable typed collections? - All the way from Repositories to Business model or not at all and expose only solid IList and IEnumerable from Repositories and deal with more specific queries inside Business model, but have more finer grained methods for data retrieval within Repositories. So, what do you think? Have any suggestions?

    Read the article

  • Custom Django admin URL + changelist view for custom list filter by Tags

    - by Botondus
    In django admin I wanted to set up a custom filter by tags (tags are introduced with django-tagging) I've made the ModelAdmin for this and it used to work fine, by appending custom urlconf and modifying the changelist view. It should work with URLs like: http://127.0.0.1:8000/admin/reviews/review/only-tagged-vista/ But now I get 'invalid literal for int() with base 10: 'only-tagged-vista', error which means it keeps matching the review edit page instead of the custom filter page, and I cannot figure out why since it used to work and I can't find what change might have affected this. Any help appreciated. Relevant code: class ReviewAdmin(VersionAdmin): def changelist_view(self, request, extra_context=None, **kwargs): from django.contrib.admin.views.main import ChangeList cl = ChangeList(request, self.model, list(self.list_display), self.list_display_links, self.list_filter, self.date_hierarchy, self.search_fields, self.list_select_related, self.list_per_page, self.list_editable, self) cl.formset = None if extra_context is None: extra_context = {} if kwargs.get('only_tagged'): tag = kwargs.get('tag') cl.result_list = cl.result_list.filter(tags__icontains=tag) extra_context['extra_filter'] = "Only tagged %s" % tag extra_context['cl'] = cl return super(ReviewAdmin, self).changelist_view(request, extra_context=extra_context) def get_urls(self): from django.conf.urls.defaults import patterns, url urls = super(ReviewAdmin, self).get_urls() def wrap(view): def wrapper(*args, **kwargs): return self.admin_site.admin_view(view)(*args, **kwargs) return update_wrapper(wrapper, view) info = self.model._meta.app_label, self.model._meta.module_name my_urls = patterns('', # make edit work from tagged filter list view # redirect to normal edit view url(r'^only-tagged-\w+/(?P<id>.+)/$', redirect_to, {'url': "/admin/"+self.model._meta.app_label+"/"+self.model._meta.module_name+"/%(id)s"} ), # tagged filter list view url(r'^only-tagged-(P<tag>\w+)/$', self.admin_site.admin_view(self.changelist_view), {'only_tagged':True}, name="changelist_view"), ) return my_urls + urls Edit: Original issue fixed. I now receive 'Cannot filter a query once a slice has been taken.' for line: cl.result_list = cl.result_list.filter(tags__icontains=tag) I'm not sure where this result list is sliced, before tag filter is applied. Edit2: It's because of the self.list_per_page in ChangeList declaration. However didn't find a proper solution yet. Temp fix: if kwargs.get('only_tagged'): list_per_page = 1000000 else: list_per_page = self.list_per_page cl = ChangeList(request, self.model, list(self.list_display), self.list_display_links, self.list_filter, self.date_hierarchy, self.search_fields, self.list_select_related, list_per_page, self.list_editable, self)

    Read the article

  • Asp.net MVC and MOSS 2010 integration

    - by Robert Koritnik
    Just a sidenote: I'm not sure whether I should post this to serverfault as well, because some MOSS admin may have some info for me as well? A bit of explanation first (without Asp.net MVC) Is it possible to integrate the two? Is it possible to write an application that would share at least credential information with MOSS? I have to write a MOSS application that has to do with these technologies: MOSS 2010 Personal client certificates authentication (most probably on USB keys) Active Directory Federation Services Separate SQL DB that would serve application specific data (separate as not being part of MOSS DB) How should it work? Users should authenticate using personal certificates into MOSS 2010 There would be a certain part of MOSS that would be related to my custom application This application should only authorize certain users via AD FS - I guess these users should have a certain security claim attached to them This application should manage users (that have access to this app) with additional (app specific) security claims related to this application (as additional application level authorization rights for individual application parts) This application should use custom SQL 2008 DB heavily with its own data This application should have the possibility to integrate with external systems as well (Exchange for instance to inject calendar entries, ERP systems etc) This application should be able to export its data (from its DB) to files. I don't know if it's possible, but it would be nice if the app could add these files to MOSS and attach authorization info to them so only users with sufficient rights would be able to view/open these files. Why Asp.net MVC then? I'm very well versed in Asp.net MVC (also with the latest version) and I haven't done anything on Sharepoint since version 2003 (which doesn't do me no good or prepare me for the latest version in any way shape or form). This project will most probably be a death march project so I would rather write my application as a UI rich Asp.net MVC application and somehow integrate it into MOSS. But not only via a link, because I would like to at least share credentials, so users wouldn't need to re-login when accessing my app. Using Asp.net MVC I would at least have the possibility to finish on time or be less death marching. Is this at all possible? Questions Is it possible to integrate Asp.net MVC into MOSS as described above? If integration is not possible, would it be possible to create a completely MOSS based application that would work as described? Which parts of MOSS 2010 should I use to accomplish what I need?

    Read the article

  • Any sample C# project that highlights separate data access layer (using EF) to business logic layer

    - by Greg
    Hi, I'm interested in having a look at a small sample project that would highlight a good technique to separate data access layer (using Entity Framework) to business logic layer. In C# would be good. That is, it would highlight how to pass data between the layer without coupling them. That is, the assumption here is not to use the EF classes in the Business Logic layer, and how to achieve this low coupling, but minimizing plumbing code.

    Read the article

  • Perl script matching a certain patern

    - by kivien
    Assuming the file.txt is as follows:- John Depp is a great guy. He is very inteligent. He can do anything. Come and meet John Depp. The perl code is as follows:- open ( FILE, "file.txt" ) || die "can't open file!"; @lines = <FILE>; close (FILE); $string = "John Depp"; foreach $line (@lines) { if ($line =~ $string) { print "$line"; } } The output is going to be first and fourth line. I want to make it working for the file having random line breaks rather than one English sentence per line. I mean it should also work for the following:- John Depp is a great guy. He is very inteligent. He can do anything. Come and meet John Depp. The output should be first and fourth sentence. Any ideas please?

    Read the article

  • Asp.net MVC/Silverlight and Sharepoint 2010 integration

    - by Robert Koritnik
    Just a sidenote: I'm not sure whether I should post this to serverfault as well, because some MOSS admin may have some info for me as well? Additional note 1: I've found this document (Asp.net MVC 2 & Sharepoint integration) if anybody with sufficient expirience is willing to comment on its content whether this can be used in my described scenario or not. Additional note 2: I've discovered (later) that Silverlight is supported in Sharepoint 2010 so I'm considering it as well. So if anyone would comment on silverlight integration as well. A bit of explanation first (without Asp.net MVC/Silverlight) Is it possible to integrate the two? Is it possible to write an application that would share at least credential information with MOSS? I have to write a MOSS application that has to do with these technologies: MOSS 2010 Personal client certificates authentication (most probably on USB keys) Active Directory Federation Services Separate SQL DB that would serve application specific data (separate as not being part of MOSS DB) How should it work? Users should authenticate using personal certificates into MOSS 2010 There would be a certain part of MOSS that would be related to my custom application This application should only authorize certain users via AD FS - I guess these users should have a certain security claim attached to them This application should manage users (that have access to this app) with additional (app specific) security claims related to this application (as additional application level authorization rights for individual application parts) This application should use custom SQL 2008 DB heavily with its own data This application should have the possibility to integrate with external systems as well (Exchange for instance to inject calendar entries, ERP systems etc) This application should be able to export its data (from its DB) to files. I don't know if it's possible, but it would be nice if the app could add these files to MOSS and attach authorization info to them so only users with sufficient rights would be able to view/open these files. Why Asp.net MVC/Silverlight then? I'm very well versed in Asp.net MVC (also with the latest version) and I haven't done anything on Sharepoint since version 2003 (which doesn't do me no good or prepare me for the latest version in any way shape or form). This project will most probably be a death march project so I would rather write my application as a UI rich Asp.net MVC application and somehow integrate it into MOSS. But not only via a link, because I would like to at least share credentials, so users wouldn't need to re-login when accessing my app. Using Asp.net MVC I would at least have the possibility to finish on time or be less death marching. Is this at all possible? I haven't done any serious project using SIlverlight, but I will sooner or later have to. So I'm also considering a jump into it at this moment, because it still might make this application development easier than strict Sharepoint 2010. Questions Is it possible to integrate Asp.net MVC/Silverlight into MOSS as described above? If integration is not possible, would it be possible to create a completely MOSS based application that would work as described? Which parts of MOSS 2010 should I use to accomplish what I need?

    Read the article

  • realloc() & ARC

    - by RynoB
    How would I be able to rewrite the the following utility class to get all the class string values for a specific type - using the objective-c runtime functions as shown below? The ARC documentation specifically states that realloc should be avoided and I also get the following compiler error on this this line: classList = realloc(classList, sizeof(Class) * numClasses); "Implicit conversion of a non-Objective-C pointer type 'void *' to '__unsafe_unretained Class *' is disallowed with ARC" The the below code is a reference to the original article which can be found here. + (NSArray *)classStringsForClassesOfType:(Class)filterType { int numClasses = 0, newNumClasses = objc_getClassList(NULL, 0); Class *classList = NULL; while (numClasses < newNumClasses) { numClasses = newNumClasses; classList = realloc(classList, sizeof(Class) * numClasses); newNumClasses = objc_getClassList(classList, numClasses); } NSMutableArray *classesArray = [NSMutableArray array]; for (int i = 0; i < numClasses; i++) { Class superClass = classList[i]; do { superClass = class_getSuperclass(superClass); if (superClass == filterType) { [classesArray addObject:NSStringFromClass(classList[i])]; break; } } while (superClass); } free(classList); return classesArray; } Your help will be much appreciated. Thanks

    Read the article

  • Autoincrementing hierarchical IDs on SQL Server

    - by Ville Koskinen
    Consider this table on SQL Server wordID aliasID value =========================== 0 0 'cat' 1 0 'dog' 2 0 'argh' 2 1 'ugh' WordID is a id of a word which possibly has aliases. AliasID determines a specific alias to a word. So above 'argh' and 'ugh' are aliases to each other. I'd like to be able to insert new words which do not have any aliases in the table without having to query the table for a free wordID value first. Inserting value 'hey' without specifying a wordID or an aliasID, a row looking like this would be created: wordID aliasID value =========================== 3 0 'hey' Is this possible and how?

    Read the article

  • How can I use jQuery to match a string inside the current URL of the window I am in?

    - by Jannis
    Hi, I have used the excellent gskinner.com/RegExr/ tool to test my string matching regex but I cannot figure out how to implement this into my jQuery file to return true or false. The code I have is as follows: ^(http:)\/\/(.+\.)?(stackoverflow)\. on a url such as http://stackoverflow.com/questions/ask this would match (according to RegExr) http://stackoverflow. So this is great because I want to try matching the current window.location to that string, but the issue I am having is that this jQuery/js script does not work: var url = window.location; if ( url.match( /^(http:)\/\/(.+\.)?(stackoverflow)\./ ) ) { alert('this works'); }; Any ideas on what I am doing wrong here? Thanks for reading. Jannis

    Read the article

  • How to render OpenStreetMaps?

    - by DomingoSL
    Did you know a way to render the .osm format given by OpenStreetMap in Php, JavaScript, ActionScript or other web plataform? What do you recomend to implement it? Where can i find good examples in the plataform you suggest? Thanks

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • OpenLayers Projections.

    - by Jenny
    I can succesfully do: point.transform(new OpenLayers.Projection("EPSG:900913"), new OpenLayers.Projection("EPSG:4326")); To a point that is in the google format (in meters), but when I want to do the reverse: point.transform(new OpenLayers.Projection("EPSG:4326"), new OpenLayers.Projection("EPSG:900913")); to a point that is in 4326 (regular lat/lon format), I am having some issues. Any negative value seems to become NaN (not a number) when I do the transformation. Is there something about the transformation in reverse that I don't understand? Edit: Even worse, when I have no negative values, the coordinates seem off. I am getting the coordinates by drawing a square on the screen, then saving those coordinates to a database and loading them later. I can draw a square near the tip of africa (positive coordinates), and then when it loads it's near the top of africa, in the atlantic ocean. I'm definitely doing something wrong....

    Read the article

  • DDD: Getting aggregate roots for other aggregates

    - by Ed
    I've been studying DDD for the past 2 weeks, and one of the things that really stuck out to me was how aggregate roots can contain other aggregate roots. Aggregate roots are retrieved from the repository, but if a root contains another root, does the repository have a reference to the other repository and asks it to build the subroot?

    Read the article

  • Showing each step geocode of directions

    - by Puru puru rin..
    Hello, Google Maps API can build a Direction from a source to a destination. In the following Google's example, each step are published into the HTML code: http://code.google.com/apis/maps/documentation/examples/directions-simple.html I would like to get the Geocoding of each step of this direction, and store them in a array. I believe it's possible, but I don't see how to process. Many Thanks for any answer. Regards

    Read the article

  • asp.net InsertCommand to return latest insert ID

    - by Stijn Van Loo
    Dear all, I'm unable to retrieve the latest inserted id from my SQL Server 2000 db using a typed dataset in asp.NET I have created a tableadapter and I ticked the "Refresh datatable" and "Generate Insert, Update and Delete statements". This auto-generates the Fill and GetData methods, and the Insert, Update, Select and Delete statements. I have tried every possible solution in this thread http://forums.asp.net/t/990365.aspx but I'm still unsuccesfull, it always returns 1(=number of affected rows). I do not want to create a seperate insert method as the auto-generated insertCommand perfectly suits my needs. As suggested in the thread above, I have tried to update the InsertCommand SQL syntax to add SELECT SCOPY_IDENTITY() or something similar, I have tried to add a parameter of type ReturnValue, but all I get is the number of affected rows. Does anyone has a different take on this? Thanks in advance! Stijn

    Read the article

  • How do you handle EF Data Contexts combined with asp.net custom membership/role providers

    - by KallDrexx
    I can't seem to get my head around how to implement a custom membership provider with Entity Framework data contexts into my asp.net MVC application. I understand how to create a custom membership/role provider by itself (using this as a reference). Here's my current setup: As of now I have a repository factory interface that allows different repository factories to be created (right now I only have a factory for EF repositories and and in memory repositories). The repository factory looks like this: public class EFRepositoryFactory : IRepositoryFactory { private EntitiesContainer _entitiesContext; /// <summary> /// Constructor that generates the necessary object contexts /// </summary> public EFRepositoryFactory() { _entitiesContext = new EntitiesContainer(); } /// <summary> /// Generates a new entity framework repository for the specified entity type /// </summary> /// <typeparam name="T">Type of entity to generate a repository for </typeparam> /// <returns>Returns an EFRepository</returns> public IRepository<T> GenerateRepository<T>() where T : class { return new EFRepository<T>(_entitiesContext); } } Controllers are passed an EF repository factory via castle Windsor. The controller then creates all the service/business layer objects it requires and passes in the repository factory into it. This means that all service objects are using the same EF data contexts and I do not have to worry about objects being used in more than one data context (which of course is not allowed and causes an exception). As of right now I am trying to decide how to generate my user and authorization service layers, and have run against a design roadblock. The User/Authization service will be a central class that handles the logic for logging in, changing user details, managing roles and determining what users have access to what. The problem is, using the current methodology the asp.net mvc controllers will initialize it's own EF repository factory via Windsor and the asp.net membership/role provider will have to initialize it's own EF repository factory. This means that each part of the site will then have it's own data context. This seems to mean that if asp.net authenticates a user, that user's object will be in the membership provider's data context and thus if I try to retrieve that user object in the service layer (say to change the user's name) I will get a duplication exception. I thought of making the repository factory class a singleton, but I don't see a way for that to work with castle Windsor. How do other people handle asp.net custom providers in a MVC (or any n-tier) architecture without having object duplication issues?

    Read the article

  • Error when pushing to Heroku - ...appear in group - Ruby on Rails

    - by bgadoci
    I am trying to deploy my first rails app to Heroku and seem to be having a problem. After git push heroku master, and heroku rake db:migrate I get an error saying: SELECT posts.*, count(*) as vote_total FROM "posts" INNER JOIN "votes" ON votes.post_id = posts.id GROUP BY votes.post_id ORDER BY created_at DESC LIMIT 5 OFFSET 0): I have included the full error below and also included the PostControll#index as it seems that is where I am doing the grouping. Lastly I included my routes.rb file. I am new to ruby, rails, and heroku so sorry for simple/obvious questions. Processing PostsController#index (for 99.7.50.140 at 2010-04-21 12:50:47) [GET] ActiveRecord::StatementInvalid (PGError: ERROR: column "posts.id" must appear in the GROUP BY clause or be used in an aggregate function : SELECT posts.*, count(*) as vote_total FROM "posts" INNER JOIN "votes" ON votes.post_id = posts.id GROUP BY votes.post_id ORDER BY created_at DESC LIMIT 5 OFFSET 0): vendor/gems/will_paginate-2.3.12/lib/will_paginate/finder.rb:82:in `send' vendor/gems/will_paginate-2.3.12/lib/will_paginate/finder.rb:82:in `paginate' vendor/gems/will_paginate-2.3.12/lib/will_paginate/collection.rb:87:in `create' vendor/gems/will_paginate-2.3.12/lib/will_paginate/finder.rb:76:in `paginate' app/controllers/posts_controller.rb:28:in `index' /home/heroku_rack/lib/static_assets.rb:9:in `call' /home/heroku_rack/lib/last_access.rb:25:in `call' /home/heroku_rack/lib/date_header.rb:14:in `call' thin (1.0.1) lib/thin/connection.rb:80:in `pre_process' thin (1.0.1) lib/thin/connection.rb:78:in `catch' thin (1.0.1) lib/thin/connection.rb:78:in `pre_process' thin (1.0.1) lib/thin/connection.rb:57:in `process' thin (1.0.1) lib/thin/connection.rb:42:in `receive_data' eventmachine (0.12.6) lib/eventmachine.rb:240:in `run_machine' eventmachine (0.12.6) lib/eventmachine.rb:240:in `run' thin (1.0.1) lib/thin/backends/base.rb:57:in `start' thin (1.0.1) lib/thin/server.rb:150:in `start' thin (1.0.1) lib/thin/controllers/controller.rb:80:in `start' thin (1.0.1) lib/thin/runner.rb:173:in `send' thin (1.0.1) lib/thin/runner.rb:173:in `run_command' thin (1.0.1) lib/thin/runner.rb:139:in `run!' thin (1.0.1) bin/thin:6 /usr/local/bin/thin:20:in `load' /usr/local/bin/thin:20 PostsController def index @tag_counts = Tag.count(:group => :tag_name, :order => 'count_all DESC', :limit => 20) conditions, joins = {}, :votes @ugtag_counts = Ugtag.count(:group => :ugctag_name, :order => 'count_all DESC', :limit => 20) conditions, joins = {}, :votes @vote_counts = Vote.count(:group => :post_title, :order => 'count_all DESC', :limit => 20) conditions, joins = {}, :votes unless(params[:tag_name] || "").empty? conditions = ["tags.tag_name = ? ", params[:tag_name]] joins = [:tags, :votes] end @posts=Post.paginate( :select => "posts.*, count(*) as vote_total", :joins => joins, :conditions=> conditions, :group => "votes.post_id", :order => "created_at DESC", :page => params[:page], :per_page => 5) @popular_posts=Post.paginate( :select => "posts.*, count(*) as vote_total", :joins => joins, :conditions=> conditions, :group => "votes.post_id", :order => "vote_total DESC", :page => params[:page], :per_page => 3) respond_to do |format| format.html # index.html.erb format.xml { render :xml => @posts } format.json { render :json => @posts } format.atom end end routes.rb ActionController::Routing::Routes.draw do |map| map.resources :ugtags map.resources :wysihat_files map.resources :users map.resources :votes map.resources :votes, :belongs_to => :user map.resources :tags, :belongs_to => :user map.resources :ugtags, :belongs_to => :user map.resources :posts, :collection => {:auto_complete_for_tag_tag_name => :get } map.resources :posts, :sessions map.resources :posts, :has_many => :comments map.resources :posts, :has_many => :tags map.resources :posts, :has_many => :ugtags map.resources :posts, :has_many => :votes map.resources :posts, :belongs_to => :user map.resources :tags, :collection => {:auto_complete_for_tag_tag_name => :get } map.resources :ugtags, :collection => {:auto_complete_for_ugtag_ugctag_name => :get } map.login 'login', :controller => 'sessions', :action => 'new' map.logout 'logout', :controller => 'sessions', :action => 'destroy' map.root :controller => "posts" map.connect ':controller/:action/:id' map.connect ':controller/:action/:id.:format' end UPDATE TO SHOW MODEL AND MIGRATION FOR POST class Post < ActiveRecord::Base has_attached_file :photo validates_presence_of :body, :title has_many :comments, :dependent => :destroy has_many :tags, :dependent => :destroy has_many :ugtags, :dependent => :destroy has_many :votes, :dependent => :destroy belongs_to :user after_create :self_vote def self_vote # I am assuming you have a user_id field in `posts` and `votes` table. self.votes.create(:user => self.user) end cattr_reader :per_page @@per_page = 10 end migrations for post class CreatePosts < ActiveRecord::Migration def self.up create_table :posts do |t| t.string :title t.text :body t.timestamps end end def self.down drop_table :posts end end _ class AddUserIdToPost < ActiveRecord::Migration def self.up add_column :posts, :user_id, :string end def self.down remove_column :posts, :user_id end end

    Read the article

  • C# dictionary uniqueness for sibling classes using IEquatable<T>

    - by anthony
    I would like to store insances of two classes in a dictionary structure and use IEquatable to determine uniqueness of these instances. Both of these classes share an (abstract) base class. Consider the following classes: abstract class Foo { ... } class SubFoo1 : Foo { ... } class SubFoo2 : Foo { ... } The dictionary will be delcared: Dictionary<Foo, Bar> Which classes should be declared as IEquatable? And what should the generic type T be for those declarations? Is this even possible?

    Read the article

  • 2d terrain generation in real time

    - by Skoder
    Hey, I'm trying to create a game similar to this (Note:When you click 'play', there are SFX in the game which you can't seem to turn off, so you may want to check volume). In particular, I'm interested in knowing how the 'infinite' landscape is generated. Are there any tutorials/articles describing this? I came across procedural generation, but I'm not quite sure what topics I should be looking for (or if it's even procedural generation). (I'm using C#, but I don't mind the language as I assume the theory behind it remains the same) Thanks for any suggestions

    Read the article

  • Regular Expressions: Positive Lookahead and Word Border question

    - by Inf.S
    Hello again Stackoverflow people! Assume I have these words: smartphones, smartphone I want to match the substring "phone" from within them. However, in both case, I want only "phone" to be returned, not "phones" in the first case. In addition to this, I want matches only if the word "phone" is a suffix only, such that: fonephonetics (just an example) is not matched. I assumed that the regex (phone([?=s])?)\b would give me what I need, but it is currently matching "phones" and "phone", but not the "fonephonetics" one. I don't need "phones". I want "phone" for both cases. Any ideas about what is wrong, and what I can do? Thank you in advance!

    Read the article

  • google maps export driving directions to kml file - java geogoogle

    - by maiky
    Hi Sorry at first for my poor grammar. I am writing a program in Java using geogoogle (Google Geocoder Java API) http://geo-google.sourceforge.net/ I need from two specific points to get the walking directions between these points and also these info to be exported in a KML file. Do you know how can I do it from Java? Is there an API that I can use? Perhaps making a call from the java program to google and handle the result - but how can it be done? Thanks in advance. PS. Google gives this functionality as i saw here http://www.gringod.com/2008/02/26/save-google-maps-driving-directions/ but I need all these to be called from Java.

    Read the article

< Previous Page | 104 105 106 107 108 109 110 111 112 113 114 115  | Next Page >