Search Results

Search found 9634 results on 386 pages for 'proxy pattern'.

Page 111/386 | < Previous Page | 107 108 109 110 111 112 113 114 115 116 117 118  | Next Page >

  • Any sample C# project that highlights separate data access layer (using EF) to business logic layer

    - by Greg
    Hi, I'm interested in having a look at a small sample project that would highlight a good technique to separate data access layer (using Entity Framework) to business logic layer. In C# would be good. That is, it would highlight how to pass data between the layer without coupling them. That is, the assumption here is not to use the EF classes in the Business Logic layer, and how to achieve this low coupling, but minimizing plumbing code.

    Read the article

  • Perl script matching a certain patern

    - by kivien
    Assuming the file.txt is as follows:- John Depp is a great guy. He is very inteligent. He can do anything. Come and meet John Depp. The perl code is as follows:- open ( FILE, "file.txt" ) || die "can't open file!"; @lines = <FILE>; close (FILE); $string = "John Depp"; foreach $line (@lines) { if ($line =~ $string) { print "$line"; } } The output is going to be first and fourth line. I want to make it working for the file having random line breaks rather than one English sentence per line. I mean it should also work for the following:- John Depp is a great guy. He is very inteligent. He can do anything. Come and meet John Depp. The output should be first and fourth sentence. Any ideas please?

    Read the article

  • realloc() & ARC

    - by RynoB
    How would I be able to rewrite the the following utility class to get all the class string values for a specific type - using the objective-c runtime functions as shown below? The ARC documentation specifically states that realloc should be avoided and I also get the following compiler error on this this line: classList = realloc(classList, sizeof(Class) * numClasses); "Implicit conversion of a non-Objective-C pointer type 'void *' to '__unsafe_unretained Class *' is disallowed with ARC" The the below code is a reference to the original article which can be found here. + (NSArray *)classStringsForClassesOfType:(Class)filterType { int numClasses = 0, newNumClasses = objc_getClassList(NULL, 0); Class *classList = NULL; while (numClasses < newNumClasses) { numClasses = newNumClasses; classList = realloc(classList, sizeof(Class) * numClasses); newNumClasses = objc_getClassList(classList, numClasses); } NSMutableArray *classesArray = [NSMutableArray array]; for (int i = 0; i < numClasses; i++) { Class superClass = classList[i]; do { superClass = class_getSuperclass(superClass); if (superClass == filterType) { [classesArray addObject:NSStringFromClass(classList[i])]; break; } } while (superClass); } free(classList); return classesArray; } Your help will be much appreciated. Thanks

    Read the article

  • How can I use jQuery to match a string inside the current URL of the window I am in?

    - by Jannis
    Hi, I have used the excellent gskinner.com/RegExr/ tool to test my string matching regex but I cannot figure out how to implement this into my jQuery file to return true or false. The code I have is as follows: ^(http:)\/\/(.+\.)?(stackoverflow)\. on a url such as http://stackoverflow.com/questions/ask this would match (according to RegExr) http://stackoverflow. So this is great because I want to try matching the current window.location to that string, but the issue I am having is that this jQuery/js script does not work: var url = window.location; if ( url.match( /^(http:)\/\/(.+\.)?(stackoverflow)\./ ) ) { alert('this works'); }; Any ideas on what I am doing wrong here? Thanks for reading. Jannis

    Read the article

  • How do you handle EF Data Contexts combined with asp.net custom membership/role providers

    - by KallDrexx
    I can't seem to get my head around how to implement a custom membership provider with Entity Framework data contexts into my asp.net MVC application. I understand how to create a custom membership/role provider by itself (using this as a reference). Here's my current setup: As of now I have a repository factory interface that allows different repository factories to be created (right now I only have a factory for EF repositories and and in memory repositories). The repository factory looks like this: public class EFRepositoryFactory : IRepositoryFactory { private EntitiesContainer _entitiesContext; /// <summary> /// Constructor that generates the necessary object contexts /// </summary> public EFRepositoryFactory() { _entitiesContext = new EntitiesContainer(); } /// <summary> /// Generates a new entity framework repository for the specified entity type /// </summary> /// <typeparam name="T">Type of entity to generate a repository for </typeparam> /// <returns>Returns an EFRepository</returns> public IRepository<T> GenerateRepository<T>() where T : class { return new EFRepository<T>(_entitiesContext); } } Controllers are passed an EF repository factory via castle Windsor. The controller then creates all the service/business layer objects it requires and passes in the repository factory into it. This means that all service objects are using the same EF data contexts and I do not have to worry about objects being used in more than one data context (which of course is not allowed and causes an exception). As of right now I am trying to decide how to generate my user and authorization service layers, and have run against a design roadblock. The User/Authization service will be a central class that handles the logic for logging in, changing user details, managing roles and determining what users have access to what. The problem is, using the current methodology the asp.net mvc controllers will initialize it's own EF repository factory via Windsor and the asp.net membership/role provider will have to initialize it's own EF repository factory. This means that each part of the site will then have it's own data context. This seems to mean that if asp.net authenticates a user, that user's object will be in the membership provider's data context and thus if I try to retrieve that user object in the service layer (say to change the user's name) I will get a duplication exception. I thought of making the repository factory class a singleton, but I don't see a way for that to work with castle Windsor. How do other people handle asp.net custom providers in a MVC (or any n-tier) architecture without having object duplication issues?

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • DDD: Getting aggregate roots for other aggregates

    - by Ed
    I've been studying DDD for the past 2 weeks, and one of the things that really stuck out to me was how aggregate roots can contain other aggregate roots. Aggregate roots are retrieved from the repository, but if a root contains another root, does the repository have a reference to the other repository and asks it to build the subroot?

    Read the article

  • Sorting tree with a materialized path?

    - by Ovid
    I have a tree structure in a table and it uses materialized paths to allow me to find children quickly. However, I also need to sort the results depth-first, as one would expect with threaded forum replies. id | parent_id | matpath | created ----+-----------+---------+---------------------------- 2 | 1 | 1 | 2010-05-08 15:18:37.987544 3 | 1 | 1 | 2010-05-08 17:38:14.125377 4 | 1 | 1 | 2010-05-08 17:38:57.26743 5 | 1 | 1 | 2010-05-08 17:43:28.211708 7 | 1 | 1 | 2010-05-08 18:18:11.849735 6 | 2 | 1.2 | 2010-05-08 17:50:43.288759 9 | 5 | 1.5 | 2010-05-09 14:02:43.818646 8 | 6 | 1.2.6 | 2010-05-09 14:01:17.632695 So the final results should actually be sorted like this: id | parent_id | matpath | created ----+-----------+---------+---------------------------- 2 | 1 | 1 | 2010-05-08 15:18:37.987544 6 | 2 | 1.2 | 2010-05-08 17:50:43.288759 8 | 6 | 1.2.6 | 2010-05-09 14:01:17.632695 3 | 1 | 1 | 2010-05-08 17:38:14.125377 4 | 1 | 1 | 2010-05-08 17:38:57.26743 5 | 1 | 1 | 2010-05-08 17:43:28.211708 9 | 5 | 1.5 | 2010-05-09 14:02:43.818646 7 | 1 | 1 | 2010-05-08 18:18:11.849735 How would I work that out? Can I do that in straight SQL (this is PostgreSQL 8.4) or should additional information be added to this table?

    Read the article

  • Does .NET Regex support global matching?

    - by Dave
    I haven't been able to find anything online regarding this. There's RegexOptions, but it doesn't have Global as one of its options. The inline modifiers list also doesn't mention global matching. In a nutshell, I've got a regex to parse something like --arga= "arg1" --argb ="arg2" into separate argument name/value pairs using this regex: --(\\w+)\\s*=\\s*\"(\\w+)\"\\s* but the .NET Regex class doesn't do it globally (iteratively). So in order for me to get this to work, I'd have to do a match, then remove this from the argument string, and loop over and over again until I've exhausted all of the arguments. It would be nicer to run the regex once, and then loop over the match groups to get the name value pairs. Is this possible? What am I missing?

    Read the article

  • Regular Expressions: Positive Lookahead and Word Border question

    - by Inf.S
    Hello again Stackoverflow people! Assume I have these words: smartphones, smartphone I want to match the substring "phone" from within them. However, in both case, I want only "phone" to be returned, not "phones" in the first case. In addition to this, I want matches only if the word "phone" is a suffix only, such that: fonephonetics (just an example) is not matched. I assumed that the regex (phone([?=s])?)\b would give me what I need, but it is currently matching "phones" and "phone", but not the "fonephonetics" one. I don't need "phones". I want "phone" for both cases. Any ideas about what is wrong, and what I can do? Thank you in advance!

    Read the article

  • Multi-tenant Access Control: Repository or Service layer?

    - by FreshCode
    In a multi-tenant ASP.NET MVC application based on Rob Conery's MVC Storefront, should I be filtering the tenant's data in the repository or the service layer? 1. Filter tenant's data in the repository: public interface IJobRepository { IQueryable<Job> GetJobs(short tenantId); } 2. Let the service filter the repository data by tenant: public interface IJobService { IList<Job> GetJobs(short tenantId); } My gut-feeling says to do it in the service layer (option 2), but it could be argued that each tenant should in essence have their own "virtual repository," (option 1) where this responsibility lies with the repository. Which is the most elegant approach: option 1, option 2 or is there a better way? Update: I tried the proposed idea of filtering at the repository, but the problem is that my application provides the tenant context (via sub-domain) and only interacts with the service layer. Passing the context all the way to the repository layer is a mission. So instead I have opted to filter my data at the service layer. I feel that the repository should represent all data physically available in the repository with appropriate filters for retrieving tenant-specific data, to be used by the service layer. Final Update: I ended up abandoning this approach due to the unnecessary complexities. See my answer below.

    Read the article

  • Unity to dispose of object

    - by Johan Levin
    Is there a way to make Unit dispose property-injected objects as part of the Teardown? The background is that I am working on an application that uses ASP.NET MVC 2, Unity and WCF. We have written our own MVC controller factory that uses unity to instantiate the controller and WCF proxies are injected using the [Dependency] attribute on public properties of the controller. At the end of the page life cycle the ReleaseController method of the controller factory is called and we call IUnityContainer.Teardown(theMvcController). At that point the controller is disposed as expected but I also need to dispose the injected wcf-proxies. (Actually I need to call Close and/or Abort on them and not Dispose but that is a later problem.) I could of course override the controllers' Dispose methods and clean up the proxies there, but I don't want the controllers to have to know about the lifecycles of the injected interfaces or even that they refer to WCF proxies. If I need to write code myself for this - what would be the best extension point? I'd appreciate any pointer.

    Read the article

  • Transparent proxying - how to pass socket to local server without modification?

    - by Luca Farber
    Hello, I have a program that listens on port 443 and then redirects to either an SSH or HTTPS local server depending on the detected protocol. The program does this by connecting to the local server and proxying all data back and forth through its own process. However, this causes the originating host on the local servers to be logged as localhost. Is there any way to pass the socket directly to the local server process (rather than just making a new TCP connection) so that the parameters of sockaddr_in (or sockaddr_in6) will be retained? Platform for this is Linux.

    Read the article

  • PHP-REGEX: accented letters matches non-accented ones, and visceversa. How to achive it?

    - by Lightworker
    I want to do the typical higlight code. So I have something like: $valor = preg_replace("/(".$_REQUEST['txt_search'].")/iu", "<span style='background-color:yellow; font-weight:bold;'>\\1</span>", $valor); Now, the request word could be something like "josé". And with it, I want "jose" or "JOSÉ" or "José" or ... highlighted too. With this expression, if I write "josé", it matches "josé" and "JOSÉ" (and all the case variants). It always matches the accented variants only. If I search "jose", it matches "JOSE", "jose", "Jose"... but not the accented ones. So I've partially what I want, cause I have case insensitive on accented and non-accented separately. I need it fully combined, wich means accent (unicode) insensitive, so I can search "jose", and highlight "josé", "josÉ", "José", "JOSE", "JOSÉ", "JoSé", ... I don't want to do a replace of accents on the word, cause when I print it on screen I need to see the real word as it comes. Any ideas? Thanks!

    Read the article

  • How can I call VC# webservice methods without ArgumentException?

    - by Zarius
    Currently, I'm trying to write a small tray application that will show the status and provide control of a server-side application exposed over webservice. The webservice only has 3 operations: start, stop and status. When I call any of these operations in code, they throw an ArgumentException citing "An item with the same key has already been added". I am compiling the webservice on Visual C# Express 2008, and .NET 3.5. The Code: private TelnetConnClient Conn { get { return new TelnetConnClient(); } } private bool Connected //call webservice operations { get { return Conn.Status(); } set { if(value) Conn.Start(); else Conn.Stop(); } } The Stacktrace: A first chance exception of type 'System.ArgumentException' occurred in mscorlib.dll at System.ThrowHelper.ThrowArgumentException(ExceptionResource resource) at System.Collections.Generic.Dictionary`2.Insert(TKey key, TValue value, Boolean add) at System.ServiceModel.TransactionFlowAttribute.ApplyBehavior(OperationDescription description, BindingParameterCollection parameters) at System.ServiceModel.TransactionFlowAttribute.System.ServiceModel.Description.IOperationBehavior.AddBindingParameters(OperationDescription description, BindingParameterCollection parameters) at System.ServiceModel.Description.DispatcherBuilder.AddBindingParameters(ServiceEndpoint endpoint, BindingParameterCollection parameters) at System.ServiceModel.Description.DispatcherBuilder.BuildProxyBehavior(ServiceEndpoint serviceEndpoint, BindingParameterCollection& parameters) at System.ServiceModel.Channels.ServiceChannelFactory.BuildChannelFactory(ServiceEndpoint serviceEndpoint) at System.ServiceModel.ChannelFactory.CreateFactory() at System.ServiceModel.ChannelFactory.OnOpening() at System.ServiceModel.Channels.CommunicationObject.Open(TimeSpan timeout) at System.ServiceModel.ChannelFactory.EnsureOpened() at System.ServiceModel.ChannelFactory`1.CreateChannel(EndpointAddress address, Uri via) at System.ServiceModel.ChannelFactory`1.CreateChannel() at System.ServiceModel.ClientBase`1.CreateChannel() at System.ServiceModel.ClientBase`1.CreateChannelInternal() at System.ServiceModel.ClientBase`1.get_Channel() at KordiaConnect.ferries.TelnetConnClient.Start() in C:\My Dropbox\Coding\RTF\KordiaConnect\KordiaConnect\Service References\ferries\Reference.cs:line 86 at coldshark.ferries.Main.set_Connected(Boolean value) in C:\My Dropbox\Coding\RTF\KordiaConnect\KordiaConnect\Main.cs:line 22 at coldshark.ferries.Main.<.ctor>b__0(Object sender, EventArgs e) in C:\My Dropbox\Coding\RTF\KordiaConnect\KordiaConnect\Main.cs:line 43 at System.Windows.Forms.NotifyIcon.OnClick(EventArgs e) at System.Windows.Forms.NotifyIcon.WmMouseUp(Message& m, MouseButtons button) at System.Windows.Forms.NotifyIcon.WndProc(Message& msg) at System.Windows.Forms.NotifyIcon.NotifyIconNativeWindow.WndProc(Message& m) at System.Windows.Forms.NativeWindow.DebuggableCallback(IntPtr hWnd, Int32 msg, IntPtr wparam, IntPtr lparam) at System.Windows.Forms.UnsafeNativeMethods.PeekMessage(MSG& msg, HandleRef hwnd, Int32 msgMin, Int32 msgMax, Int32 remove) at System.Windows.Forms.Application.ComponentManager.System.Windows.Forms.UnsafeNativeMethods.IMsoComponentManager.FPushMessageLoop(Int32 dwComponentID, Int32 reason, Int32 pvLoopData) at System.Windows.Forms.Application.ThreadContext.RunMessageLoopInner(Int32 reason, ApplicationContext context) at System.Windows.Forms.Application.ThreadContext.RunMessageLoop(Int32 reason, ApplicationContext context) at System.Windows.Forms.Application.Run() at coldshark.ferries.Main..ctor() in C:\My Dropbox\Coding\RTF\KordiaConnect\KordiaConnect\Main.cs:line 55 I can just call the webservice from the web interface, but this application will give me a handy status notification icon, and I'd really love to know why the out-of-the-box auto-generated code fails for no particular reason.

    Read the article

  • How can I substitute the nth occurrence of a match in a Perl regex?

    - by Zaid
    Following up from an earlier question on extracting the n'th regex match, I now need to substitute the match, if found. I thought that I could define the extraction subroutine and call it in the substitution with the /e modifier. I was obviously wrong (admittedly, I had an XY problem). use strict; use warnings; sub extract_quoted { # à la codaddict my ($string, $index) = @_; while($string =~ /'(.*?)'/g) { $index--; return $1 if(! $index); } return; } my $string = "'How can I','use' 'PERL','to process this' 'line'"; extract_quoted ( $string, 3 ); $string =~ s/&extract_quoted($string,2)/'Perl'/e; print $string; # Prints 'How can I','use' 'PERL','to process this' 'line' There are, of course, many other issues with this technique: What if there are identical matches at different positions? What if the match isn't found? In light of this situation, I'm wondering in what ways this could be implemented.

    Read the article

  • C# Inheritence: Choosing what repository based on type of inherited class

    - by Oskar Kjellin
    I have been making a program that downloads information about movies from the internet. I have a base class Title, which represents all titles. Movie, Serie and Episode are inherited from that class. To save them to the database I have 2 services, MovieService and SerieService. They in turn call repositories, but that is not important here. I have a method Save(Title title) which I am not very happy with. I check for what type the title is and then call the correct service. I would like to perhaps write like this: ITitleService service = title.GetService(); title.GetSavedBy(service); So I have an abstract method on Title that returns an ITitleSaver, which will return the correct service for the instance. My question is how should I implement ITitleSaver? If I make it accept Title I will have to cast it to the correct type before calling the correct overload. Which will lead to having to deal with casting once again. What is the best approach to dealing with this? I would like to have the saving logic in the corresponding class.

    Read the article

  • How can I extract the nth occurrence of a match in a Perl regex?

    - by Zaid
    Is it possible to extract the n'th match in a string of single-quoted words? use strict; use warnings; my $string1 = '\'I want to\' \'extract the word\' \'Perl\',\'from this string\''; my $string2 = '\'What about\',\'getting\',\'Perl\',\'from\',\'here\',\'?\''; sub extract_quoted { my ($string, $index) = @_; my ($wanted) = $string =~ /some_regex_using _$index/; return $wanted; } extract_wanted ($string1, 3); # Should return 'Perl', with quotes extract_wanted ($string2, 3); # Should return 'Perl', with quotes

    Read the article

  • Comparing 2 columns in the same table with the "Like" function

    - by Vic
    I'm trying to come up with a way to query the values in two different columns in the same table where the result set will indicate instances where the value of columnB doesn't contain the value of columnA. For example, my "Nodes" table contains columns "NodeName" and "DNS". The values should look similar to the following: NodeName DNS Router1 Router1.mydomain.com I want to run a query to show which rows have a DNS value that does not contain (or begin with) the value of the NodeName field. I think the query should function something similar to the following, but obviously I'm missing something with regard to the use of "Like" in this situation. SELECT NodeName, DNS WHERE DNS NOT LIKE 'NodeName%' I'm using SQL Server 2005, and any suggestions would be greatly appreciated... :)

    Read the article

  • Apache URL rewrite query

    - by ant-1980
    Can anyone tell me how to do this? i'm stumped! I need a modified URL in this format this55-is-a-test-id-23.html But I need the 23 as a GET. I can't rely on searching for 'id' as this may occur elsewhere in the URL. Is there any way of searching for the last occurrence of id and passing that as a get using an Apache RewriteRule in .htaccess?? Many thanks Ant

    Read the article

  • Apache mod_rewrite and multiple domains

    - by andihahn
    Hi, I'm trying to use mod_rewrite to map multiple domains to different servlets on one host. Example: www.dom1.com - 192.168.1.n/dom1 www.dom2.com - 192.168.1.n/dom2 ... I'm using the mod_rewrite and mod_proxy and directive but it seems that the reverse mapping via ProxyPassReverse doesn't work as I expected. ProxyPassReverse /subdomain.domain.com http://192.168.1.n/subdomain doesn't work. I've turned rewrite-logging on with RewriteLog /var/log/rewrite.log From the logs I'd say that rewriting works and the problem seems to be with reverse mapping. However I can't see any Reverse mapping entries. It seems that reverse mapping isn't logged or needs a different command to be activated. (Apache and the servlet container are on different machines but this should not matter I'd think ?)

    Read the article

  • Intercept Properties With Castle Windsor IInterceptor

    - by jeffn825
    Does anyone have a suggestion on a better way to intercept a properties with Castle DynamicProxy? Specifcally, I need the PropertyInfo that I'm intercepting, but it's not directly on the IInvocation, so what I do is: public static PropertyInfo GetProperty(this MethodInfo method) { bool takesArg = method.GetParameters().Length == 1; bool hasReturn = method.ReturnType != typeof(void); if (takesArg == hasReturn) return null; if (takesArg) { return method.DeclaringType.GetProperties() .Where(prop => prop.GetSetMethod() == method).FirstOrDefault(); } else { return method.DeclaringType.GetProperties() .Where(prop => prop.GetGetMethod() == method).FirstOrDefault(); } } Then in my IInterceptor: #region IInterceptor Members public void Intercept(IInvocation invocation) { bool doSomething = invocation.Method.GetProperty().GetCustomAttributes(true).OfType<SomeAttribute>().Count() > 0; } #endregion Thanks.

    Read the article

  • web apps on localhost on different ports accessed via port 80

    - by punkish
    On my laptop, with Apache I have different web apps in various directories on my laptop, that I can start using simple webservers listening on different ports. For example ~/app1/./app.pl >> listening on http://localhost:3000/ ~/app2/./app.pl >> listening on http://localhost:3001/ ~/app3/./app.pl >> listening on http://localhost:3001/ I want to access the above from my browser like so http://localhost/app1 http://localhost/app2 http://localhost/app3 Can I do the above with mod_proxy? If so, how? Update: I must add that I have Googled for mod_proxy, read the tutes on Apache's website, and experimented with the following uncommented the following in my httpd.conf LoadModule proxy_module modules/mod_proxy.so LoadModule proxy_connect_module modules/mod_proxy_connect.so LoadModule proxy_http_module modules/mod_proxy_http.so added the following in my httpd.conf <IfModule mod_proxy.c> ProxyRequests On ProxyPass /app1 http://localhost:3000/ ProxyPassReverse /app1 http://localhost:3000/ ProxyPass /app2 http://localhost:3001/ ProxyPassReverse /app2 http://localhost:3001/ ProxyPass /app3 http://localhost:3002/ ProxyPassReverse /app3 http://localhost:3002/ </IfModule> Yet, I get HTTP 404 when I try to access the above apps.

    Read the article

  • WPF tree data binding

    - by Am
    Hi, I have a well defined tree repository. Where I can rename items, move them up, down, etc. Add new and delete. The data is stored in a table as follows: Index Parent Label Left Right 1 0 root 1 14 2 1 food 2 7 3 2 cake 3 4 4 2 pie 5 6 5 1 flowers 8 13 6 5 roses 9 10 7 5 violets 11 12 Representing the following tree: (1) root (14) (2) food (7) (8) flowers (13) (3) cake (4) (5) pie (6) (9) roeses (10) (11) violets (12) or root food cake pie flowers roses violets Now, my problem is how to represent this in a bindable way, so that a TreeView can handle all the possible data changes? Renaming is easy, all I need is to make the label an updatble field. But what if a user moves flowers above food? I can make the relevant data changes, but they cause a complete data change to all other items in the tree. And all the examples I found of bindable hierarchies are good for non static trees.. So my current (and bad) solution is to reload the displayed tree after relocation change. Any direction will be good. Thanks

    Read the article

< Previous Page | 107 108 109 110 111 112 113 114 115 116 117 118  | Next Page >