Search Results

Search found 10042 results on 402 pages for 'bundle module'.

Page 113/402 | < Previous Page | 109 110 111 112 113 114 115 116 117 118 119 120  | Next Page >

  • ruby nested classes and modules

    - by ash34
    Hi, I am familiar with the concept of nesting classes and modules within another module and grouping them in a namespace. What is the idea / purpose behind Nesting classes within another class class A class B def method_B ... end end end 2.Nesting modules within another class class A module c def method_c ... end end end thanks, ash

    Read the article

  • AngularJS service returning promise unit test gives error No more request expected

    - by softweave
    I want to test a service (Bar) that invokes another service (Foo) and returns a promise. The test is currently failing with this error: Error: Unexpected request: GET foo.json No more request expected Here are the service definitions: // Foo service returns new objects having get function returning a promise angular.module('foo', []). factory('Foo', ['$http', function ($http) { function FooFactory(config) { var Foo = function (config) { angular.extend(this, config); }; Foo.prototype = { get: function (url, params, successFn, errorFn) { successFn = successFn || function (response) {}; errorFn = errorFn || function (response) {}; return $http.get(url, {}).then(successFn, errorFn); } }; return new Foo(config); }; return FooFactory; }]); // Bar service uses Foo service angular.module('bar', ['foo']). factory('Bar', ['Foo', function (Foo) { var foo = Foo(); return { getCurrentTime: function () { return foo.get('foo.json', {}, function (response) { return Date.parse(response.data.now); }); } }; }]); Here is my current test: 'use strict'; describe('bar tests', function () { var currentTime, currentTimeInMs, $q, $rootScope, mockFoo, mockFooFactory, Foo, Bar, now; currentTime = "March 26, 2014 13:10 UTC"; currentTimeInMs = Date.parse(currentTime); beforeEach(function () { // stub out enough of Foo to satisfy Bar service: // create mock object with function get: function(url, params, successFn, errorFn) // that promises to return a response with this property // { data: { now: "March 26, 2014 13:10 UTC" }}) mockFoo = { get: function (url, params, successFn, errorFn) { successFn = successFn || function (response) {}; errorFn = errorFn || function (response) {}; // setup deferred promise var deferred = $q.defer(); deferred.resolve({data: { now: currentTime }}); return (deferred.promise).then(successFn, errorFn); } }; // create mock Foo service mockFooFactory = function(config) { return mockFoo; }; module(function ($provide) { $provide.value('Foo', mockFooFactory); }); module('bar'); inject(function (_$q_, _$rootScope_, _Foo_, _Bar_) { $q = _$q_; $rootScope = _$rootScope_; Foo = _Foo_; Bar = _Bar_; }); }); it('getCurrentTime should return currentTimeInMs', function () { Bar.getCurrentTime().then(function (serverCurrentTime) { now = serverCurrentTime; }); $rootScope.$apply(); // resolve Bar promise expect(now).toEqual(currentTimeInMs); }); }); The error is being thrown at $rootScope.$apply(). I also tried using $rootScope.$digest(), but it gives the same error. Thanks in advance for any insight you can give me.

    Read the article

  • Displaying a notification when bluetooth is disconnected - Android

    - by Ryan T
    I am trying to create a program that will display a notification to the user if a Blue tooth device suddenly comes out of range from my Android device. I currently have the following code but no notification is displayed. I was wondering if it was possible I shouldn't use ACTION_ACL_DISCONNECTED because I believe the bluetooth stack would be expecting packets that state a disconnect is requested. My requirements state that the bluetooth device will disconnect without warning. Thank you for any assistance! BluetoothNotification.java: //This is where the notification is created. import android.app.Activity; import android.app.Notification; import android.app.NotificationManager; import android.app.PendingIntent; import android.content.Context; import android.content.Intent; import android.os.Bundle; import android.app.Activity; import android.app.Notification; import android.app.NotificationManager; import android.app.PendingIntent; import android.content.Context; import android.content.Intent; import android.os.Bundle; public class BluetoothNotification extends Activity { public static final int NOTIFICATION_ID = 1; /** Called when the activity is first created. */ @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.main); /** Define configuration for our notification */ int icon = R.drawable.logo; CharSequence tickerText = "This is a sample notification"; long when = System.currentTimeMillis(); Context context = getApplicationContext(); CharSequence contentTitle = "Sample notification"; CharSequence contentText = "This notification has been generated as a result of BT Disconnecting"; Intent notificationIntent = new Intent(this, BluetoothNotification.class); PendingIntent contentIntent = PendingIntent.getActivity(this, 0, notificationIntent, 0); /** Initialize the Notification using the above configuration */ final Notification notification = new Notification(icon, tickerText, when); notification.setLatestEventInfo(context, contentTitle, contentText, contentIntent); /** Retrieve reference from NotificationManager */ String ns = Context.NOTIFICATION_SERVICE; final NotificationManager mNotificationManager = (NotificationManager) getSystemService(ns); mNotificationManager.notify(NOTIFICATION_ID, notification); finish(); } } Snippet from OnCreate: //Located in Controls.java IntentFilter filter1 = new IntentFilter(BluetoothDevice.ACTION_ACL_DISCONNECTED); this.registerReceiver(mReceiver, filter1); Snippet from Controls.java: private final BroadcastReceiver mReceiver = new BroadcastReceiver() { @Override public void onReceive(Context context, Intent intent) { String action = intent.getAction(); BluetoothDevice device = intent.getParcelableExtra(BluetoothDevice.EXTRA_DEVICE); if (BluetoothDevice.ACTION_ACL_DISCONNECTED.equals(action)) { //Device has disconnected NotificationManager nm = (NotificationManager) getSystemService(NOTIFICATION_SERVICE); } } };

    Read the article

  • Is it possible to add IPTC data to a JPG using python when no such data already exists?

    - by ventolin
    With the IPTCInfo module under Python (http://snippets.dzone.com/posts/show/768 for more info) it's possible to read, modify and write IPTC info to pictures. However, if a JPG doesn't already have IPTC information, the module simply raises an exception. It doesn't seem to be able to create and add this metadata information itself. What alternatives are there? I've googled for the past hour but to no avail whatsoever.

    Read the article

  • Updating DetailViewController from RootController

    - by Stefano Salmaso
    I'm trying to create an iPad application with a similar user interface to Apple's Mail application, i.e: RootView controller (table view) on the left hand side of the split view for navigation with a multiple view hierarchy. When a table cell is selected a new table view is pushed on the left hand side The new view on the left side can update the detail view. I can accomplish both tasks BUT NOT TOGETHER. I mean I can make a multi-level table view in the RootController.(HERE you can find the working source code). Or I can make a single-level table view in the RootController which can update the detailViewController (here there is the source code:http://www.megaupload.com/?d=D6L0463G). Can anyone tell me how to make a multi-level table in the RootController which can update a detailViewController? There is more source code at the link but below is the method in which I presume I have to declare a new detailViewController (which has to be put in the UISplitViewController): - (void)tableView:(UITableView *)TableView didSelectRowAtIndexPath:(NSIndexPath *)indexPath { NSDictionary *dictionary = [self.tableDataSource objectAtIndex:indexPath.row]; //Get the children of the present item. NSArray *Children = [dictionary objectForKey:@"Children"]; // if([Children count] == 0) { /* Create and configure a new detail view controller appropriate for the selection. */ NSUInteger row = indexPath.row; UIViewController <SubstitutableDetailViewController> *detailViewController = nil; if (row == 0) { FirstDetailViewController *newDetailViewController = [[FirstDetailViewController alloc]initWithNibName:@"FirstDetailView" bundle:nil]; detailViewController = newDetailViewController; } if (row == 1) { SecondDetailViewController *newDetailViewController = [[SecondDetailViewController alloc]initWithNibName:@"SecondDetailView" bundle:nil]; detailViewController = newDetailViewController; } // Update the split view controller's view controllers array. NSArray *viewControllers = [[NSArray alloc] initWithObjects:self.navigationController, detailViewController, nil]; splitViewController.viewControllers = viewControllers//nothing happens..... [viewControllers release];// } else { //Prepare to tableview. RootViewController *rvController = [[RootViewController alloc]initWithNibName:@"RootViewController" bundle:[NSBundle mainBundle]]; //Increment the Current View rvController.current_level += 1; //Set the title; rvController.current_title = [dictionary objectForKey:@"Title"]; //Push the new table view on the stack [self.navigationController pushViewController:rvController animated:YES]; rvController.tableDataSource = Children; [rvController.tableView reloadData]; //without this instrucion,items won't be loaded inside the second level of the table [rvController release]; } }

    Read the article

  • Use symfony 1.4 without changing apache configuration

    - by aRagnis
    Is it possible to set the /web directory as webroot whithout changing apache configuration file? I tried using the following .htaccess code, but if i go to localhost/module/, it displays 404 error. But if i go to localhost/web/module/ then everything works. <IfModule mod_rewrite.c> RewriteEngine on RewriteRule sf/(.*) lib/vendor/symfony/data/web/sf/$1 [L] RewriteRule ^$ web/ [L] RewriteRule (.*) web/$1 [L] </IfModule>

    Read the article

  • Why is my UIViewController initializer never called?

    - by mystify
    I made a view-based project from a fresh template. There's a UIViewController which is created with an XIB. In the implementation I uncommented that and added an NSLog. But this is never called: // The designated initializer. Override to perform setup that is required before the view is loaded. - (id)initWithNibName:(NSString *)nibNameOrNil bundle:(NSBundle *)nibBundleOrNil { if ((self = [super initWithNibName:nibNameOrNil bundle:nibBundleOrNil])) { // Custom initialization NSLog(@"nib"); } return self; } since that is initialized from a nib / xib, that should be called for sure, right? however, it doesn't. I do get an NSLog message when I put that in viewDidLoad.

    Read the article

  • APE engine Mysql push data to channel on insert

    - by Fotis
    Hello, i am working with APE Engine (http://www.ape-project.org) and up until now i had no actual problem. The problem is that i would like to use the MySQL module and push data to a channel each time a row is inserted into a table. I've tried to setup a server side module, i created an SQL query but data is fetched only when the server boots. How can i make this work?

    Read the article

  • Good way to "wrap" jars for OSGi with Maven

    - by javamonkey79
    I was looking at the PAX tools on OPS4J for example: this one and I thought I'd found a nice way to: Specify an artifact Create an assembled jar (jar that contains all dependencies) from that jar and it's transitive dependencies Wrap it with BND to create an OSGi bundle It turns out, that I was wrong - it doesn't appear that the PAX stuff does this. (RTFM, right? :) ) But this got me wondering: is there something out there that does what I'm asking? I've thought maybe I could do this by creating a simple POM and using the maven-bundle-plugin but this seems like it might be a bit cumbersome for what I'm asking. NOTE: I get that embedding and assembling jar's is not really "the OSGi way" - so I wouldn't do this unless I really felt it useful. For example - Spring. Thanks in advance.

    Read the article

  • android:black screen switching between activity

    - by 100rabh
    Hi, I am using below code from one of my activity to start another Intent viewIntent = new Intent (getApplicationContext (), landingPage.class); Bundle b = new Bundle (); b.putString ("ApplicationName", a_Bean.getApplicationName ()); if (landingPage.getInstanceCount () < 1) bp.landingPage_ProgressDialog = ProgressDialog.show (ViewAllApp.this, "Please wait...", "Retrieving data...", true, false); viewIntent.putExtras (b); viewIntent.addFlags (Intent.FLAG_ACTIVITY_CLEAR_TOP); startActivityForResult (viewIntent,10); Thread background=new Thread(new Runnable() { public void run() { Progresshandler.sendMessage(handler.obtainMessage());//finishes progressDialog }}); background.start (); but after startactivity it shows a black screen & then displays new activity. Can I make progressdialog to be shown while the black screen is displayed??

    Read the article

  • I18n - JSF variable value translation

    - by Yurish
    Hi! I am using Bundle Internationalization in my project. I have initialized bundle via <f:loadBundle basename="ui.all.bundles.AppResources_en" var="msg"/> When i need to translate some text, i am using a key to resourceBundle, to get a value of it, for example: #{msg.someText}. But, now i want to translate text, which key is a value of another variable. For example: I have variable String textToTransl. It`s value is status_booked. In my AppResources is defined, that status_booked means "It is booked!", so, when i am pointing it to #{msg.textToTransl} i need to see "It is booked!" How can i make it work?

    Read the article

  • Common utility functions for Perl .t tests

    - by zedoo
    Hi I am getting started with Test::More, already have a few .t test scripts. Now I'd like to define a function that will only be used for the tests, but accross different .t files. Where's the best place to put such a function? Define another .t without any tests and require it where needed? (As a sidenote I use the module structure created by Module::Starter)

    Read the article

  • How to restrict code from developers

    - by Kelvin
    My company is planning in hiring outsourcers to work for us, but concerned to give whole existing code to outside world. What is the proper way to deal with security of sharing code in such cases? Is it possible to restrict part of code for developers? So each of them could work on their project without having access to whole repository. P.S. The code we have is very integrated, and its hard to extract "one module", each module can use files from different locations. Thanks in advance

    Read the article

  • My iPhone App don't works in iOS 4. Why?

    - by noflipes
    Hi everybody. I make a iPhone App that display some videos, I made it with Xcode 3.2.2 with iPhone SDK 3.1.3 and works fine. But a few days ago I downloaded the last version of the iPhone SDK for iOS 4, the proyect Build ok, no erros, no warnings, but when I run the aplication the video didnt work, the image didn't load but sound works. I don't understand it. Here is the code that I used. NSBundle *Bundle = [NSBundle mainBundle]; NSString *moviePath = [Bundle pathForResource:@"Prueba" ofType:@"mp4"]; NSURL *movieURL = [[NSURL fileURLWithPath:moviePath] retain]; MPMoviePlayerController *theMovie = [[MPMoviePlayerController alloc] initWithContentURL:movieURL]; theMovie.scalingMode = MPMovieScalingModeFill; [theMovie play]; Some idea? Best regards

    Read the article

  • Replacing python docstrings

    - by tomaz
    I have written a epytext to reST markup converter, and now I want to convert all the docstrings in my entire library from epytext to reST format. Is there a smart way to read the all the docstrings in a module and write back the replacements? ps: ast module perhaps?

    Read the article

  • JSF tags not being rendered as HTML

    - by Toto
    I'm following the Java EE firstcup tutorial using Netbeans and Glassfish. When I execute the JSF web tier I've been instructed to code, the browser gets the same JSF markup coded in the .xhtml file, and the tags are not rendered as HTML tags. I know this by using the view source code in my browser. For example, for this code: <html xmlns="http://www.w3.org/1999/xhtml" xmlns:f="http://java.sun.com/jsf/core" xmlns:h="http://java.sun.com/jsf/html"> <h:head> <title>Page title here</title> </h:head> <h:body> <h2> <h:outputText value="#{bundle.WelcomeMessage}" /> </h2> </h:body> </html> The browser should get something like: <html ...> <head> <title>Page title here</title> </head> <body> <h2> the welcome message goes here </h2> </body> </html> Right? Well, my browser is getting jsf code (the first piece of code above) and not the html code (the second piece of code above). It seems to be a configuration problem in netbeans or glassfish but don't know what. Any ideas? This is my web.xml file: <?xml version="1.0" encoding="UTF-8"?> <web-app version="3.0" xmlns="http://java.sun.com/xml/ns/javaee" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:schemaLocation="http://java.sun.com/xml/ns/javaee http://java.sun.com/xml/ns/javaee/web-app_3_0.xsd"> <context-param> <param-name>javax.faces.PROJECT_STAGE</param-name> <param-value>Development</param-value> </context-param> <servlet> <servlet-name>Faces Servlet</servlet-name> <servlet-class>javax.faces.webapp.FacesServlet</servlet-class> <load-on-startup>1</load-on-startup> </servlet> <servlet-mapping> <servlet-name>Faces Servlet</servlet-name> <url-pattern>/firstcup/*</url-pattern> </servlet-mapping> <session-config> <session-timeout> 30 </session-timeout> </session-config> <welcome-file-list> <welcome-file>greetings.xhtml</welcome-file> </welcome-file-list> </web-app> This is my faces-config.xml file: <?xml version='1.0' encoding='UTF-8'?> <!-- =========== FULL CONFIGURATION FILE ================================== --> <faces-config version="2.0" xmlns="http://java.sun.com/xml/ns/javaee" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:schemaLocation="http://java.sun.com/xml/ns/javaee http://java.sun.com/xml/ns/javaee/web-facesconfig_2_0.xsd"> <application> <resource-bundle> <base-name>firstcup.web.WebMessages</base-name> <var>bundle</var> </resource-bundle> <locale-config> <default-locale>en</default-locale> <supported-locale>es</supported-locale> </locale-config> </application> <navigation-rule> <from-view-id>/greetings.xhtml</from-view-id> <navigation-case> <from-outcome>success</from-outcome> <to-view-id>/response.xhtml</to-view-id> </navigation-case> </navigation-rule> </faces-config> Moreover: The url I'm entering in the browser is http://localhost:8081/firstcup/ but I've also tried: http://localhost:8081/firstcup/greetings.xhtml I've checked Glassfish logs and there's no information about not being able to load FacesServlet

    Read the article

  • Getting "uninitialized constant" in Rails app

    - by Robert McCabe
    I'm new to Rails and feeling my way, but this has me stumped. I moved some constants to a separate module ie: module Fns Fclick = "function() { alert(\"You clicked the map.\");}\n" ... end then in my controller added: require "fns" class GeomapController < ApplicationController def index fstring = Fns::Fclick ... end but when I run the server I get: uninitialized constant Fns::Fclick what am I missing?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • C++ DLL Export: Decorated/Mangled names

    - by Bob
    Created basic C++ DLL and exported names using Module Definition file (MyDLL.def). After compilation I check the exported function names using dumpbin.exe I expect to see: SomeFunction but I see this instead: SomeFunction = SomeFunction@@@23mangledstuff#@@@@ Why? The exported function appears undecorated (especially compared to not using the Module Def file), but what's up with the other stuff? If I use dumpbin.exe against a DLL from any commercial application, you get the clean: SomeFunction and nothing else......

    Read the article

  • What should be proper location for sqlit3 database file?

    - by Elliot Chen
    Hi, Everyone: I'm using a sqlite3 database to store app's data. Instead of building a database within program, I introduced an existing db file: 'abc.sqlite' into my project and put it under my 'Resources' folder. So, I think this db file should be inside of 'bundle', so at my init function, I used following statement to read it out: NSString *path = [[NSBundle mainBundle] pathForResource:@"abc" ofType:"sqlite"]; if(sqlite3_open([path UTF8String], &database) != SQLITE_OK) ... It's ok that this db can be opened and data can be retrieved from it. BUT, someone told me that it's better to copy this db file into user folder: such as 'Document'. So, my question is: is it ok to use this db from main bundle directly or copy it to user folder then use that copy. Which is better? Thank you very much!

    Read the article

  • Getting "stack level too deep" error when deploying with Capistrano, Rails 3.1 ruby 1.9.2

    - by Victor S
    Here is the log for the cap deploy script output around where the error occurs. Anny suggestions why this might be happening? Thanks! [yup.la] executing command [yup.la] sh -c 'cd /srv/www/portrait/releases/20120406051647 && bundle exec rake RAILS_ENV=production RAILS_GROUPS=assets assets:precompile' ** [out :: yup.la] rake aborted! ** [out :: yup.la] ** [out :: yup.la] stack level too deep ** [out :: yup.la] (in /srv/www/portrait/releases/20120406051647/app/assets/stylesheets/mobile.css.scss) ** [out :: yup.la] ** [out :: yup.la] Tasks: TOP => assets:precompile:primary ** [out :: yup.la] (See full trace by running task with --trace) ** [out :: yup.la] command finished in 30868ms *** [deploy:update_code] rolling back * executing "rm -rf /srv/www/portrait/releases/20120406051647; true" servers: ["yup.la"] [yup.la] executing command [yup.la] sh -c 'rm -rf /srv/www/portrait/releases/20120406051647; true' command finished in 288ms failed: "sh -c 'cd /srv/www/portrait/releases/20120406051647 && bundle exec rake RAILS_ENV=production RAILS_GROUPS=assets assets:precompile'" on yup.la /Users/victorstan/Sites/portrait ?

    Read the article

< Previous Page | 109 110 111 112 113 114 115 116 117 118 119 120  | Next Page >