Search Results

Search found 35270 results on 1411 pages for 'nice line'.

Page 115/1411 | < Previous Page | 111 112 113 114 115 116 117 118 119 120 121 122  | Next Page >

  • Command line or library "compare tables" utility for SQL server with comprehensive diff output to a

    - by MicMit
    I can't find anything like that. Commercial or free ( XSQL Lite is suitable for my case and ) tools show diffs in grids with possibility to export to CSV. Also they generate sync SQL scripts when run from command line. What I need is an output as a comprehensive report ( XML , HTML ) suitable for parsing so that I would be able to show similar diff grid in my application ( updated old/new values for each column , added - all values for row , deleted - all values for row and etc... ) .

    Read the article

  • java.util.logging: how to suppress date line

    - by andrews
    I'm trying to suppress output of the date line durinng logging when using the default logger in java.util.logging. For example, here is a typical output: Jun 1, 2010 10:18:12 AM gamma.utility.application info INFO: ping: db-time=2010-06-01 10:18:12.0, local-time=20100601t101812, duration=180000 Jun 1, 2010 10:21:12 AM gamma.utility.application info INFO: ping: db-time=2010-06-01 10:21:12.0, local-time=20100601t102112, duration=180000 I would like to get rid of the Jun 1, 2010... lines, they just clutter my log output. How can I do this?

    Read the article

  • loading multiple line query in one row

    - by bharath
    Hi, How to load a multiple line query in one row using mysql.The data is stored in a text file. For example: "GGAGTTGTGGGAGTGGAGGAGGAAGAGGCGGTGGGGAGTACGGGGGCTGGTCCCAGAAGATGGCGGAGGC GGGGGATTTCTGGTAGGTCCTACTTTAGGACAAGATGTGGTGGTACTGTTGAAGCGTCAGTCTTTGATTC" Thanks in advance.

    Read the article

  • How to transform multiple line into one line in bash stdout ?

    - by Samantha
    Hello, I sometimes do this in my shell : sam@sam-laptop:~/shell$ ps aux | grep firefox | awk '{print $2}' 2681 2685 2689 4645 $ kill -9 2681 2685 2689 4645 Is there a way I can transform the multiple lines containing the PIDs into one line separated by spaces ? (It's a little bit annoying to type the PIDs every time and I really would like to learn :) ) Thanks a lot.

    Read the article

  • NetBeans Java code formatter: logical operators on new line

    - by mizipzor
    My code looks like this: if (firstCondition() && secondCondition()) { // ... code } The default settings for the code formatter in NetBeans wants to put the && on a new line, like this: if (firstCondition() && secondCondition()) { // ... code } The formatter works well so I would just like to find the setting so it doesnt change the code to the latter. Whats the setting called?

    Read the article

  • Animating gradient displays line artifacts in ActionScript

    - by TheDarkIn1978
    i've programatically created a simple gradient (blue to red) sprite rect using my own basic class called GradientRect, but moving or animation the sprite exhibits line artifacts. when the sprite is rotating, it kind of resembles bad reception of an old television set. i'm almost certain the cause is because each line slice of the gradient is vector so there are gaps between the lines - this is visible when the sprite is zoomed in. var colorPickerRect:GradientRect = new GradientRect(200, 200, 0x0000FF, 0xFF0000); addChild(colorPickerRect); colorPickerRect.cacheAsBitmap = true; colorPickerRect.x = colorPickerRect.y = 100; colorPickerRect.addEventListener(Event.ENTER_FRAME, rotate); function rotate(evt:Event):void { evt.target.rotation += 1; } ________________________ //CLASS PACKAGE package { import flash.display.CapsStyle; import flash.display.GradientType; import flash.display.LineScaleMode; import flash.display.Sprite; import flash.geom.Matrix; public class GradientRect extends Sprite { public function GradientRect(gradientRectWidth:Number, gradientRectHeight:Number, ...leftToRightColors) { init(gradientRectWidth, gradientRectHeight, leftToRightColors); } private function init(gradientRectWidth:Number, gradientRectHeight:Number, leftToRightColors:Array):void { var leftToRightAlphas:Array = new Array(); var leftToRightRatios:Array = new Array(); var leftToRightPartition:Number = 255 / (leftToRightColors.length - 1); var pixelColor:Number; var i:int; //Push arrays for (i = 0; i < leftToRightColors.length; i++) { leftToRightAlphas.push(1); leftToRightRatios.push(i * leftToRightPartition); } //Graphics matrix and lineStyle var leftToRightColorsMatrix:Matrix = new Matrix(); leftToRightColorsMatrix.createGradientBox(gradientRectWidth, 1); graphics.lineStyle(1, 0, 1, false, LineScaleMode.NONE, CapsStyle.NONE); for (i = 0; i < gradientRectWidth; i++) { graphics.lineGradientStyle(GradientType.LINEAR, leftToRightColors, leftToRightAlphas, leftToRightRatios, leftToRightColorsMatrix); graphics.moveTo(i, 0); graphics.lineTo(i, gradientRectHeight); } } } } how can i solve this problem?

    Read the article

  • Current Line For Visual Studio Macros

    - by Vadim
    How can I read text of a current line (where cursor is situated) from Macros? I'm going to use such a fucntion: Public Sub AddTextToChangeLogFile() Dim textOnACurrentLine As ??? textOnACurrentLine = ??? If textOnACurrentLine.Text <> String.Empty Then Dim sw As New StreamWriter("C:\###\Changes.txt", True) sw.WriteLine(textOnACurrentLine + ". file: " + DTE.ActiveDocument.Name) sw.Close() End If End Sub

    Read the article

  • Batch file command line arguments

    - by Hema Joshi
    I want to pass a command as a command line argument from one batch file to another e.g. first.bat call test.bat "echo hello world" "echo welcome " test.bat set initialcommand=%1 set maincommand=%2 %maincommand% %initialcommand%

    Read the article

  • Convert Line breaks to html break for all field getters in Symfony project

    - by Ben
    I am working on a Symfony project and I currently have this: <?php echo preg_replace('/\n/','<br />', $review->getComments()); ?> and would very much like to be able to make all getters add html line breaks so i don't have to pepper my code with preg_replace. the $object-getFieldname methods are work automatically so I am looking to extend this somewhere to globally add a new method. What is the best approach here?

    Read the article

  • Getting following exception javax.sound.sampled.LineUnavailableException: line with format ULAW 800

    - by angelina
    Dear All, I tried to play and get duration of a wave file using code below but got following exception.please resolve.I m using a wave file format. URL url = new URL("foo.wav"); Clip clip = AudioSystem.getClip(); AudioInputStream ais = AudioSystem.getAudioInputStream(url); clip.open(ais); System.out.println(clip.getMicrosecondLength()); **javax.sound.sampled.LineUnavailableException: line with format ULAW 8000.0 Hz, 8 bit, mono, 1 bytes/frame, not supported.**

    Read the article

  • How to resume CUPS printer from command line

    - by stach81
    Hello I have printer in CUPS that due driver problems (hp 1010) form time to time goes into pause. I would like to write a shell script that will be once per hour resuming printer in cups. But I have no idea after googling for couple of minutes how to resume printer from shell command line. Regards Stan

    Read the article

  • Python: try statement single line

    - by Brant
    Is there a way in python to turn a try/except into a single line? something like... b = 'some variable' a = c | b #try statement goes here Where b is a declared variable and c is not... so c would throw an error and a would become b...

    Read the article

  • Simple Tableless Positioning issue: Trying to float Div right on same line

    - by MrEnder
    Ok I just started a template for a website http://clickforclicks.com/design1/ I'm trying to make it tableless. Notice I have a red div along the side. I tried to get one on the otherside aswell that looked the same. But when I do it. It goes to a new line =[ How might I get this effect without using Javascript or Absolute positioning that wont look proper on all resolution sizes.

    Read the article

  • multi-line pattern matching in pyhon

    - by Horace Ho
    A periodic computer generated message (simplified): Hello user123, - (604)7080900 - 152 - minutes Regards Using python, how can I extract "(604)7080900", "152", "minutes" (i.e. any text following a leading "- " pattern) between the two empty lines (empty line is the \n\n after "Hello user123" and the \n\n before "Regards"). Even better if the result string list are stored in an array. Thanks!

    Read the article

  • Can you reverse order a string in one line with LINQ or a LAMBDA expression

    - by Student for Life
    Not that I would want to use this practically (for many reasons) but out of strict curiousity I would like to know if there is a way to reverse order a string using LINQ and/or LAMBDA expressions in one line of code, without utilising any framework "Reverse" methods. e.g. string value = "reverse me"; string reversedValue = (....); and reversedValue will result in "em esrever" EDIT Clearly an impractical problem/solution I know this, so don't worry it's strictly a curiosity question around the LINQ/LAMBDA construct.

    Read the article

  • Placement of command line options in bash

    - by Nathan Rambeck
    I just starting using a Mac and have been frustrated that command line options are required immediately following the command so that this works: ls -la /usr but this doesn't: ls /usr -la ls: -la: No such file or directory Is there any way to change this? Or can someone tell me why the placement of options is agnostic on most Linux platforms, but not on Mac?

    Read the article

< Previous Page | 111 112 113 114 115 116 117 118 119 120 121 122  | Next Page >