Search Results

Search found 3804 results on 153 pages for 'regex lookarounds'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 116/153 | < Previous Page | 112 113 114 115 116 117 118 119 120 121 122 123  | Next Page >

  • Finding C#-style unescaped strings using regular expressions

    - by possan
    I'm trying to write a regular expression that finds C#-style unescaped strings, such as string x = @"hello world"; The problem I'm having is how to write a rule that handles double quotes within the string correctly, like in this example string x = @"before quote ""junk"" after quote"; This should be an easy one, right?

    Read the article

  • Regular Expression Fails

    - by Meander365
    Anyone help? When I run this I get " invalid quantifier ?<=href= " var aHrefMatch = new RegExp("(?<=href\=")[^]+?(?=")"); var matchedLink = mystring.match(aHrefMatch); But I know the regular expression is valid. Any ideas?

    Read the article

  • How to modify complex argument strings in Perl

    - by mmccoo
    I have a cmdline that I'm trying to modify to remove some of the arguments. What makes this complex is that I can have nested arguments. Say that I have this: $cmdline = "-a -xyz -a- -b -xyz -b- -a -xyz -a-" I have three different -xyz flags that are to be interpreted in two different contexts. One is the -a context and the other is the -b context. I want to remove the "a" -xyz's but leave the ones in the "b" -xyz. How can I most effectively do this in Perl?

    Read the article

  • python and regular expression with unicode

    - by bsn
    I need to delete some unicode symbols from the string '?????? ??????? ???????????? ??????????' I know they exist here for sure. I try: re.sub('([\u064B-\u0652\u06D4\u0670\u0674\u06D5-\u06ED]+)', '', '?????? ??????? ???????????? ??????????') but it doesn't work. String stays the same. ant suggestion what i do wrong?

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • [Qt] Check octal number

    - by sterh
    Hello, I write simple application in C++/Qt. And i have a text and some octal number in it. My app splits this text by spaces. And i need to check octal numbers from text. How can i select octal numbers from this text with regular expressions? Thank you.

    Read the article

  • Normalizing Strings using Regexes

    - by RasputinJones
    How do I match this string "1 & 2" from this string "Foo Bar 1 & 2"? How do I match this string "1, 2 & 3" from this string "Foo Baz 1, 2 & 3"? Trying to split out "Foo Bar" from the string using regexes while using the presence of "1 & 2" or "1, 2 & 3" as conditionals to normalize these strings into "Foo Bar 1" and "Foo Bar 2" or "Foo Baz 1", "Foo Baz 2" and "Foo Baz 3" respectively.

    Read the article

  • Match Phrases (in array) in text string

    - by Tim Hanssen
    I'm using the Twitter API streaming to collect thousand of tweets every minute. They need to be matched to a list of keywords (can contain spaces). This is my current method: $text = preg_replace( '/[^a-z0-9]+/i', ' ', strtolower( $data['text'] ) ); $breakout = explode( " ", $text ); $result = array_intersect( $this->_currentTracks, $breakout ); I chop the tweet into words, and the matches them against my current keywords. This works well for all the keywords without a space ofc. If I wanted to find for example "Den Haag", It won't show up, because the string is exploded into words (based on the spaces). Any ideas about how I can do this in a quick way? Kind regards, Tim

    Read the article

  • Regular expression one or more times JAVA

    - by user1381564
    Hi i am trying to match a string against a pattern this is the possible string signal CS, NS, dl: stateType := writeOrRead0; signal CS, pS : stateType := writeOrRead0; signal dS : stateType := writeOrRead0; i am only concerned with the pattern as far as the first colon. but the number of signals define can be more than one it could be three or four even this is the regular expression i have ^signal\\s*(\\w+),*\\s*(\\w+)\\s*: it will pick up the second two signal but and for the second one it picks up CS and pS and but the d and S in the next signal when i use matcher.group() come up seperately Can anyone give me an expression that will pick up all signal names whether there is one two three or more?

    Read the article

  • Using varible in re.match in python

    - by screwuphead
    I am trying to create an array of things to match in a description line. So I cant ignore them later on in my script. Below is a sample script that I have been working on, on the side. Basically I am trying to take a bunch of strings and match it against a bunch of other strings. AKA: asdf or asfs or wrtw in string = true continue with script if not print this. import re ignorelist = ['^test', '(.*)set'] def guess(a): for ignore in ignorelist: if re.match(ignore, a): return('LOSE!') else: return('WIN!') a = raw_input('Take a guess: ') print guess(a) Thanks

    Read the article

  • How can I match everything in a string until the second occurrence of a delimiter with a regular expression?

    - by Steve
    I am trying to refine a preg_match_all by finding the second occurrence of a period then a space: <?php $str = "East Winds 20 knots. Gusts to 25 knots. Waters a moderate chop. Slight chance of showers."; preg_match_all ('/(^)((.|\n)+?)(\.\s{2})/',$str, $matches); $dataarray=$matches[2]; foreach ($dataarray as $value) { echo $value; } ?> But it does not work: the {2} occurrence is incorrect. I have to use preg_match_all because I am scraping dynamic HTML. I want to capture this from the string: East Winds 20 knots. Gusts to 25 knots.

    Read the article

  • Some pro regular expressions help needed here

    - by Camran
    I need a special regular expression, have no experience in them whatsoever so I am turning to you guys on this one: I need to validate a classifieds title field so it doesn't have any special characters in it, almost. Only letters and numbers should be allowed, and also the swedish three letters å, ä, ö, and also not case sensitive. Besides the above, these should also be allowed: The "&" sign. Parenthesis sign "()" Mathematical signs "-", "+", "%", "/", "*" Dollar and Euro signs Accent sign or whatever it's called, for example in "coupé" the apostrophe above the "e". Double quote and singel quote signs. The comma "," and point "." signs Thanks

    Read the article

  • Find multiple patterns with a single preg_match_all in PHP

    - by Mark
    Using PHP and preg_match_all I'm trying to get all the HTML content between the following tags (and the tags also): <p>paragraph text</p> don't take this <ul><li>item 1</li><li>item 2</li></ul> don't take this <table><tr><td>table content</td></tr></table> I can get one of them just fine: preg_match_all("(<p>(.*)</p>)siU", $content, $matches, PREG_SET_ORDER); Is there a way to get all the <p></p> <ul></ul> <table></table> content with a single preg_match_all? I need them to come out in the order they were found so I can echo the content and it will make sense. So if I did a preg_match_all on the above content then iterated through the $matches array it would echo: <p>paragraph text</p> <ul><li>item 1</li><li>item 2</li></ul> <table><tr><td>table content</td></tr></table>

    Read the article

  • Form validation in JAvascript with Regexp

    - by Nikita Barsukov
    I have a webpage with an input field where only digits are allowed. The input field has an onkeyup event that starts this validating function: function validate() { var uah_amount = document.getElementById("UAH").value; var allowed = /^\d+$/; document.getElementById("error").innerHTML = document.getElementById("UAH").value; if (!allowed.test(uah_amount)) { document.getElementById("error").style.backgroundColor = "red"; } } Everything works as I expect until I hit Backspace button to remove some characters. In this case function always behaves as if I entered letters. How to correct this?

    Read the article

  • preg_replace replacing with array

    - by Scott
    What I want to do is replace the "[replace]" in input string with the corresponding vaule in the replace array. The total number of values will change but there will always be the same number in the replace array as in input string. I have tried doing this with preg_replace and preg_replace_callback but I can't get the pattern right for [replace], I also tried using vsprintf but the % in <table width="100%"> was messing it up. All help is greatly appreciated! Replace Array: $array = array('value 1','value 2','value 3'); Input String $string = ' <table width="100%"> <tr> <td>Name:</td> <td>[replace]</td> </tr> <tr> <td>Date:</td> <td>[replace]</td> </tr> <tr> <td>Info:</td> <td>[replace]</td> </tr> </table> '; Desired Result <table width="100%"> <tr> <td>Name:</td> <td>value 1</td> </tr> <tr> <td>Date:</td> <td>value 2</td> </tr> <tr> <td>Info:</td> <td>value 3</td> </tr> </table>

    Read the article

  • regular expression - function body extracting

    - by Altariste
    Hi, In Python script,for every method definition in some C++ code of the form: return_value ClassName::MethodName(args) {MehodBody} ,I need to extract three parts: the class name, the method name and the method body for further processing. Finding and extracting the ClassName and MethodName is easy, but is there any simple way to extract the body of the method? With all possible '{' and '}' inside it? Or are regexes unsuitable for such task?

    Read the article

  • Perl regular expression question

    - by user368311
    Suppose I have variables $x1 = 'XX a b XX c d XX'; $x2 = 'XX a b XX c d XX e f XX'; I want a regular expression that will find each instance of letters between XX. I'm looking for a general solution, because I don't know how many XX's there are. I tried using /XX(.*?)XX/g but this only matches "a b" for x1 and "a b", "e f" for x2 because once the first match is found, the engine has already read the second "XX". Thanks for any help.

    Read the article

  • dropping characters from regular expression groups

    - by tcurdt
    The goal: I want to convert a number from the format "10.234,56" to "10234.56" Using this simple approach almost gets us there /([\d\.]+),(\d\d)/ => '\1.\2' The problem is that the first group of the match (of course) still contains the '.' character. So questions are: Is it possible to exclude a character from the group somehow? How would you solve this with a single regexp (I know this is a trivial problem when not using a single regexp)

    Read the article

  • jQuery: Replace strings with .each()

    - by Warrantica
    I want a function that replace each li with an image. This is my code: $(document).ready(function(){ var tmphref; var tmpname; var str = '<a href="' + tmphref + '"><img src="http://www.somesite.com/a/' + tmpname[1] + '/avatar-small.jpg /></a>'; $('#somediv li a').each(function(){ tmphref = $(this).attr("href"); tmpname = /http\:\/\/(\w+)\.somesite\.com\//.exec(tmphref); $(this).parent().replaceWith(str); }); }); The image is in this specific path: www.somesite.com/a/username/avatar-small.jpg The code above doesn't work. Any ideas? Thank you in advance.

    Read the article

  • Regular Expression

    - by Blanca
    Hi! i would like to avoid texts like this one: height="49" with a regular expresion. I tought in .replaceAll("\s*="*"",""); (replaceAll is used as a method in a java class), but eclipse don't allowed me to do that. Any other suggestion?? tx!

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 112 113 114 115 116 117 118 119 120 121 122 123  | Next Page >