Search Results

Search found 5311 results on 213 pages for 'greek characters'.

Page 118/213 | < Previous Page | 114 115 116 117 118 119 120 121 122 123 124 125  | Next Page >

  • Special chars in Amazon S3 keys?

    - by Martin
    Is it possible to have special characters like åäö in the key? If i urlencode the key before storing it works, but i cant really find a way to access the object. If i write åäö in the url i get access denied (like i get if the object is not found). If i urlencode the url i paste in the browser i get "InvalidURICouldn't parse the specified URI". Is there some way to do this?

    Read the article

  • Drill down rss reader iphone

    - by bing
    Hi everyone, I have made a simple rss reader. The app loads an xml atom file in an array. Now I have added categories to my atom feed, which are first loaded in the array What is the best way to add drill down functionality programmatically. Now only the categories are loaded into the array and displayed. This is the implementation code ..... loading xml file <snip> ..... - (void)parserDidStartDocument:(NSXMLParser *)parser { NSLog(@"found file and started parsing"); } - (void)parser:(NSXMLParser *)parser parseErrorOccurred:(NSError *)parseError { NSString * errorString = [NSString stringWithFormat:@"Unable to download story feed from web site (Error code %i )", [parseError code]]; NSLog(@"error parsing XML: %@", errorString); UIAlertView * errorAlert = [[UIAlertView alloc] initWithTitle:@"Error loading content" message:errorString delegate:self cancelButtonTitle:@"OK" otherButtonTitles:nil]; [errorAlert show]; } - (void)parser:(NSXMLParser *)parser didStartElement:(NSString *)elementName namespaceURI:(NSString *)namespaceURI qualifiedName:(NSString *)qName attributes:(NSDictionary *)attributeDict{ //NSLog(@"found this element: %@", elementName); currentElement = [elementName copy]; if ([elementName isEqualToString:@"entry"]) { // clear out our story item caches... Categoryentry = [[NSMutableDictionary alloc] init]; currentID = [[NSMutableString alloc] init]; currentTitle = [[NSMutableString alloc] init]; currentSummary = [[NSMutableString alloc] init]; currentContent = [[NSMutableString alloc] init]; } } - (void)parser:(NSXMLParser *)parser didEndElement:(NSString *)elementName namespaceURI:(NSString *)namespaceURI qualifiedName:(NSString *)qName{ //NSLog(@"ended element: %@", elementName); if ([elementName isEqualToString:@"entry"]) { // save values to an entry, then store that item into the array... [Categoryentry setObject:currentTitle forKey:@"title"]; [Categoryentry setObject:currentID forKey:@"id"]; [Categoryentry setObject:currentSummary forKey:@"summary"]; [Categoryentry setObject:currentContent forKey:@"content"]; [categories addObject:[Categoryentry copy]]; NSLog(@"adding category: %@", currentTitle); } } - (void)parser:(NSXMLParser *)parser foundCharacters:(NSString *)string{ //NSLog(@"found characters: %@", string); // save the characters for the current item... if ([currentElement isEqualToString:@"title"]) { [currentTitle appendString:string]; } else if ([currentElement isEqualToString:@"id"]) { [currentID appendString:string]; } else if ([currentElement isEqualToString:@"summary"]) { [currentSummary appendString:string]; } else if ([currentElement isEqualToString:@"content"]) { [currentContent appendString:string]; } } - (void)parserDidEndDocument:(NSXMLParser *)parser { [activityIndicator stopAnimating]; [activityIndicator removeFromSuperview]; NSLog(@"all done!"); NSLog(@"categories array has %d entries", [categories count]); [newsTable reloadData]; }

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Why use spaces instead of tabs for indentation? [closed]

    - by erenon
    Possible Duplicate: Are spaces preferred over tabs for indentation? Why do most coding standards recommend the use of spaces instead of tabs? Tabs can be configured to be as many characters wide as needed, but spaces can't. Example: Zend cs Pear cs Pear manual: This helps to avoid problems with diffs, patches, SVN history and annotations. How could tabs cause problems?

    Read the article

  • timeout stringwithcontentsofurl

    - by sergiobuj
    Hi, I have this call to stringwithcontentsofurl: [NSString stringWithContentsOfURL:url usedEncoding:NSASCIIStringEncoding error:nil]; How can I give that a simple timeout? I don't want to use threads or operation queues (the content of the url is about 100 characters), I just don't want to wait too long when the connection is slow.

    Read the article

  • How do I write a Oracle SQl query for this tricky question...

    - by atrueguy
    Here is the table data with the column name as Ships. +--------------+ Ships | +--------------+ Duke of north | ---------------+ Prince of Wales| ---------------+ Baltic | ---------------+ In the Outcomes table, transform names of the ships containing more than one space, as follows: Replace all characters between the first and the last spaces (excluding these spaces) by symbols of an asterisk (*). The number of asterisks must be equal to number

    Read the article

  • [PHP] Read and write to a file while keeping lock

    - by Znarkus
    Hi! I am making a simple page load counter by storing the current count in a file. This is how I want to do this: Lock the file Read the current count Increment it Write new count Unlock file/close it Can this be done? As I understand it, the file can't be written to without losing the lock. The only way I have come up with to tackle this, is to write a character using "r+" mode, and then counting characters.

    Read the article

  • php regex - replace on "\${1}"

    - by Qiao
    found this regex: insert " " every 10 characters: $text = preg_replace("|(.{10})|u", "\${1}"." ", $text); can you, please, explain what \${1} means. Why using \ and what curly brackets means?

    Read the article

  • how could I store data within a GUID

    - by Mark
    I have an application that I want to represent a users session (just small pieces of data here and there) within a GUID. Its a 16 HEX characters (so 16^16 possible values) string and I want to 'encode' some data within that GUID. How can I achieve this? I am really after any ideas and implementations here, Ive not yet decided on the best mechanism for it yet. I would also like encryption to be involved if possible... Thanks a lot Mark

    Read the article

  • UILabel to render partial character using clip

    - by magic-c0d3r
    I want a UILabel to render a partial character by setting the lineBreakMode to clip. But it is clipping the entire character. Is there a different way to clip a word so that only partial character is displayed? Lets say I have a string like: "Hello Word" and that string is in a myLabel with a width that only fits the 5 characters and part of the "W" I want it still to render part of the "W" and not drop it from the render.

    Read the article

  • Problem with regular expression for some special parttern.

    - by SpawnCxy
    Hi all, I got a problem when I tried to find some characters with following code: preg_match_all('/[\w\uFF10-\uFF19\uFF21-\uFF3A\uFF41-\uFF5A]/',$str,$match); //line 5 print_r($match); And I got error as below: Warning: preg_match_all() [function.preg-match-all]: Compilation failed: PCRE does not support \L, \l, \N, \U, or \u at offset 4 in E:\mycake\app\webroot\re.php on line 5 I'm not so familiar with reg expression and have no idea about this error.How can I fix this?Thanks.

    Read the article

  • preg_match in php

    - by Satish
    I want to use preg_match() such that there should not be special characters such as `@#$%^&/ ' in a given string. For example : Coding : Outputs valid : Outputs Invalid(String beginning with space) 12Designing : outputs invalid Project management :Outputs valid (space between two words are valid) 123 :Outputs invalid

    Read the article

  • Problem on creating font using a custom ant task, which extends LWUIT's FontTask.

    - by Smithy
    Hi. I am new to LWUIT and j2me, and I am building a j2me application for showing Japanese text vertically. The phonetic symbol part of the text should be shown in relatively small font size (about half the size of the text), small Kanas need to be shown as normal ones, and some 'vertical only' characters need to be put into the Private Use Area, etc. I tried to build this font into a bitmap font using the FontTask ant task LWUIT provided, but found that it does support the customizations mentioned above. So I decided to write my own task and add those. Below is what I have achieved: 1 An ant task extending the LWUITTask task to support a new nested element <verticalfont>. public class VerticalFontBuildTask extends LWUITTask { public void addVerticalfont(VerticalFontTask anVerticalFont) { super.addFont(anVerticalFont); } } 2 The VerticalFontTask task, which extends the original FontTask. Instead of inserting a EditorFont object, it inserts a VerticalEditorFont object(derived from EditorFont) into the resource. public class VerticalFontTask extends FontTask { // some constants are omitted public VerticalFontTask() { StringBuilder sb = new StringBuilder(); sb.append(UPPER_ALPHABET); sb.append(UPPER_ALPHABET.toLowerCase()); sb.append(HALFWIDTH); sb.append(HIRAGANA); sb.append(HIRAGANA_SMALL); sb.append(KATAKANA); sb.append(KATAKANA_SMALL); sb.append(WIDE); this.setCharset(sb.toString()); } @Override public void addToResources(EditableResources e) { log("Putting rigged font into resource..."); super.addToResources(e); //antialias settings Object aa = this.isAntiAliasing() ? RenderingHints.VALUE_TEXT_ANTIALIAS_ON :RenderingHints.VALUE_TEXT_ANTIALIAS_OFF; VerticalEditorFont ft = new VerticalEditorFont( Font.createSystemFont( this.systemFace, this.systemStyle, this.systemSize), null, getLogicalName(), isCreateBitmap(), aa, getCharset()); e.setFont(getName(), ft); } VerticalEditorFont is just a bunch of methods logging to output and call the super. I am still trying to figure out how to extend it. But things are not going well: none of the methods on the VerticalEditorFont object get called when executing this task. My questions are: 1 where did I do wrong? 2 I want to embed a truetype font to support larger screens. I only need a small part of the font inside my application and I don't want it to carry a font resource weighing 1~2MB. Is there a way to extract only the characters needed and pack them into LWUIT?

    Read the article

  • How to control the font size of html select boxes on iPhone

    - by Zorzella
    Regular HTML select boxes (such as, e.g. found here), while being "chosen" are presented by the iPhone on a native widget that seems to totally ignore regular html font sizes and whatnot. It does some ellipsing when it goes too long, but the font is way too big for a list I want to present -- even on landscape, only about 35 characters can fit. Is there any way to tell the iPhone to use a smaller font there?

    Read the article

  • How to strip specific contents of a String in Java

    - by user2974877
    So I have a string, and I want to strip out some parts of it using, for example, the firt and last characters of the "interesting" part. String dirty = "$!$!%!%$something interesting&!!$!%$something interesting2"; And the output something like: String clean = "something interesting:something interesting2"; Note: The code needs to work without knowing the random part, changing everytime the program runs. I researched and only found code that does it, but only knowing the random segment.

    Read the article

  • How do I add html link to image title

    - by Jason
    I'm actually needing to include html links in the longdesc attribute. I've altered prettyphoto to use longdesc instead of title for images, but I need to include html links in those descriptions. I know it's possible with code for characters, I just don't remember what those are. Thanks

    Read the article

  • Internationalization string testing

    - by LicenseQ
    Some people using look-alike Unicode symbols to replace English characters to test the internationalization, e.g. "Test" is replaced as "Test". Is there a wellknown name for this language/culture? Are there utils, keyboard layouts, translation tools for this "language"?

    Read the article

  • Images inside of UILabel

    - by enby
    hello everyone! I'm trying to find the best way to display images inside of UILabels (in fact, I wouldn't mind switching to something other than UILabel if it supports images with no hassle) The scenario is: I have a table view with hundreds of cells and UILabel being the main component of each cell The text I assign to each cell contains sequences of characters that need to be parsed out and represented as an image In simpler words, imagine a TableView of an instant messenger that parses replaces all ":)", ":(", ":D" etc with corresponding smiley images Any input would be greatly appreciated!

    Read the article

< Previous Page | 114 115 116 117 118 119 120 121 122 123 124 125  | Next Page >