Search Results

Search found 35200 results on 1408 pages for 't string'.

Page 1181/1408 | < Previous Page | 1177 1178 1179 1180 1181 1182 1183 1184 1185 1186 1187 1188  | Next Page >

  • Ubuntu NBR karmic boot freezes at fsck from util-linux-ng 2.16

    - by BlueBill
    Hi all, I have a netbook (emachine e250 - equivalent to an acer aspire one) and I have Ubunutu NBR 9.10 installed on it. Every other cold boot freezes at the following error message: "fsck from util-linux-ng 2.16" There is no disk activity, no activity what so ever. I have left the machine sit for over an hour and nothing. It takes a couple of hard resets to be able to boot properly. Once it boots everything works great (wireless, suspend/resume, etc.)! I have spent the last couple of weeks researching the problem and the only thing that seems to work is setting nolapic in the boot string in grub - it boots every time. Unfortunately, nolapic disables the second core and causes problems with suspend resume. At first I thought it was an fsck problem with the first partition on the hard disk as it is a hidden ntfs partition containing the windows xp recover information. So in /etc/fstab I set the partition so that it would be ignored by fsck. This didn't seem to do anything. I have these partitions: /dev/sda1 - an ntfs recovery partition /dev/sda2 - /boot /dev/sda3 - swap /dev/sda5 - / /dev/sda6 - /home I am running kernel version 2.6.31-19-generic and have all the patches (as indicated by update manager). I also have no splash screen so I can see the boot progress. I have only been using NBR since January, I have been using Ubuntu on my desktop since last June (2009-06). What logs should I be looking at? Is there a log for failed boots? Thanks, Troy

    Read the article

  • Create SAMBA node trust relationship to Windows 2003 PDC server

    - by Rod Regier
    I am having problems creating a trust relationship between an OpenVMS/IA64 node running V/IA64 8.3-1H1, TCPIP 5.6 ECO 5, CIFS 1.1 ECO1 PS11 (SAMBA 3.0.28a) and Windows 2003 server running as a PDC. I do have two other OpenVMS/Alpha nodes running V/A 8.3, TCPIP 5.6 ECO 4, CIS 1.1 ECO1 PS10 (SAMBA 3.0.28a) with working trust relationships to the same Windows 2003 server. Looking for assistance in resolving the trust "handshake". \\ Details from failing node. Unless otherwise noted, corresponding files on working nodes are similar or identical. SMB.CONF extract: [global] server string = Samba %v running on %h (OpenVMS) workgroup = WILMA netbios name = %h security = DOMAIN encrypt passwords = Yes name resolve order = lmhosts host wins bcast Password server = * log file = /samba$log/log.%m printcap name = /sys$manager/ucx$printcap.dat guest account = DYMAX print command = print %f/queue=%p/delete/passall/name="""""%s""""" lprm command = delete/entry=%j map archive = No printing = OpenVMS net rpc testjoin [2010/08/13 16:09:28, 0] SAMBA$SRC:[SOURCE.RPC_CLIENT]CLI_PIPE.C;1:(2443) get_schannel_session_key: could not fetch trust account password for domain 'WILMA' [2010/08/13 16:09:28, 0] SAMBA$SRC:[SOURCE.UTILS]NET_RPC_JOIN.C;1:(72) net_rpc_join_ok: failed to get schannel session key from server W2K3AD2 for domain WILMA. Error was NT_STATUS_CANT_ACCESS_DOMAIN_I NFO Join to domain 'WILMA' is not valid net rpc join "-Uaccount%password" tdb_open_isam: error verifying status of file SAMBA$ROOT:[PRIVATE]secrets.tdb tdb_open_isam: errno value = 1 [2010/08/13 16:21:13, 0] SAMBA$SRC:[SOURCE.PASSDB]SECRETS.C;1:(72) Failed to open /SAMBA$ROOT/PRIVATE/secrets.tdb [2010/08/13 16:21:13, 0] SAMBA$SRC:[SOURCE.UTILS]NET_RPC.C;1:(322) error storing domain sid for WILMA tdb_open_isam: error verifying status of file SAMBA$ROOT:[PRIVATE]secrets.tdb tdb_open_isam: errno value = 1 [2010/08/13 16:21:13, 0] SAMBA$SRC:[SOURCE.PASSDB]SECRETS.C;1:(72) Failed to open /SAMBA$ROOT/PRIVATE/secrets.tdb [2010/08/13 16:21:13, 0] SAMBA$SRC:[SOURCE.UTILS]NET_RPC_JOIN.C;1:(409) error storing domain sid for WILMA Unable to join domain WILMA. \\ Example from other node: net rpc testjoin Join to 'WILMA' is OK

    Read the article

  • Replace text with spaces in MySQL

    - by javipas
    I'm trying to do a global replace of search in my database, which has a lot of articles with a double carriage return because of this code: <p> </p> I'd like to replace this in my WordPress blog so instead of that appears... nothing, and so I can delete the CR. I've tried this on my database UPDATE wp_posts set post_content = replace (post_content,'<p> </p>',''); but didn't work. Why? Do I have to add special thinks to consider the space between the <p>and the</p>? Mmm. Good points, both Jon Angliss and Wim. Jon, as you could have guessed, the database shows no entries with that text string. So there's something going on inside the post_content field. Wim, the famous   was replaced previously, but there are still hundreds of posts that for some reason have something different between the p and the /p tags. I've done a search of one of the posts with this error: mysql> select * from wp_posts where post_title like '%3DVisionLive%'; And looking in the wp_content field, this is a little piece of the post: Phil Eisler, responsable de la divisi?n 3D Vision.?</p> <p>?</p> <p>Este portal ser? por tanto No spanish tilde (accent) shown on the terminal, and instead of an space there's a quotation mark between the p and the /p tags. I've tried to replace <p>?</p>, but again, no results. There's some character (or several) there, but I don't know how to discover that. Maybe it's the character set of my terminal, but I've accessed the database from phpmyadmin and in that case there's a space character between the p and the /p. Weird.

    Read the article

  • Samba authentication problem when attempting to connect from Windows client

    - by Camsoft
    I've got a Linux server running Ubuntu and Samba. I've created two shares in Samba that point to directories that are owned by the user "cameron". When I attempt to connect to these shares on Windows 7 is connects and allows me to see the files but they are read-only. This is the desired action for guest users but not for authenticated users. My user on the Windows client is "Cameron" and has the same password as the Linux user "cameron". I don't think my Windows user has authenticated against the Linux user. I even created a users.map file to map the user cameron (linux) to Cameron (windows) but still it does not work. Here is my samba config file (UPDATED): [global] server string = %h server (Samba, Ubuntu) map to guest = Bad User passwd program = /usr/bin/passwd %u passwd chat = *Enter\snew\s*\spassword:* %n\n *Retype\snew\s*\spassword:* %n\n *password\supdated\ssuccessfully* . username map = /etc/samba/users.map syslog = 0 log file = /var/log/samba/log.%m max log size = 1000 os level = 65 preferred master = Yes dns proxy = No wins support = Yes usershare allow guests = Yes panic action = /usr/share/samba/panic-action %d valid users = cameron write list = cameron [www] path = /usr/local/apache2/htdocs write list = @www-data force group = www-data guest ok = Yes [cameron] path = /home/cameron write list = @www-data force group = www-data guest ok = Yes

    Read the article

  • SQL Server 2008 login problem with ASP.NET application: Failed to open the explicitly specified data

    - by eulerfx
    I am running SQL Server 2008 Express Edition on Windows Server 2008 with an ASP.NET application which must access the server. The ASP.NET application is associated with an application pool that runs on the NetworkService account. This account in turn has a Login and User record on SQL Server in the required database. When I attempt to run the ASP.NET website I get a blank page and when viewed in the error log, I seem to be getting this information event record: Login failed for user 'NT AUTHORITY\NETWORK SERVICE'. Reason: Failed to open the explicitly specified database. [CLIENT: myLocalMachine] The connection string has Trusted_Connection=True; and the required database specified. When I explicitly specify the user name and password I get another login error stating the password is incorrect, even though the same un/pw combination works through SQL Server Management studio. The NETWORK SERVICE account seems to have all the required privileges for the database. Also, I made a test ASP.NET website project which does a simple select from a table in that database, and using the same config file I am not getting the error and it seems to work. Is it something to do with trust levels then, because the original ASP.NET web app references various DLLs including open source libraries. Also, the application does not seem to be able to write to the event log itself, throwing a security exception, even though everything in the config files, including machine.config states the app is in full trust.

    Read the article

  • Need help in setting lighttpd on Ubuntu 9.10

    - by hap497
    Hi, I am trying to run lighttpd on Ubuntu 9.10. I get the conf file from the doc directory of lighttpd source. $ sudo ./lighttpd -f lighttpd.conf $ ps -ef | grep lighttpd root 2094 1 0 19:40 ? 00:00:00 ./lighttpd -f lighttpd.conf This is my lighttpd.conf: $ more lighttpd.conf # lighttpd configuration file # # use it as a base for lighttpd 1.0.0 and above # # $Id: lighttpd.conf,v 1.7 2004/11/03 22:26:05 weigon Exp $ ############ Options you really have to take care of #################### ## modules to load # at least mod_access and mod_accesslog should be loaded # all other module should only be loaded if really neccesary # - saves some time # - saves memory server.modules = ( # "mod_rewrite", # "mod_redirect", # "mod_alias", "mod_access", # "mod_trigger_b4_dl", # "mod_auth", # "mod_status", # "mod_setenv", # "mod_fastcgi", # "mod_proxy", # "mod_simple_vhost", # "mod_evhost", # "mod_userdir", # "mod_cgi", # "mod_compress", # "mod_ssi", # "mod_usertrack", # "mod_expire", # "mod_secdownload", # "mod_rrdtool", "mod_accesslog" ) ## A static document-root. For virtual hosting take a look at the ## mod_simple_vhost module. server.document-root = "/srv/www/htdocs/" ## where to send error-messages to server.errorlog = "/var/log/lighttpd/error.log" # files to check for if .../ is requested index-file.names = ( "index.php", "index.html", "index.htm", "default.htm" ) ## set the event-handler (read the performance section in the manual) # server.event-handler = "freebsd-kqueue" # needed on OS X # mimetype mapping mimetype.assign = ( ".pdf" => "application/pdf", ".sig" => "application/pgp-signature", ".spl" => "application/futuresplash", ".class" => "application/octet-stream", ".ps" => "application/postscript", ".torrent" => "application/x-bittorrent", ".dvi" => "application/x-dvi", ".gz" => "application/x-gzip", ".pac" => "application/x-ns-proxy-autoconfig", ".swf" => "application/x-shockwave-flash", ".tar.gz" => "application/x-tgz", ".tgz" => "application/x-tgz", ".tar" => "application/x-tar", ".zip" => "application/zip", ".mp3" => "audio/mpeg", ".m3u" => "audio/x-mpegurl", ".wma" => "audio/x-ms-wma", ".wax" => "audio/x-ms-wax", ".ogg" => "application/ogg", ".wav" => "audio/x-wav", ".gif" => "image/gif", ".jar" => "application/x-java-archive", ".jpg" => "image/jpeg", ".jpeg" => "image/jpeg", ".png" => "image/png", ".xbm" => "image/x-xbitmap", ".xpm" => "image/x-xpixmap", ".xwd" => "image/x-xwindowdump", ".css" => "text/css", ".html" => "text/html", ".htm" => "text/html", ".js" => "text/javascript", ".asc" => "text/plain", ".c" => "text/plain", ".cpp" => "text/plain", ".log" => "text/plain", ".conf" => "text/plain", ".text" => "text/plain", ".txt" => "text/plain", ".dtd" => "text/xml", ".xml" => "text/xml", ".mpeg" => "video/mpeg", ".mpg" => "video/mpeg", ".mov" => "video/quicktime", ".qt" => "video/quicktime", ".avi" => "video/x-msvideo", ".asf" => "video/x-ms-asf", ".asx" => "video/x-ms-asf", ".wmv" => "video/x-ms-wmv", ".bz2" => "application/x-bzip", ".tbz" => "application/x-bzip-compressed-tar", ".tar.bz2" => "application/x-bzip-compressed-tar", # default mime type "" => "application/octet-stream", ) # Use the "Content-Type" extended attribute to obtain mime type if possible #mimetype.use-xattr = "enable" ## send a different Server: header ## be nice and keep it at lighttpd # server.tag = "lighttpd" #### accesslog module accesslog.filename = "/var/log/lighttpd/access.log" ## deny access the file-extensions # # ~ is for backupfiles from vi, emacs, joe, ... # .inc is often used for code includes which should in general not be part # of the document-root url.access-deny = ( "~", ".inc" ) $HTTP["url"] =~ "\.pdf$" { server.range-requests = "disable" } ## # which extensions should not be handle via static-file transfer # # .php, .pl, .fcgi are most often handled by mod_fastcgi or mod_cgi static-file.exclude-extensions = ( ".php", ".pl", ".fcgi" ) ######### Options that are good to be but not neccesary to be changed ####### ## bind to port (default: 80) #server.port = 81 ## bind to localhost (default: all interfaces) #server.bind = "127.0.0.1" ## error-handler for status 404 #server.error-handler-404 = "/error-handler.html" #server.error-handler-404 = "/error-handler.php" ## to help the rc.scripts #server.pid-file = "/var/run/lighttpd.pid" ###### virtual hosts ## ## If you want name-based virtual hosting add the next three settings and load ## mod_simple_vhost ## ## document-root = ## virtual-server-root + virtual-server-default-host + virtual-server-docroot ## or ## virtual-server-root + http-host + virtual-server-docroot ## #simple-vhost.server-root = "/srv/www/vhosts/" #simple-vhost.default-host = "www.example.org" #simple-vhost.document-root = "/htdocs/" ## ## Format: <errorfile-prefix><status-code>.html ## -> ..../status-404.html for 'File not found' #server.errorfile-prefix = "/usr/share/lighttpd/errors/status-" #server.errorfile-prefix = "/srv/www/errors/status-" ## virtual directory listings #dir-listing.activate = "enable" ## select encoding for directory listings #dir-listing.encoding = "utf-8" ## enable debugging #debug.log-request-header = "enable" #debug.log-response-header = "enable" #debug.log-request-handling = "enable" #debug.log-file-not-found = "enable" ### only root can use these options # # chroot() to directory (default: no chroot() ) #server.chroot = "/" ## change uid to <uid> (default: don't care) #server.username = "wwwrun" ## change uid to <uid> (default: don't care) #server.groupname = "wwwrun" #### compress module #compress.cache-dir = "/var/cache/lighttpd/compress/" #compress.filetype = ("text/plain", "text/html") #### proxy module ## read proxy.txt for more info #proxy.server = ( ".php" => # ( "localhost" => # ( # "host" => "192.168.0.101", # "port" => 80 # ) # ) # ) #### fastcgi module ## read fastcgi.txt for more info ## for PHP don't forget to set cgi.fix_pathinfo = 1 in the php.ini #fastcgi.server = ( ".php" => # ( "localhost" => # ( # "socket" => "/var/run/lighttpd/php-fastcgi.s ocket", # "bin-path" => "/usr/local/bin/php-cgi" # ) # ) # ) #### CGI module #cgi.assign = ( ".pl" => "/usr/bin/perl", # ".cgi" => "/usr/bin/perl" ) # #### SSL engine #ssl.engine = "enable" #ssl.pemfile = "/etc/ssl/private/lighttpd.pem" #### status module #status.status-url = "/server-status" #status.config-url = "/server-config" #### auth module ## read authentication.txt for more info #auth.backend = "plain" #auth.backend.plain.userfile = "lighttpd.user" #auth.backend.plain.groupfile = "lighttpd.group" #auth.backend.ldap.hostname = "localhost" #auth.backend.ldap.base-dn = "dc=my-domain,dc=com" #auth.backend.ldap.filter = "(uid=$)" #auth.require = ( "/server-status" => # ( # "method" => "digest", # "realm" => "download archiv", # "require" => "user=jan" # ), # "/server-config" => # ( # "method" => "digest", # "realm" => "download archiv", # "require" => "valid-user" # ) # ) #### url handling modules (rewrite, redirect, access) #url.rewrite = ( "^/$" => "/server-status" ) #url.redirect = ( "^/wishlist/(.+)" => "http://www.123.org/$1" ) #### both rewrite/redirect support back reference to regex conditional using %n #$HTTP["host"] =~ "^www\.(.*)" { # url.redirect = ( "^/(.*)" => "http://%1/$1" ) #} # # define a pattern for the host url finding # %% => % sign # %0 => domain name + tld # %1 => tld # %2 => domain name without tld # %3 => subdomain 1 name # %4 => subdomain 2 name # #evhost.path-pattern = "/srv/www/vhosts/%3/htdocs/" #### expire module #expire.url = ( "/buggy/" => "access 2 hours", "/asdhas/" => "ac cess plus 1 seconds 2 minutes") #### ssi #ssi.extension = ( ".shtml" ) #### rrdtool #rrdtool.binary = "/usr/bin/rrdtool" #rrdtool.db-name = "/var/lib/lighttpd/lighttpd.rrd" #### setenv #setenv.add-request-header = ( "TRAV_ENV" => "mysql://user@host/db" ) #setenv.add-response-header = ( "X-Secret-Message" => "42" ) ## for mod_trigger_b4_dl # trigger-before-download.gdbm-filename = "/var/lib/lighttpd/trigger.db" # trigger-before-download.memcache-hosts = ( "127.0.0.1:11211" ) # trigger-before-download.trigger-url = "^/trigger/" # trigger-before-download.download-url = "^/download/" # trigger-before-download.deny-url = "http://127.0.0.1/index.html" # trigger-before-download.trigger-timeout = 10 #### variable usage: ## variable name without "." is auto prefixed by "var." and becomes "var.bar" #bar = 1 #var.mystring = "foo" ## integer add #bar += 1 ## string concat, with integer cast as string, result: "www.foo1.com" #server.name = "www." + mystring + var.bar + ".com" ## array merge #index-file.names = (foo + ".php") + index-file.names #index-file.names += (foo + ".php") #### include #include /etc/lighttpd/lighttpd-inc.conf ## same as above if you run: "lighttpd -f /etc/lighttpd/lighttpd.conf" #include "lighttpd-inc.conf" #### include_shell #include_shell "echo var.a=1" ## the above is same as: #var.a=1 When I go to browser and hit 'http://127.0.0.1', I get link not found. Any idea?

    Read the article

  • How can I get Thunderbird to automatically move messages?

    - by David Heffernan
    I have Thunderbird 15. I'd like to automatically move messages from one folder to another. My mail account is an IMAP account. My Blackberry is also connected to the account and when it sends mail, it places a copy on the IMAP server in a folder named Sent Items. I'd like those messages to be moved to my Inbox automatically. By default message filters are only applied automatically to the Inbox. There is an extension to do this, Filter Subfolders, but it's only for TB3. What I have tried so far is: Use the FiltaQuilla add-on to be able to filter messages for folder name. Set the string property mail.server.default.applyIncomingFilters to true. As recommended here: http://blog.mozilla.org/bcrowder/ But I can't get these filters to run automatically. I have a suspicion that filters only run automatically for incoming mail. And these are sent items. Perhaps that's it. I just don't know. On the other hand, if I run the filters manually on that folder, it does indeed move the mail. Or perhaps the issue is that these messages are saved into the Sent Items folder marked as read. Is it possible that filters are only automatically applied to unread items? If I could install an add-in that automatically ran the message filter on my folder, that would do it. Anyway, I'm at a loss now. Any suggestions are welcome. I'm not at all wedded to using filters. I just want to find a way to get these messages moved without human interaction!

    Read the article

  • Perl TDS character sets

    - by skiphoppy
    I'm using the FreeTDS driver with DBD::Sybase, connecting to an MS SQL Server. When I query certain values of certain records, I get this error: DBD::Sybase::st fetchrow_arrayref failed: OpenClient message: LAYER = (0) ORIGIN = (0) SEVERITY = (9) NUMBER = (99) Server , database Message String: WARNING! Some character(s) could not be converted into client's character set. Unconverted bytes were changed to question marks ('?'). This seems to happen for records that contain special Windows character-set characters, such as curly quotes, copied and pasted from people's Outlook and Word messages. Unfortunately, I do not have any control of this database; sanitizing the input on the way in is obviously the way to go, but is not available to me. What FreeTDS settings do I need to change to be able to successfully query these records? Additional information: The query works fine from tsql. I only get this error through Perl's DBD::Sybase interface. (Should I test through something else? I don't have the expertise yet to install PHP or Python. I've got jTDS and can use it, but I think that's a completely different implementation, not an interface to FreeTDS.) Adding client charset = UTF-8 to my freetds.conf file results in "Out of memory!" printed to STDERR.

    Read the article

  • SSH hangs without password prompt

    - by Wilco
    Just reinstalled OS X and for some reason I now cannot connect to a specific machine on my local network via SSH. I can SSH to other machines on the network without any problems, and other machines can SSH to the problematic one as well. I'm not sure where to start looking for problems - can anyone point me in the right direction? Here's a dump of a connection attempt: OpenSSH_5.1p1, OpenSSL 0.9.7l 28 Sep 2006 debug1: Reading configuration data /etc/ssh_config debug1: Connecting to 10.0.1.7 [10.0.1.7] port 22. debug1: Connection established. debug1: identity file /Users/nwilliams/.ssh/identity type -1 debug1: identity file /Users/nwilliams/.ssh/id_rsa type -1 debug1: identity file /Users/nwilliams/.ssh/id_dsa type -1 debug1: Remote protocol version 2.0, remote software version OpenSSH_4.5 debug1: match: OpenSSH_4.5 pat OpenSSH* debug1: Enabling compatibility mode for protocol 2.0 debug1: Local version string SSH-2.0-OpenSSH_5.1 debug1: SSH2_MSG_KEXINIT sent debug1: SSH2_MSG_KEXINIT received debug1: kex: server->client aes128-cbc hmac-md5 none debug1: kex: client->server aes128-cbc hmac-md5 none debug1: SSH2_MSG_KEX_DH_GEX_REQUEST(1024<1024<8192) sent debug1: expecting SSH2_MSG_KEX_DH_GEX_GROUP debug1: SSH2_MSG_KEX_DH_GEX_INIT sent debug1: expecting SSH2_MSG_KEX_DH_GEX_REPLY debug1: Host '10.0.1.7' is known and matches the RSA host key. debug1: Found key in /Users/nwilliams/.ssh/known_hosts:1 debug1: ssh_rsa_verify: signature correct debug1: SSH2_MSG_NEWKEYS sent debug1: expecting SSH2_MSG_NEWKEYS debug1: SSH2_MSG_NEWKEYS received debug1: SSH2_MSG_SERVICE_REQUEST sent debug1: SSH2_MSG_SERVICE_ACCEPT received debug1: Authentications that can continue: publickey,gssapi-keyex,gssapi-with-mic,password,keyboard-interactive debug1: Next authentication method: gssapi-keyex debug1: No valid Key exchange context debug1: Next authentication method: gssapi-with-mic ... at this point it hangs for quite a while, and then resumes ... debug1: Unspecified GSS failure. Minor code may provide more information Server not found in Kerberos database debug1: Unspecified GSS failure. Minor code may provide more information Server not found in Kerberos database debug1: Unspecified GSS failure. Minor code may provide more information debug1: Next authentication method: publickey debug1: Trying private key: /Users/nwilliams/.ssh/identity debug1: Trying private key: /Users/nwilliams/.ssh/id_rsa debug1: Trying private key: /Users/nwilliams/.ssh/id_dsa debug1: Next authentication method: keyboard-interactive

    Read the article

  • How do I decode this WordPress hack?

    - by Dennis Wurster
    I found an offending string in a client's WordPress-powered website, and I just want to know what it does. @preg_replace("\x40\50\x2e\53\x29\100\x69\145","\x65\166\x61\154\x28\142\x61\163\x65\66\x34\137\x64\145\x63\157\x64\145\x28\151\x6d\160\x6c\157\x64\145\x28\42\x5c\156\x22\54\x66\151\x6c\145\x28\142\x61\163\x65\66\x34\137\x64\145\x63\157\x64\145\x28\42\x5c\61\x22\51\x29\51\x29\51\x3b","\x4c\62\x68\166\x62\127\x55\166\x64\62\x56\151\x4c\63\x56\172\x5a\130\x4a\172\x4c\172\x49\167\x4d\152\x6b\165\x59\155\x6c\156\x4e\151\x39\172\x61\130\x52\154\x63\171\x39\151\x61\127\x63\62\x4c\63\x42\61\x59\155\x78\160\x59\61\x39\157\x64\107\x31\163\x4c\62\x5a\166\x63\156\x56\164\x4c\62\x4a\151\x4c\127\x6c\165\x59\62\x78\61\x5a\107\x56\172\x4c\62\x70\172\x4c\62\x70\170\x64\127\x56\171\x65\123\x38\165\x59\62\x46\152\x61\107\x55\166\x4c\151\x55\64\x4d\152\x68\106\x4a\124\x41\167\x4d\124\x4d\154\x51\152\x68\107\x4d\171\x56\103\x51\172\x46\103\x4a\125\x49\171\x4d\153\x49\154\x4e\105\x59\61\x4e\167\x3d\75"); Can someone outline the steps it takes to decode this? I know what preg_replace() is, but I don't know how to decode the arguments to the function, or how PHP processes it into something it can make use of.

    Read the article

  • Sshfs is not working..

    - by Devrim
    Hi, When I run sshpass -p 'mypass' sshfs 'root'@'68.19.40.16':/ '/dir' -o StrictHostKeyChecking=no,debug It successfully mounts but it runs on foreground. When I run without 'debug' parameter, it doesn't mount at all. Server is ubuntu 8.04 Any ideas why? UPDATE: When I run the command as ROOT it does mount. It doesn't work with other users. here is the output of an unsuccessful mount $ sshpass -p 'pass' sshfs 'root'@'68.1.1.1':/ '/s6' -o StrictHostKeyChecking=no,sshfs_debug,loglevel=debug debug1: Reading configuration data /etc/ssh/ssh_config debug1: Applying options for * debug1: Connecting to 68.1.1.1 [68.1.1.1] port 22. debug1: Connection established. debug1: identity file /var/www/vhosts/devrim.kodingen.com/.ssh/id_rsa type -1 debug1: identity file /var/www/vhosts/devrim.kodingen.com/.ssh/id_dsa type -1 debug1: Remote protocol version 2.0, remote software version OpenSSH_5.1p1 Debian-5 debug1: match: OpenSSH_5.1p1 Debian-5 pat OpenSSH* debug1: Enabling compatibility mode for protocol 2.0 debug1: Local version string SSH-2.0-OpenSSH_4.7p1 Debian-8ubuntu1.2 debug1: SSH2_MSG_KEXINIT sent debug1: SSH2_MSG_KEXINIT received debug1: kex: server->client aes128-cbc hmac-md5 none debug1: kex: client->server aes128-cbc hmac-md5 none debug1: SSH2_MSG_KEX_DH_GEX_REQUEST(1024<1024<8192) sent debug1: expecting SSH2_MSG_KEX_DH_GEX_GROUP debug1: SSH2_MSG_KEX_DH_GEX_INIT sent debug1: expecting SSH2_MSG_KEX_DH_GEX_REPLY Warning: Permanently added '68.1.1.1' (RSA) to the list of known hosts. debug1: ssh_rsa_verify: signature correct debug1: SSH2_MSG_NEWKEYS sent debug1: expecting SSH2_MSG_NEWKEYS debug1: SSH2_MSG_NEWKEYS received debug1: SSH2_MSG_SERVICE_REQUEST sent debug1: SSH2_MSG_SERVICE_ACCEPT received debug1: Authentications that can continue: publickey,password debug1: Next authentication method: publickey debug1: Trying private key: /var/www/vhosts/devrim.kodingen.com/.ssh/id_rsa debug1: Trying private key: /var/www/vhosts/devrim.kodingen.com/.ssh/id_dsa debug1: Next authentication method: password debug1: Authentication succeeded (password). debug1: channel 0: new [client-session] debug1: Entering interactive session. debug1: Sending environment. debug1: Sending env LANG = en_GB.UTF-8 debug1: Sending subsystem: sftp Server version: 3 debug1: channel 0: free: client-session, nchannels 1 debug1: fd 0 clearing O_NONBLOCK debug1: Killed by signal 1.

    Read the article

  • Error while detecting start profile for instance with ID _u

    - by Techboy
    I am upgrading a SAP Java instance and am getting the error shown in the log below. There are not backup profile files in the profiles directory. The string _u does not exist in the default, start or instance profile for instance SCS01. Please can you suggest what the issue might be? Mar 13, 2010 12:09:01 PM [Info]: com.sap.sdt.ucp.phases.AbstractPhaseType.initializexAbstractPhaseType.javax758x [Thread[main,5,main]]: Phase PREPARE/INIT/DETERMINE_PROFILES has been started. Mar 13, 2010 12:09:01 PM [Info]: com.sap.sdt.ucp.phases.AbstractPhaseType.initializexAbstractPhaseType.javax759x [Thread[main,5,main]]: Phase type is com.sap.sdt.j2ee.phases.PhaseTypeDetermineProfiles. Mar 13, 2010 12:09:01 PM [Info]: ...ap.sdt.j2ee.phases.PhaseTypeDetermineProfiles.checkVariablesxPhaseTypeDetermineProfiles.javax284x [Thread[main,5,main]]: All 4 required variables exist in variable handler. Mar 13, 2010 12:09:01 PM [Info]: ....j2ee.tools.sysinfo.AbstractInfoController.updateProfileVariablexAbstractInfoController.javax302x [Thread[main,5,main]]: Parameter /J2EE/StandardSystem/DefaultProfilePath has been detected. Parameter value is \server1\SAPMNT\PI7\SYS\profile\DEFAULT.PFL. Mar 13, 2010 12:09:01 PM [Info]: com.sap.sdt.j2ee.tools.sysinfo.ProfileDetector.detectInstancexProfileDetector.javax340x [Thread[main,5,main]]: Instance SCS01 with profile \server1\SAPMNT\PI7\SYS\profile\PI7_SCS01_server1, start profile \server1\SAPMNT\PI7\SYS\profile\START_SCS01_server1, and host server1 has been detected. Mar 13, 2010 12:09:01 PM [Error]: com.sap.sdt.ucp.phases.AbstractPhaseType.doExecutexAbstractPhaseType.javax862x [Thread[main,5,main]]: Exception has occurred during the execution of the phase. Mar 13, 2010 12:09:01 PM [Error]: com.sap.sdt.j2ee.tools.sysinfo.ProfileDetector.detectInstancexProfileDetector.javax297x [Thread[main,5,main]]: Error while detecting start profile for instance with ID _u. Mar 13, 2010 12:09:01 PM [Info]: com.sap.sdt.ucp.phases.AbstractPhaseType.cleanupxAbstractPhaseType.javax905x [Thread[main,5,main]]: Phase PREPARE/INIT/DETERMINE_PROFILES has been completed. Mar 13, 2010 12:09:01 PM [Info]: com.sap.sdt.ucp.phases.AbstractPhaseType.cleanupxAbstractPhaseType.javax906x [Thread[main,5,main]]: Start time: 2010/03/13 12:09:01. Mar 13, 2010 12:09:01 PM [Info]: com.sap.sdt.ucp.phases.AbstractPhaseType.cleanupxAbstractPhaseType.javax908x [Thread[main,5,main]]: End time: 2010/03/13 12:09:01. Mar 13, 2010 12:09:01 PM [Info]: com.sap.sdt.ucp.phases.AbstractPhaseType.cleanupxAbstractPhaseType.javax909x [Thread[main,5,main]]: Duration: 0:00:00.078. Mar 13, 2010 12:09:01 PM [Info]: com.sap.sdt.ucp.phases.AbstractPhaseType.cleanupxAbstractPhaseType.javax910x [Thread[main,5,main]]: Phase status is error.

    Read the article

  • Remote Sending of Emails via SMTP/EXIM Issue

    - by Christian Noel
    I have been encountering a problem when sending messages via EXIM. Here is the scenario: I have 2 servers lets just say host1.com = where all my apps and programs are hosted. host2.com = is another server which handles some apps but is also my smtp mail server. whm and cpanel are installed in both hosts as well as exim. right now, messages are being sent out as [email protected] to clients. host1.com uses the [email protected] so that it can send messages outbound as well. here's the problem, after a few hours from a fresh reboot of host1.com, sending messages from host1.com is no longer possible because i encounter an error that states: system/vendor/swift/Swift/Connection/SMTP.php [309]: The SMTP connection failed to start [tls://mail.host2.com]: fsockopen returned Error Number 110 and Error String 'Connection timed out'` also note that this was working fine earlier (like 10 hours ago) but then it suddenly fails. everytime i restart the host1.com then sending messages will work again. i have checked logs and traces but to no avail the only means of fixing this problem is restarting host1.com.

    Read the article

  • Windows Server 2008 R2 SP1 Drivers Missing Would Not Install?

    - by bleepzter
    I am building my dev machine with WS2008R2SP1. I consider Windows Server as the best development environment for C# since I tend to focus on server-centric (integration) applications. The desktop flavor of Windows (7) doesn't play nicely with things like Commerce Server or BizTalk... so I to like stick to the environment I develop for. Previously I used to develop inside of VM's but I've found that it is super inefficient and tends to take a toll on the laptops. (I've gone through two of them in 6 months). Problem is that I multiple devices that do not want to be recognized by Windows: My machine is Dell Precision M4500: Intel Core i7-Q740, 1TB HDD, 8GB RAM, Dell re-branded Broadcom DW1501 802x11n Half-Mini Card, Dell re-branded Broadcom DW375 Bluetooh Module, Intel 82577LM Gigabit Network connection NVidia Quadro FX1800 Graphics The devices in question are the Dell rebranded broadcom network and bluetooth adapters: Broadcom USH: USB\VID_0A5C&PID_5800&REV_0101&MI_00 USB\VID_0A5C&PID_5800&MI_00 DW375 Bluetooth Module USB\VID_413C&PID_8187&REV_0517 USB\VID_413C&PID_8187 When I ran the broadcom installers I get "Operating System not supported" which I think is a big oversight on Broadcom's part. Why check for system version string? UGHGHGH Moreover if I try to manually force the driver in windows... I get an error: Driver Management concluded the process to install driver FileRepository\btwampsecfl.inf_amd64_neutral_d8fc2b85d035ed47\btwampsecfl.inf for Device Instance ID USB\VID_0A5C&PID_5800&MI_00\7&66DE6C9&0&0000 with the following status: 0xe0000217. '- or - Driver Management concluded the process to install driver FileRepository\btwampfl.inf_amd64_neutral_d4c4acf036c61299\btwampfl.inf for Device Instance ID USB\VID_413C&PID_8187\90004EEEF5A6 with the following status: 0xe0000217. I googled the 0xe0000217 error code and it says Bad service install section in the driver inf file... Any ideas on how to fix this? I also tried the post by BetaIQ on MSDN Forum, unfortunately the links to the driver package included in the post were dead :( PS. On a side note I also do mobile development for Android, iOS, and Windows Phone, and BB. Having the bluetooth is quite useful with mobile devices.

    Read the article

  • Cannot push to GitHub from Amazon EC2 Linux instance

    - by Eli
    Having the worst luck push files to a repo from EC2 to GitHub. I have my ssh key setup and added to Github. Here are the results of ssh -v [email protected] OpenSSH_5.3p1, OpenSSL 1.0.0g-fips 18 Jan 2012 debug1: Reading configuration data /etc/ssh/ssh_config debug1: Applying options for * debug1: Connecting to github.com [207.97.227.239] port 22. debug1: Connection established. debug1: permanently_set_uid: 0/0 debug1: identity file /root/.ssh/identity type -1 debug1: identity file /root/.ssh/id_rsa type 1 debug1: identity file /root/.ssh/id_dsa type -1 debug1: Remote protocol version 2.0, remote software version OpenSSH_5.1p1 Debian-5github2 debug1: match: OpenSSH_5.1p1 Debian-5github2 pat OpenSSH* debug1: Enabling compatibility mode for protocol 2.0 debug1: Local version string SSH-2.0-OpenSSH_5.3 debug1: SSH2_MSG_KEXINIT sent debug1: SSH2_MSG_KEXINIT received debug1: kex: server->client aes128-ctr hmac-md5 none debug1: kex: client->server aes128-ctr hmac-md5 none debug1: SSH2_MSG_KEX_DH_GEX_REQUEST(1024<1024<8192) sent debug1: expecting SSH2_MSG_KEX_DH_GEX_GROUP debug1: SSH2_MSG_KEX_DH_GEX_INIT sent debug1: expecting SSH2_MSG_KEX_DH_GEX_REPLY debug1: Host 'github.com' is known and matches the RSA host key. debug1: Found key in /root/.ssh/known_hosts:1 debug1: ssh_rsa_verify: signature correct debug1: SSH2_MSG_NEWKEYS sent debug1: expecting SSH2_MSG_NEWKEYS debug1: SSH2_MSG_NEWKEYS received debug1: SSH2_MSG_SERVICE_REQUEST sent debug1: SSH2_MSG_SERVICE_ACCEPT received debug1: Authentications that can continue: publickey debug1: Next authentication method: publickey debug1: Trying private key: /root/.ssh/identity debug1: Offering public key: /root/.ssh/id_rsa debug1: Remote: Forced command: gerve eliperelman 81:5f:8a:b2:42:6d:4e:8c:2d:ba:9a:8a:2b:9e:1a:90 debug1: Remote: Port forwarding disabled. debug1: Remote: X11 forwarding disabled. debug1: Remote: Agent forwarding disabled. debug1: Remote: Pty allocation disabled. debug1: Server accepts key: pkalg ssh-rsa blen 277 debug1: Trying private key: /root/.ssh/id_dsa debug1: No more authentication methods to try. Permission denied (publickey).

    Read the article

  • Executing Oracle SQLPlus in a Powershell Invoke-Command statement against a remote machine

    - by Scott Muc
    We have a basic powershell script that attempts to execute SQLPlus.exe on a remote machine. The remote does not have Oracle Instant client installed, but we have bundled all the necesary dlls in a remote folder. For example we have sqlplus.exe and dependencies in the directory C:\temp\oracle. If I navigate to that path on the remote server and execute sqlplus.exe it runs just fine. I get the prompt for username. If I go: Invoke-Command -comp remote.machine.host -ScriptBlock { C:\temp\oracle\sqplus.exe } I get the following: Error 57 initializing SQL*Plus + CategoryInfo : NotSpecified: (Error 57 initializing SQL*Plus:String) [], RemoteException + FullyQualifiedErrorId : NativeCommandError Error loading message shared library Thinking that it's potentially a PATH issue I tried the following: Invoke-Command -comp remote.machine.host -ScriptBlock { $env:ORACLE_HOME= "C:\temp\oracle"; $env:PATH = "$env:ORACLE_HOME; C:\temp\oracle\sqlplus.exe } This had the same result. The error code is not very helpful and is extremely frustrating since it does work when I log on to the machine. What is powershell remoting doing that's making this not work?

    Read the article

  • How to remove that extra text from URL titles in Firefox browser?

    - by amar
    I am using Firefox with Vimperator. On Mac I use Shiori to bookmark. I also use Pinboard's default add-on (on both Mac and Windows, but mainly on Windows as there's no Shiori). When I used to bookmark, I had this behaviour[A] (before changing Vimperator options): Example: URL: xyz.com TITLE: xyz website Pinboard add-on would fetch the title as xyz website which was fine (I reckon it directly fetches TITLE form the URL). But after installing and starting to use Shiori the title I was getting in its "title" field was xyz website - Vimperator exactly the same what I could see in tabs (seems it's getting what the browser is feeding it). So, I :set titlestring= in Vimperator to remove that extra Vimperator from title. Now, this is what I am getting [B]: When I try to bookmark using Pinboard add-on the title is undefined Using Shiori it results in xyz website - undefined. I tried to change it back to original[C] :set titlestring=Mozilla Firefox (assuming this was the original, before Vimperator) but the results are still the same as [B]. How to get read of that extra - undefined or that extra - Vimperator or - Mozilla Firefox for that matter, while bookmarking pages either with Pinboard add-on or Shiori? One workaround is, instead of no string just add a white-space while setting title in Firefox via Vimperator there but that results in - appended to titles.

    Read the article

  • Squid, authentication, Outlook Anywhere, Windows 7 and HTTP 1.1 = NIGHTMARE

    - by Massimo
    I'm running a Squid proxy (latest version, 3.1.4) on Linux CentOS 5.4 with Samba 3.5.4, in order to allow authenticated web access for domain users; everything works fine, and even Windows 7 clients are fully supported. Authentication is transparent for domain users, while it is explicitly requested for non-domain ones, and it works if the user can provide valid domain credentials. All nice and good. Then, Outlook Anywhere kicks in and pain and suffering ensue. When Outlook (be it 2007 or 2010, it doesn't matter) runs on Windows XP clients, it connects gracefully through the Squid proxy to its remote Exchange server. When it runs on Windows 7, it doesn't. If the authentication requirement is lifted from the proxy, everything works on Windows 7 too, so the problem is obviously related to NTLM authentication with Squid. Digging more deeply (WireShark), I discovered Outlook Anywhere uses HTTP 1.1 when it runs on Windows 7, while it uses HTTP 1.0 when on Windows XP. And it looks like Squid, even in its latest incarnation, still has some serious troubles handling HTTP 1.1 properly, particularly when SSL and proxy authentication are thrown in the mix. While waiting for Squid to fully and officially support HTTP 1.1 (and it looks like this could take quite a long time), I'm looking for one of the following solutions: Make Squid handle this correctly, if it is at all possible. Identify Outlook Anywhere connections and have Squid not require authentication for them. But it isn't easy: again, the behaviour of Outlook differs when running on Windows XP and Windows 7, and while on Windows XP Outlook sends a really nice user-agent string of "MSRPC", on Windows 7 it doesn't send any (why? WHY?!?). Force Outlook Anywhere to use HTTP 1.0 even when running on Windows 7. And no, this is not as simple as deselecting "use HTTP 1.1" in Internet Explorer, looks like Outlook ignores that setting and chooses on its own which protocol to use. Any other feasible solution which doesn't involve whitelisting specific destination Exchange servers, which is the last-resort solution I'm trying to avoid.

    Read the article

  • Samba 3.5 Shadow Copy for Windows 7

    - by Prashanth Sundaram
    Over the past several days I have been trying to get the shadow to work with samba but haven’t been successful. Can someone check below config and let me know if I am missing something? We are using Equallogic SAN and iSCSI LUNS to mount volumes. I can cleanly access samba shares on Windows 7 clients but just not shadow copy. I have referred the official how-to but couldn’t get it to work. I see these messages in the logs. Any help is deeply appreciated. [2012/10/31 12:20:53.549863, 0] smbd/nttrans.c:2170(call_nt_transact_ioctl) FSCTL_GET_SHADOW_COPY_DATA: connectpath /fs/test-01, failed. [2012/10/31 12:21:13.887198, 0] modules/vfs_shadow_copy2.c:734(shadow_copy2_get_shadow_copy2_data) shadow:snapdir not found for /fs/test-01 in get_shadow_copy_data [2012/10/31 12:21:13.887265, 0] smbd/nttrans.c:2170(call_nt_transact_ioctl) FSCTL_GET_SHADOW_COPY_DATA: connectpath /fs/test-01, failed. == Samba pkgs == samba-3.5.10-116.el6_2.x86_64 samba-common-3.5.10-116.el6_2.x86_64 samba-winbind-clients-3.5.10-116.el6_2.x86_64 samba-client-3.5.10-116.el6_2.x86_64 === df –h == First is the iSCSI LUN and 2 others are snapshots. /dev/mapper/eql-0-fs-test01 5.0G 2.3G 2.5G 48% /fs/test-01 /dev/mapper/eql-2-0+fs-test01 5.0G 2.3G 2.5G 48% /fs/test-01/@GMT-2012.10.26-17.32.42/fs/test-01 (SNAPSHOT-1) /dev/mapper/eql-d-0+fs-test01 5.0G 2.3G 2.5G 48% /fs/test-01/@GMT-2012.10.31-11.52.42/fs/test-01 (SNAPSHOT- 2) ===/etc/samba/smb.conf === [global] workgroup = DOMAIN server string = Samba Server Version %v security = ads realm = DOMAIN.CORP encrypt passwords = yes guest account = nobody map to guest = bad uid log file = /var/log/samba/%m.log domain master = no local master = no preferred master = no os level = 0 load printers = no show add printer wizard = no printable = no printcap name = /dev/null disable spoolss = yes follow symlinks = yes wide links = yes unix extensions = no [test] comment = Test Directories path = /fs/test-01 vfs objects = shadow_copy2 #shadow_copy2: sort = desc #shadow: localtime = yes #shadow: snapdir = /fs/test-01/test #shadow: basedir = /fs/test-01 guest ok = yes writeable = yes map archive = no force create mode = 0660 force directory mode = 2770 inherit owner = yes inherit permissions = yes All feedback is welcome. Thanks!

    Read the article

  • Find Search Replace from landmark to landmark - including everything in between

    - by Erick Tronboll
    Appreciate some Jedi help... I have the following string: gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR repeating sporadically throughout my document and want to remove everything from: gi|37463 to the AAMGR sequence but, I want to keep the blocks where JQ250 appears: gi|374638936|gb|*JQ250*332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC and remove only the lines that have AEZ554 gi|374638939|gb|*AEZ554*52.1| myosin light chain 2, partial [Batrachoseps major] AAMGR ..................................... So, ideally the following block: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638935|gb|AEZ55450.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638937|gb|AEZ55451.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR Would be left as just: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC ................................many thanks as I help a struggling Grad Student

    Read the article

  • Unable to login to Amazon EC2 compute server

    - by MasterGaurav
    I am unable to login to the EC2 server. Here's the log of the connection-attempt: $ ssh -v -i ec2-key-incoleg-x002.pem [email protected] OpenSSH_5.6p1, OpenSSL 0.9.8p 16 Nov 2010 debug1: Reading configuration data /home/gvaish/.ssh/config debug1: Applying options for * debug1: Connecting to ec2-50-16-0-207.compute-1.amazonaws.com [50.16.0.207] port 22. debug1: Connection established. debug1: identity file ec2-key-incoleg-x002.pem type -1 debug1: identity file ec2-key-incoleg-x002.pem-cert type -1 debug1: identity file /home/gvaish/.ssh/id_rsa type -1 debug1: identity file /home/gvaish/.ssh/id_rsa-cert type -1 debug1: Remote protocol version 2.0, remote software version OpenSSH_5.3 debug1: match: OpenSSH_5.3 pat OpenSSH* debug1: Enabling compatibility mode for protocol 2.0 debug1: Local version string SSH-2.0-OpenSSH_5.6 debug1: SSH2_MSG_KEXINIT sent debug1: SSH2_MSG_KEXINIT received debug1: kex: server->client aes128-ctr hmac-md5 none debug1: kex: client->server aes128-ctr hmac-md5 none debug1: SSH2_MSG_KEX_DH_GEX_REQUEST(1024<1024<8192) sent debug1: expecting SSH2_MSG_KEX_DH_GEX_GROUP debug1: SSH2_MSG_KEX_DH_GEX_INIT sent debug1: expecting SSH2_MSG_KEX_DH_GEX_REPLY debug1: Host 'ec2-50-16-0-207.compute-1.amazonaws.com' is known and matches the RSA host key. debug1: Found key in /home/gvaish/.ssh/known_hosts:8 debug1: ssh_rsa_verify: signature correct debug1: SSH2_MSG_NEWKEYS sent debug1: expecting SSH2_MSG_NEWKEYS debug1: SSH2_MSG_NEWKEYS received debug1: Roaming not allowed by server debug1: SSH2_MSG_SERVICE_REQUEST sent debug1: SSH2_MSG_SERVICE_ACCEPT received debug1: Authentications that can continue: publickey debug1: Next authentication method: publickey debug1: Trying private key: ec2-key-incoleg-x002.pem debug1: read PEM private key done: type RSA debug1: Authentications that can continue: publickey debug1: Trying private key: /home/gvaish/.ssh/id_rsa debug1: No more authentication methods to try. Permission denied (publickey). What can be the possible reason? How do I fix the issue?

    Read the article

  • Kunagi LDAP configuration problems

    - by Willem de Vries
    We recently started with Scrum at our company and we wanted to start using Kunagi to test and see how it works. So I installed the kunagi_0.23.2.deb packet that I downloaded from their website, on my Ubuntu 11.04 running in tomcat6 using openjdk-6-jre. everything works fine except I can't get the LDAP to work. I have one AD server and one LDAP at my disposal for testing. For the LDAP I use the following info: -uri: ldap://192.168.1.11:389 -user: some_tested_user -passwd: the_pass -DN: dc=colosa,dc=net -LDAP Filter: (&(objectClass=user)) I tested various LDAP Filters, I don't know if I have the right one. However I get an erro when clicking "test LDAP". The error refers to the DN: Server service call error Calling service TestLdap failed. java.lang.RuntimeException: InvalidNameException: [LDAP: error code 34 - invalid DN] With the AD server I get no error while testing, yet I am not able to login I get: "Login faild" every time. I don't know if this is because of the LDAP Filter I entered, yet I can't get it to work. I have read this http://kunagi.org/iss652.html stating that I need to create my accounts inside Kunagi before I can login. So I did this with no effect. So basically my question is, what causes this DN string error (I am sure mine is right), and what LDAP Filter should i use? Any help would be highly appreciated.

    Read the article

  • How to configure fastcgi to work with ligttpd in ubuntu

    - by michael
    I am able to run lighttpd on ubuntu 9.10. But when i tried to setup fastcgi with lighttpd by putting this in the ligttpd.conf file: #### fastcgi module fastcgi.server = ( "/fastcgi_scripts/" => (( "host" => "127.0.0.1", "port" => "9098", "check-local" => "disable", "bin-path" => "/usr/local/bin/cgi-fcgi", "docroot" => "/" # remote server may use # it's own docroot )) ) This is what I get in the error.log in ligttpd: 2010-03-07 21:00:11: (log.c.166) server started 2010-03-07 21:00:11: (mod_fastcgi.c.1104) the fastcgi-backend /usr/local/bin/cgi-fcgi failed to start: 2010-03-07 21:00:11: (mod_fastcgi.c.1108) child exited with status 1 /usr/local/bin/cgi-fcgi 2010-03-07 21:00:11: (mod_fastcgi.c.1111) If you're trying to run your app as a FastCGI backend, make sure you're using the FastCGI-enabled version. If this is PHP on Gentoo, add 'fastcgi' to the USE flags. 2010-03-07 21:00:11: (mod_fastcgi.c.1399) [ERROR]: spawning fcgi failed. 2010-03-07 21:00:11: (server.c.931) Configuration of plugins failed. Going down. I do have cgi-fcgi in /usr/local/bin: $ which cgi-fcgi /usr/local/bin/cgi-fcgi '/usr/local/bin/cgi-fcgi' is the executable after I download and compile fast-cgi. Here is my lighttpd conf file: $ more lighttpd.conf # lighttpd configuration file # # use it as a base for lighttpd 1.0.0 and above # # $Id: lighttpd.conf,v 1.7 2004/11/03 22:26:05 weigon Exp $ ############ Options you really have to take care of #################### ## modules to load # at least mod_access and mod_accesslog should be loaded # all other module should only be loaded if really neccesary # - saves some time # - saves memory server.modules = ( # "mod_rewrite", # "mod_redirect", # "mod_alias", "mod_access", # "mod_trigger_b4_dl", # "mod_auth", # "mod_status", # "mod_setenv", "mod_fastcgi", # "mod_proxy", # "mod_simple_vhost", # "mod_evhost", # "mod_userdir", # "mod_cgi", # "mod_compress", # "mod_ssi", # "mod_usertrack", # "mod_expire", # "mod_secdownload", # "mod_rrdtool", "mod_accesslog" ) ## A static document-root. For virtual hosting take a look at the ## mod_simple_vhost module. server.document-root = "/srv/www/htdocs/" ## where to send error-messages to server.errorlog = "/var/log/lighttpd/error.log" # files to check for if .../ is requested index-file.names = ( "index.php", "index.html", "index.htm", "default.htm" ) ## set the event-handler (read the performance section in the manual) # server.event-handler = "freebsd-kqueue" # needed on OS X # mimetype mapping mimetype.assign = ( ".pdf" => "application/pdf", ".sig" => "application/pgp-signature", ".spl" => "application/futuresplash", ".class" => "application/octet-stream", ".ps" => "application/postscript", ".torrent" => "application/x-bittorrent", ".dvi" => "application/x-dvi", ".gz" => "application/x-gzip", ".pac" => "application/x-ns-proxy-autoconfig", ".swf" => "application/x-shockwave-flash", ".tar.gz" => "application/x-tgz", ".tgz" => "application/x-tgz", ".tar" => "application/x-tar", ".zip" => "application/zip", ".mp3" => "audio/mpeg", ".m3u" => "audio/x-mpegurl", ".wma" => "audio/x-ms-wma", ".wax" => "audio/x-ms-wax", ".ogg" => "application/ogg", ".wav" => "audio/x-wav", ".gif" => "image/gif", ".jar" => "application/x-java-archive", ".jpg" => "image/jpeg", ".jpeg" => "image/jpeg", ".png" => "image/png", ".xbm" => "image/x-xbitmap", ".xpm" => "image/x-xpixmap", ".xwd" => "image/x-xwindowdump", ".css" => "text/css", ".html" => "text/html", ".htm" => "text/html", ".js" => "text/javascript", ".asc" => "text/plain", ".c" => "text/plain", ".cpp" => "text/plain", ".log" => "text/plain", ".conf" => "text/plain", ".text" => "text/plain", ".txt" => "text/plain", ".dtd" => "text/xml", ".xml" => "text/xml", ".mpeg" => "video/mpeg", ".mpg" => "video/mpeg", ".mov" => "video/quicktime", ".qt" => "video/quicktime", ".avi" => "video/x-msvideo", ".asf" => "video/x-ms-asf", ".asx" => "video/x-ms-asf", ".wmv" => "video/x-ms-wmv", ".bz2" => "application/x-bzip", ".tbz" => "application/x-bzip-compressed-tar", ".tar.bz2" => "application/x-bzip-compressed-tar", # default mime type "" => "application/octet-stream", ) # Use the "Content-Type" extended attribute to obtain mime type if possible #mimetype.use-xattr = "enable" ## send a different Server: header ## be nice and keep it at lighttpd # server.tag = "lighttpd" #### accesslog module accesslog.filename = "/var/log/lighttpd/access.log" ## deny access the file-extensions # # ~ is for backupfiles from vi, emacs, joe, ... # .inc is often used for code includes which should in general not be part # of the document-root url.access-deny = ( "~", ".inc" ) $HTTP["url"] =~ "\.pdf$" { server.range-requests = "disable" } ## # which extensions should not be handle via static-file transfer # # .php, .pl, .fcgi are most often handled by mod_fastcgi or mod_cgi static-file.exclude-extensions = ( ".php", ".pl", ".fcgi" ) ######### Options that are good to be but not neccesary to be changed ####### ## bind to port (default: 80) server.port = 9090 ## bind to localhost (default: all interfaces) server.bind = "127.0.0.1" ## error-handler for status 404 #server.error-handler-404 = "/error-handler.html" #server.error-handler-404 = "/error-handler.php" ## to help the rc.scripts #server.pid-file = "/var/run/lighttpd.pid" ###### virtual hosts ## ## If you want name-based virtual hosting add the next three settings and load ## mod_simple_vhost ## ## document-root = ## virtual-server-root + virtual-server-default-host + virtual-server-docroot ## or ## virtual-server-root + http-host + virtual-server-docroot ## #simple-vhost.server-root = "/srv/www/vhosts/" #simple-vhost.default-host = "www.example.org" #simple-vhost.document-root = "/htdocs/" ## ## Format: <errorfile-prefix><status-code>.html ## -> ..../status-404.html for 'File not found' #server.errorfile-prefix = "/usr/share/lighttpd/errors/status-" #server.errorfile-prefix = "/srv/www/errors/status-" ## virtual directory listings #dir-listing.activate = "enable" ## select encoding for directory listings #dir-listing.encoding = "utf-8" ## enable debugging #debug.log-request-header = "enable" #debug.log-response-header = "enable" #debug.log-request-handling = "enable" #debug.log-file-not-found = "enable" ### only root can use these options # # chroot() to directory (default: no chroot() ) #server.chroot = "/" ## change uid to <uid> (default: don't care) #server.username = "wwwrun" ## change uid to <uid> (default: don't care) #server.groupname = "wwwrun" #### compress module #compress.cache-dir = "/var/cache/lighttpd/compress/" #compress.filetype = ("text/plain", "text/html") #### proxy module ## read proxy.txt for more info #proxy.server = ( ".php" => # ( "localhost" => # ( # "host" => "192.168.0.101", # "port" => 80 # ) # ) # ) #### fastcgi module fastcgi.server = ( "/fastcgi_scripts/" => (( "host" => "127.0.0.1", "port" => 1026, "check-local" => "disable", "bin-path" => "/usr/local/bin/cgi-fcgi", #"docroot" => "/" # remote server may use # it's own docroot )) ) ## read fastcgi.txt for more info ## for PHP don't forget to set cgi.fix_pathinfo = 1 in the php.ini #fastcgi.server = ( ".php" => # ( "localhost" => # ( # "socket" => "/var/run/lighttpd/php-fastcgi.s ocket", # "bin-path" => "/usr/local/bin/php-cgi" # ) # ) # ) #### CGI module #cgi.assign = ( ".pl" => "/usr/bin/perl", # ".cgi" => "/usr/bin/perl" ) # #### SSL engine #ssl.engine = "enable" #ssl.pemfile = "/etc/ssl/private/lighttpd.pem" #### status module #status.status-url = "/server-status" #status.config-url = "/server-config" #### auth module ## read authentication.txt for more info #auth.backend = "plain" #auth.backend.plain.userfile = "lighttpd.user" #auth.backend.plain.groupfile = "lighttpd.group" #auth.backend.ldap.hostname = "localhost" #auth.backend.ldap.base-dn = "dc=my-domain,dc=com" #auth.backend.ldap.filter = "(uid=$)" #auth.require = ( "/server-status" => # ( # "method" => "digest", # "realm" => "download archiv", # "require" => "user=jan" # ), # "/server-config" => # ( # "method" => "digest", # "realm" => "download archiv", # "require" => "valid-user" # ) # ) #### url handling modules (rewrite, redirect, access) #url.rewrite = ( "^/$" => "/server-status" ) #url.redirect = ( "^/wishlist/(.+)" => "http://www.123.org/$1" ) #### both rewrite/redirect support back reference to regex conditional using %n #$HTTP["host"] =~ "^www\.(.*)" { # url.redirect = ( "^/(.*)" => "http://%1/$1" ) #} # # define a pattern for the host url finding # %% => % sign # %0 => domain name + tld # %1 => tld # %2 => domain name without tld # %3 => subdomain 1 name # %4 => subdomain 2 name # #evhost.path-pattern = "/srv/www/vhosts/%3/htdocs/" #### expire module #expire.url = ( "/buggy/" => "access 2 hours", "/asdhas/" => "ac cess plus 1 seconds 2 minutes") #### ssi #ssi.extension = ( ".shtml" ) #### rrdtool #rrdtool.binary = "/usr/bin/rrdtool" #rrdtool.db-name = "/var/lib/lighttpd/lighttpd.rrd" #### setenv #setenv.add-request-header = ( "TRAV_ENV" => "mysql://user@host/db" ) #setenv.add-response-header = ( "X-Secret-Message" => "42" ) ## for mod_trigger_b4_dl # trigger-before-download.gdbm-filename = "/var/lib/lighttpd/trigger.db" # trigger-before-download.memcache-hosts = ( "127.0.0.1:11211" ) # trigger-before-download.trigger-url = "^/trigger/" # trigger-before-download.download-url = "^/download/" # trigger-before-download.deny-url = "http://127.0.0.1/index.html" # trigger-before-download.trigger-timeout = 10 #### variable usage: ## variable name without "." is auto prefixed by "var." and becomes "var.bar" #bar = 1 #var.mystring = "foo" ## integer add #bar += 1 ## string concat, with integer cast as string, result: "www.foo1.com" #server.name = "www." + mystring + var.bar + ".com" ## array merge #index-file.names = (foo + ".php") + index-file.names #index-file.names += (foo + ".php") #### include #include /etc/lighttpd/lighttpd-inc.conf ## same as above if you run: "lighttpd -f /etc/lighttpd/lighttpd.conf" #include "lighttpd-inc.conf" #### include_shell #include_shell "echo var.a=1" ## the above is same as: #var.a=1 Thank you for your help.

    Read the article

  • Rename a Network Printer win Win 7

    - by Alex
    Seems this is a common question but the answers regularly miss the point. I have a server. Server has some printers connected. Server has all drivers for x32 & x64 OS PLUS ALL DEFAULTS set. Server also manages print queue. I have many workstations, all need to use the printers. All NEED to have drivers print queue and DEFAULTS propagated from server. Now.... When I add the printers on the workstations, I get: "ABC Printer on SERVER123" I need something less long - just "ABC Printer" So how? Tip: Please don't show me how to change the name of your locally installed printer. I know how to do this - I am particularly interested in shared printers that look like "ABC Printer on SERVER123" Tip: Installing the driver with a local port wont cut it because then I loose the server propagated defaults, the driver updates and I need to run around with driver disks/confuse trembling users with hard things like choosing drivers. I am happy for a hack if there is no official way to do this in the group policy.... I tried looking in HKEY_LOCAL_MACHINE\SYSTEM\CurrentControlSet\Control\Print\Printers on the workstation machines but those are only local printers :( I can see the network printer details on the workstations here: HKEY_USERS[Some GUID]\Printers\Connections But there is nothing obvious like a description string... Can anyone help with this?

    Read the article

  • Unable to read data from the transport connection: An existing connection was forcibly closed by the remote host

    - by Paul J. Warner
    I am having an issue with a program where after 6 mins +- 5 secs we get the above exception. Some more info about the exception stacktrace is below. This all happens pretty religiously, 6 mins goes by and bam the following 3 exeptions. We have the application installed in 2 other environments and it is working fine there. I am hoping to find some server settings either IIS 6 or Server 2003 settings that may be causing this issue to occur. I have reviewed some of the similar questions and don't see very many answers. I am hoping that maybe the information I have provided may help a little bit. 208741,Exception,,,,2011-06-21 00:30:14.193,SERVERNAME,2624,1,CLIENTNAME,The underlying connection was closed: An unexpected error occurred on a receive. , at System.Web.Services.Protocols.WebClientProtocol.GetWebResponse(WebRequest request) at System.Web.Services.Protocols.HttpWebClientProtocol.GetWebResponse(WebRequest request) at Microsoft.Web.Services3.WebServicesClientProtocol.GetResponse(WebRequest request, IAsyncResult result) at System.Web.Services.Protocols.SoapHttpClientProtocol.Invoke(String methodName, Object[] parameters) at System.Net.Sockets.NetworkStream.Read(Byte[] buffer, Int32 offset, Int32 size) at System.Net.FixedSizeReader.ReadPacket(Byte[] buffer, Int32 offset, Int32 count) at System.Net.Security._SslStream.StartFrameHeader(Byte[] buffer, Int32 offset, Int32 count, AsyncProtocolRequest asyncRequest) at System.Net.Security._SslStream.StartReading(Byte[] buffer, Int32 offset, Int32 count, AsyncProtocolRequest asyncRequest) at System.Net.Security._SslStream.ProcessRead(Byte[] buffer, Int32 offset, Int32 count, AsyncProtocolRequest asyncRequest) at System.Net.TlsStream.Read(Byte[] buffer, Int32 offset, Int32 size) at System.Net.PooledStream.Read(Byte[] buffer, Int32 offset, Int32 size) at System.Net.Connection.SyncRead(HttpWebRequest request, Boolean userRetrievedStream, Boolean probeRead),2004437127,114,1 208742,Exception,,,,2011-06-21 00:30:14.227,SERVERNAME,2624,1,CLIENTNAME,Unable to read data from the transport connection: An existing connection was forcibly closed by the remote host. , at System.Net.Sockets.NetworkStream.Read(Byte[] buffer, Int32 offset, Int32 size) at System.Net.FixedSizeReader.ReadPacket(Byte[] buffer, Int32 offset, Int32 count) at System.Net.Security._SslStream.StartFrameHeader(Byte[] buffer, Int32 offset, Int32 count, AsyncProtocolRequest asyncRequest) at System.Net.Security._SslStream.StartReading(Byte[] buffer, Int32 offset, Int32 count, AsyncProtocolRequest asyncRequest) at System.Net.Security._SslStream.ProcessRead(Byte[] buffer, Int32 offset, Int32 count, AsyncProtocolRequest asyncRequest) at System.Net.TlsStream.Read(Byte[] buffer, Int32 offset, Int32 size) at System.Net.PooledStream.Read(Byte[] buffer, Int32 offset, Int32 size) at System.Net.Connection.SyncRead(HttpWebRequest request, Boolean userRetrievedStream, Boolean probeRead),2004437127,114,1 208743,Exception,,,,2011-06-21 00:30:14.287,SERVERNAME,2624,1,CLIENTNAME,An existing connection was forcibly closed by the remote host , at System.Net.Sockets.NetworkStream.Read(Byte[] buffer, Int32 offset, Int32 size),-691097507,62,1

    Read the article

< Previous Page | 1177 1178 1179 1180 1181 1182 1183 1184 1185 1186 1187 1188  | Next Page >