Search Results

Search found 20336 results on 814 pages for 'connection strings'.

Page 120/814 | < Previous Page | 116 117 118 119 120 121 122 123 124 125 126 127  | Next Page >

  • How do i compare 2 strings in shell?

    - by Thomas
    I want the user to input something at the command line either -l or -e. so e.g. $./report.sh -e I want an if statement to split up whatever decision they make so i have tried... if [$1=="-e"]; echo "-e"; else; echo "-l"; fi obviously doesn't work though Thanks

    Read the article

  • Python Twisted Client Connection Lost

    - by MovieYoda
    I have this twisted client, which connects with a twisted server having an index. I ran this client from command-line. It worked fine. Now I modified it to run in loop (see main()) so that I can keep querying. But the client runs only once. Next time it simply says connection lost \n Connection lost - goodbye!. What am i doing wrong? In the loop I am reconnecting to the server, it that wrong? from twisted.internet import reactor from twisted.internet import protocol from settings import AS_SERVER_HOST, AS_SERVER_PORT # a client protocol class Spell_client(protocol.Protocol): """Once connected, send a message, then print the result.""" def connectionMade(self): self.transport.write(self.factory.query) def dataReceived(self, data): "As soon as any data is received, write it back." if data == '!': self.factory.results = '' else: self.factory.results = data self.transport.loseConnection() def connectionLost(self, reason): print "\tconnection lost" class Spell_Factory(protocol.ClientFactory): protocol = Spell_client def __init__(self, query): self.query = query self.results = '' def clientConnectionFailed(self, connector, reason): print "\tConnection failed - goodbye!" reactor.stop() def clientConnectionLost(self, connector, reason): print "\tConnection lost - goodbye!" reactor.stop() # this connects the protocol to a server runing on port 8090 def main(): print 'Connecting to %s:%d' % (AS_SERVER_HOST, AS_SERVER_PORT) while True: print query = raw_input("Query:") if query == '': return f = Spell_Factory(query) reactor.connectTCP(AS_SERVER_HOST, AS_SERVER_PORT, f) reactor.run() print f.results return if __name__ == '__main__': main()

    Read the article

  • How to replace strings with javascript?

    - by Damiano
    Hello everybody, I have this function: function emoticons(text){ var url = "http://www.domain.it/images/smilies/"; var emt = { ":D" : 'icon_e_biggrin.gif', ":-D" : 'icon_e_biggrin.gif', ":)" : 'icon_e_smile.gif', ":-)" : 'icon_e_smile.gif', ";)" : 'icon_e_wink.gif', "';-)" : 'icon_e_wink.gif', ":(" : 'icon_e_sad.gif', ":-(" : 'icon_e_sad.gif', ":o" : 'icon_e_surprised.gif', ":?" : 'icon_e_confused.gif', "8-)" : 'icon_cool.gif', ":x" : 'icon_mad.gif', ":P" : 'icon_razz.gif' }; for (smile in emt){ text = text.replace(smile, '<img src="' + url + emt[smile] + '" class="emoticons" />'); } return (text); } As you know .replace() convert the first occurence, how to replace more then one emoticon inside the text? How to change this function? Thank you very much!

    Read the article

  • Return highest number found in an array of strings

    - by Mdd
    I have an array of objects. The objects have a property called level that is a string which contains a number and is in consistent format. I am trying to find the highest number and return just that one but I seem to be blocked as far as how to proceed from my current code. Here is a fiddle to my current code: http://jsfiddle.net/6sXYR/ Here is my JavaScript: var myArray = [ { color: 'blue', level: 'L1' }, { color: 'red', level: 'L1' }, { color: 'green', level: 'L2' }, { color: 'yellow', level: 'L2' }, { color: 'purple', level: 'L3' } ]; for (var i = 0; i < myArray.length; i++) { console.log( myArray[i].level.substring(1,2) ); }; The result I am trying to get is to return just the number '3' from the example above. The highest number may not always be in the last object in the array, but it will always be in the format of L#.

    Read the article

  • ADODB.Connection undefined

    - by Wes Groleau
    Reference http://stackoverflow.com/questions/1690622/excel-vba-to-sql-server-without-ssis After I got the above working, I copied all the global variables/constants from the routine, which included Const CS As String = "Driver={SQL Server};" _ & "Server=**;" _ & "Database=**;" _ & "UID=**;" _ & "PWD=**" Dim DB_Conn As ADODB.Connection Dim Command As ADODB.Command Dim DB_Status As Stringinto a similar module in another spreadsheet. I also copied Sub Connect_To_Lockbox() If DB_Status < "Open" Then Set DB_Conn = New Connection DB_Conn.ConnectionString = CS DB_Conn.Open ' problem! DB_Status = "Open" End If End SubI added the same reference (ADO 2.8) The first spreadsheet still works; the seccond at DB_Conn.Open pops up "Run-time error '-214767259 (80004005)': [Microsoft][ODBC Driver Manager] Data source name not found and no default driver specified" Removing the references on both, saving files, re-opening, re-adding the references doesn't help. The one still works and the other gets the error. ?!?

    Read the article

  • Perl's use encoding pragma breaking UTF strings

    - by Karel Bílek
    I have a problem with Perl and Encoding pragma. (I use utf-8 everywhere, in input, output, the perl scripts themselves. I don't want to use other encoding, never ever.) However. When I write binmode(STDOUT, ':utf8'); use utf8; $r = "\x{ed}"; print $r; I see the string "í" (which is what I want - and what is 00+ED unicode char). But when I add the "use encoding" pragma like this binmode(STDOUT, ':utf8'); use utf8; use encoding 'utf8'; $r = "\x{ed}"; print $r; all I see is a box character. Why? Moreover, when I add Data::Dumper and let the Dumper print the new string like this binmode(STDOUT, ':utf8'); use utf8; use encoding 'utf8'; $r = "\x{ed}"; use Data::Dumper; print Dumper($r); I see that perl changed the string to "\x{fffd}". Why?

    Read the article

  • SQL Server 2005 Fail: Return Dates As Strings

    - by Abs
    Hello all, I am using the SQL Server PHP Driver, I think this question can be answered without knowing what this is. I have come across this many times, what does it mean by NAMES? Column names?: SET NAMES utf8 Is there a query similar to the above that will get my dates to be returned as a string? For some reason on my SQL Sever 2008 on Vista, this works: $connectionInfo = array('Database' => $dbname, 'ReturnDatesAsStrings' => true) But the above 'ReturnDatesAsStrings' does not work on my SQL Server 2005 on a windows server machine? I can't execute any queries after setting the above! Does SQL Server 2005 support ReturnDatesAsStrings? Is there some other parameter I can pass to do the same? Thanks all for any help EDIT I should of mentioned this but if there is a solution I am hoping for one that is in the form of a setting that can be set before any queries can be executed as I do not have control on what queries will be executed.

    Read the article

  • How do i change this method to get strings instead of ints

    - by David
    here is the original code: public static int getInt () { Scanner in = new Scanner (System.in) ; if (in.hasNextInt()) { int a = in.nextInt() ; return a ; } else { System.out.println ("try again:") ; return getInt () ; } } This checks and sees if the input it receives is an int. If it is then it returns the int, if not it tells you to try again and re-runs. This is what i tried to do to change it: public static String getIns () { Scanner in = new Scanner (System.in) ; if (in.hasNextString()) { String a = in.nextString() ; return a ; } else { System.out.println ("try again:") ; return getIns () ; } } This doesn't work though. I looked through the documentation for the scanner class and i think the problem is that there is no such method as in.hasNextString or in.nextString What methods from the scanner class can i use to do what i intend these to do?

    Read the article

  • SQL Server T-SQL statement to replace/delete sub-strings

    - by StefanE
    Hi, I have a table with 6 columns containing HTML content with some markups in it and now when moving to a new designed site most of this HTML code has to be deleted. More or less all tags except <B> and </B>. Is there a nice way of doing this, identify all tags end delete them within the data? I'm sure there are no < symbols in the test so a regular expression would maybe work? My alternative is to fetch every row, process it and update the database but I'm guessing this is possible to do in T-SQL directly. My server is an MSSQL 2008 and is located in a hosted environment but I can fetch a local copy if needed. Thanks, Stefan

    Read the article

  • List available languages for PyGTK UI strings

    - by detly
    I'm cleaning up some localisation and translation settings in our PyGTK application. The app is only intended to be used under GNU/Linux systems. One of the features we want is for users to select the language used for the applications (some prefer their native language, some prefer English for consistency, some like French because it sounds romantic, etc). For this to work, I need to actually show a combo box with the various languages available. How can I get this list? In fact, I need a list of pairs of the language code ("en", "ru", etc) and the language name in the native language ("English (US)", "???????"). If I had to implement a brute force method, I'd do something like: look in the system locale dir (eg. "/usr/share/locale") for all language code dirs (eg. "en/") containing the relative path "LC_MESSAGES/OurAppName.mo". Is there a more programmatic way?

    Read the article

  • Escape apostrophes inside double quoted strings (Javascript)

    - by George Sheppard
    Say i have a string that i need to evaluate in javascript such as : window.some_class.update( 'Runner', 'update_runner', '{"runner":{"id":"1","name":"Nin's Lad" } }'); In order for eval() to evaluate it, i need to escape the apostrophe in runner_name (Nin's Lad). Is this possable with regex? I dont want to escape the single quotes around Runner and update_runner. I'd just like to escape any single quotes inside double quotes. Thanks,

    Read the article

  • Match HTML tags in two strings using regex in Python

    - by jack
    I want to verify that the HTML tags present in a source string are also present in a target string. For example: >> source = '<em>Hello</em><label>What's your name</label>' >> verify_target(’<em>Hi</em><label>My name is Jim</label>') True >> verify_target('<label>My name is Jim</label><em>Hi</em>') True >> verify_target('<em>Hi<label>My name is Jim</label></em>') False

    Read the article

  • how to split strings and bind them as header for gridview

    - by prince23
    hi i have an string List rows = new List(); now rows has an data like this countryname~population india~12,211 china~23,22,223 usa~45,454 japan~34,343,232 now i need to bind this data in gridview like countryname and population as header for gridview countryname population india 12,211 china 2322223 usa 45454 japan 34343232 any help would be great thank you

    Read the article

  • DB4o Linq query - How to check for null strings

    - by Dave
    Hey there - simple query: var q = (from SomeObject o in container where o.SomeInt > 8 && o.SomeString != null //Null Ref here select o; I always get a null reference exception. If I use String.IsNullOrEmpty(o.SomeString) the query takes about 100 times as long, as if I use && o.SomeString != "" (which is way faster, but obviously not correct). I'm guessing because DB4o needs to activate the objects, in order to pass them in to the IsNullOrEmpty call, and can't use the indexes. My question is, what's a better way to check for nulls in this situation? Is there something like: mystring != Db4o.DBNull.Value, or something? Cheers, Dave

    Read the article

  • PHP: Condense array of similar strings into one merged array

    - by Matt Andrews
    Hi everyone. Working with an array of dates (opening times for a business). I want to condense them to their briefest possible form. So far, I started out with this structure Array ( [Mon] => 12noon-2:45pm, 5:30pm-10:30pm [Tue] => 12noon-2:45pm, 5:30pm-10:30pm [Wed] => 12noon-2:45pm, 5:30pm-10:30pm [Thu] => 12noon-2:45pm, 5:30pm-10:30pm [Fri] => 12noon-2:45pm, 5:30pm-10:30pm [Sat] => 12noon-11pm [Sun] => 12noon-9:30pm ) What I want to achieve is this: Array ( [Mon-Fri] => 12noon-2:45pm, 5:30pm-10:30pm [Sat] => 12noon-11pm [Sun] => 12noon-9:30pm ) I've tried writing a recursive function and have managed to output this so far: Array ( [Mon-Fri] => 12noon-2:45pm, 5:30pm-10:30pm [Tue-Fri] => 12noon-2:45pm, 5:30pm-10:30pm [Wed-Fri] => 12noon-2:45pm, 5:30pm-10:30pm [Thu-Fri] => 12noon-2:45pm, 5:30pm-10:30pm [Sat] => 12noon-11pm [Sun] => 12noon-9:30pm ) Can anybody see a simple way of comparing the values and combining the keys where they're similar? My recursive function is basically two nested foreach() loops - not very elegant. Thanks, Matt EDIT: Here's my code so far, which produces the 3rd array above (from the first one as input): $last_time = array('t' => '', 'd' => ''); // blank array for looping $i = 0; foreach($final_times as $day=>$time) { if($last_time['t'] != $time ) { // it's a new time if($i != 0) { $print_times[] = $day . ' ' . $time; } // only print if it's not the first, otherwise we get two mondays } else { // this day has the same time as last time $end_day = $day; foreach($final_times as $day2=>$time2) { if($time == $time2) { $end_day = $day2; } } $print_times[] = $last_time['d'] . '-' . $end_day . ' ' . $time; } $last_time = array('t' => $time, 'd' => $day); $i++; }

    Read the article

  • Django approximate matching of unicode strings with ascii equivalents

    - by c
    I have the following model and instance: class Bashable(models.Model): name = models.CharField(max_length=100) >>> foo = Bashable.objects.create(name=u"piñata") Now I want to be able to search for objects, but using ascii characters rather than unicode, something like this: >>> Bashable.objects.filter(name__lookslike="pinata") Is there a way in Django to do this sort of approximate string matching, using ascii stand-ins for the unicode characters in the database? Here is a related question, but for Apple's Core Data.

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • Strings exported from a module have extra line breaks

    - by Jesse Millikan
    In a DrScheme project, I'm using a MrEd editor-canvas% with text% and inserting a string from a literal in a Scheme file. This results in an extra blank line in the editor for each line of text I'm trying to insert. I've tracked this down to the apparent fact that string literals from outside modules are getting extra line breaks. Here's a full example. The editor is irrelevant at this point, but it displays the result. ; test-literals.ss (module test-literals scheme (provide (all-defined-out)) (define exported-string "From another module with some more line breaks. ")) ; editor-test.ss (module editor-test scheme (require mred "test-literals.ss") (define w (instantiate frame% ("Editor Test" #f) )) (define c (instantiate editor-canvas% (w) (line-count 12) (min-width 400))) (define editor (instantiate text% ())) (send c set-editor editor) (send w show #t) (send editor erase) (send editor insert "Some text with some line breaks. ") (send editor insert exported-string)) And the result in the editor is Some text with some line breaks. From another module with some more line breaks.

    Read the article

  • Where can I learn about JNDI strings?

    - by ferrari fan
    How do you know how to form a JNDI string? I know there must be a format and that the divisions must mean something but I haven't been able to find a good resource that explains them. For example: java:comp/env/wm/default. This is supposed to connect to a WorkManager in Websphere with the name of default. But what does the "java", "comp", "env" mean? I know what the wm/default mean because that's the JNDI name put in the WorkManager, but what does the rest mean? Thanks

    Read the article

  • MS-SQL statement to replace/delete sub-strings

    - by StefanE
    Hi, I have a table with 6 columns containing HTML content with some markups in it and now when moving to a new designed site most of this HTML code has to be deleted. More or less all tags except and . Is there a nice way of doing this, identify all tags end delete them within the data? I'm sure there are no < symbols in the test so a regular expression would maybe work? My alternative is to fecth every row, process it and update the database but I'm guessing this is possible to do in SQL directly. Thanks, Stefan

    Read the article

  • Error in merging two sequences of timestamps to yield strings

    - by AruniRC
    The code sorts two input sequences - seq01 and seq02 - on the basis of their timestamp values and returns a sequence that denotes which sequence is to be read for the values to be in order. For cases where seq02's timestamp value is lesser than seq01's timestamp value we yield a "2" to the sequence being returned, else a "1". These denote whether at that point seq01 is to be taken or seq02 is to be taken for the data to be in order (by timestamp value). let mergeSeq (seq01:seq<_>) (seq02:seq<_>) = seq { use iter01 = seq01.GetEnumerator() use iter02 = seq02.GetEnumerator() while iter01.MoveNext() do let _,_,time01 = iter01.Current let _,_,time02 = iter02.Current while time02 < time01 && iter02.MoveNext() do yield "2" yield "1" } To test it in the FSI created two sequences a and b, a={1;3;5;...} and b={0;2;4;...}. So the expected values for let c = mergeSeq a b would have been {"2","1","2","1"...}. However I am getting this error: error FS0001: The type ''a * 'b * 'c' does not match the type 'int' EDIT After correcting: let mergeSeq (seq01:seq<_>) (seq02:seq<_>) = seq { use iter01 = seq01.GetEnumerator() use iter02 = seq02.GetEnumerator() while iter01.MoveNext() do let time01 = iter01.Current let time02 = iter02.Current while time02 < time01 && iter02.MoveNext() do yield "2" yield "1" } After running this, there's another error: call MoveNext. Somehow the iteration is not being performed.

    Read the article

  • How to loop an array with strings as indexes in PHP

    - by Axel Lambregts
    I had to make an array with as indexes A-Z (the alphabet). Each index had to have a value 0. So i made this array: $alfabet = array( 'A' => 0, 'B' => 0, 'C' => 0, 'D' => 0, 'E' => 0, 'F' => 0, 'G' => 0, 'H' => 0, 'I' => 0, 'J' => 0, 'K' => 0, 'L' => 0, 'M' => 0, 'N' => 0, 'O' => 0, 'P' => 0, 'Q' => 0, 'R' => 0, 'S' => 0, 'T' => 0, 'U' => 0, 'V' => 0, 'W' => 0, 'X' => 0, 'Y' => 0, 'Z' => 0 ); I also have got text from a file ($text = file_get_contents('tekst15.txt');) I have putted the chars in that file to an array: $textChars = str_split ($text); and sorted it from A-Z: sort($textChars); What i want is that (with a for loop) when he finds an A in the textChars array, the value of the other array with index A, goes up by one (so like: $alfabet[A]++; Can anyone help me with this loop? I have this atm: for($i = 0; $i <= count($textChars); $i++){ while($textChars[$i] == $alfabet[A]){ $alfabet[A]++; } } echo $alfabet[A]; Problem 1: i want to loop the alfabet array to, so now i only check for A but i want to check all indexes. Problem2: this now returns 7 for each alphabet index i try so its totally wrong :) I'm sorry about my english but thanks for your time.

    Read the article

< Previous Page | 116 117 118 119 120 121 122 123 124 125 126 127  | Next Page >