Search Results

Search found 3533 results on 142 pages for 'jms topic'.

Page 120/142 | < Previous Page | 116 117 118 119 120 121 122 123 124 125 126 127  | Next Page >

  • Using PHP to get the source code of a URL I must be logged in to reach

    - by Maxwell
    I am trying to write a PHP script that will get the source code of a page in my Amazon account. However, to reach that page, I must be logged in. From what I understand, I should be able to accomplish this by posting the correct request headers, and then capturing the HTML response. Is that correct? If so, I'd really appreciate it if someone could explain to me how exactly I would do this. If it's not right, I'd love to hear the correct way of doing it! I've used Firebug to get the request and response headers I need. It's just a matter of what to do with them now. I read elsewhere on this site that you can't send a request with the PHP post method, and that perhaps using cURL is the way to go. I really know nothing about cURL, so the more info the better. Also, feel free to point me to some useful tutorials on this topic. Thanks! Max

    Read the article

  • Trigger JavaScript action after Datatable is loaded

    - by perissf
    In a JSF 2.1 + PrimeFaces 3.2 web application, I need to trigger a JavaScript function after a p:dataTable is loaded. I know that there is no such event in this component, so I have to find a workaround. In order to better understand the scenario, on page load the dataTable is not rendered. It is rendered after a successful login: <p:commandButton value="Login" update=":aComponentHoldingMyDataTable" action="#{loginBean.login}" oncomplete="handleLoginRequest(xhr, status, args)"/> As you can see from the above code, I have a JavaScript hook after the successful login, if it can be of any help. Immediately after the oncomplete action has finished, the update attribute renders the dataTable: <p:dataTable var="person" value="#{myBean.lazyModel}" rendered="#{p:userPrincipal() != null}" /> After the datatable is loaded, I need to run a JavaScript function on each row item, in order to subscribe to a cometD topic. In theory I could use the oncomplete attribute of the login Button for triggering a property from myBean in order to retrieve once again the values to be displayed in the dataTable, but it doesn't seem very elegant. The JavaScript function should do something with the rowKey of each row of the dataTable: function javaScriptFunctionToBeTriggered(rowKey) { // do something }

    Read the article

  • Java object graph -> xml when direction of object association needs to be reversed.

    - by Sigmoidal
    An application I have been working on has objects with a relationship similar to below. In the real application both objects are JPA entities. class Underlying{} class Thing { private Underlying underlying; public Underlying getUnderlying() { return underlying; } public void setUnderlying(final Underlying underlying) { this.underlying = underlying; } } There is a requirement in the application to create xml of the form: <template> <underlying> <thing/> <thing/> <thing/> </underlying> </template> So we have a situation where the object graph expresses the relationship between Thing and Underlying in the opposite direction to how it's expressed in the xml. I expect to use JAXB to create the xml but ideally I don't want to have to create a new object hierarchy to reflect the associations in the xml. Is there any way to create xml of the form required from the entities in their current form (through the use of xml annotations or something)? I don't have any experience using JAXB but from the limited research I've done it doesn't seem like it's possible to reverse the direction of association in any straightforward way. Any help/advice would be greatly appreciated. One other option that has been suggested is to use XLST to transform the xml into the correct format. I have done no research on this topic as yet but I'll add to the question when I have some more info. Thanks, Matt.

    Read the article

  • incremental way of counting quantiles for large set of data

    - by Gacek
    I need to count the quantiles for a large set of data. Let's assume we can get the data only through some portions (i.e. one row of a large matrix). To count the Q3 quantile one need to get all the portions of the data and store it somewhere, then sort it and count the quantile: List<double> allData = new List<double>(); foreach(var row in matrix) // this is only example. In fact the portions of data are not rows of some matrix { allData.AddRange(row); } allData.Sort(); double p = 0.75*allData.Count; int idQ3 = (int)Math.Ceiling(p) - 1; double Q3 = allData[idQ3]; Now, I would like to find a way of counting this without storing the data in some separate variable. The best solution would be to count some parameters od mid-results for first row and then adjust it step by step for next rows. Note: These datasets are really big (ca 5000 elements in each row) The Q3 can be estimated, it doesn't have to be an exact value. I call the portions of data "rows", but they can have different leghts! Usually it varies not so much (+/- few hundred samples) but it varies! This question is similar to this one: http://stackoverflow.com/questions/1058813/on-line-iterator-algorithms-for-estimating-statistical-median-mode-skewness But I need to count quantiles. ALso there are few articles in this topic, i.e.: http://web.cs.wpi.edu/~hofri/medsel.pdf http://portal.acm.org/citation.cfm?id=347195&dl But before I would try to implement these, I wanted to ask you if there are maybe any other, qucker ways of counting the 0.25/0.75 quantiles?

    Read the article

  • What should be taught in a "Fundamentals of programming" course at university?

    - by Dervin Thunk
    I have started a new question (see here), because I think the topic is of importance in a more general form. The question is now: If you were a professor at a Computer Science Dept. in some university, what would make it into your course? This is a programming course, second term, first year computer science/computer engineering. Remember you have a limited amount of time, and students are of different levels of competence, and some may be scientists, but some will also go on to be programmers in companies of different kinds. You have to cater to all. Bonus: What language? (Although see this question for my current thoughts about this...) Maybe you want to attach a course outline from some university? See here for an even more general question about this. Answer: I can't really summarize this post... I guess it was too subjective. However, it looks like we have to cover the history of computing up to a certain extent, computer architecture (memory, registers, whatever), C, and finally some basic algos and data structures in a problem solving fashion. This will be the bare bones of the course. Thanks all. I will accept the most voted up answer to close the thread, as it should be done.

    Read the article

  • Understanding how software testing works and what to test.

    - by RHaguiuda
    Intro: I've seen lots of topics here on SO about software testing and other terms I don't understand. Problem: As a beginner developer I, unfortunately, have no idea how software testing works, not even how to test a simple function. This is a shame, but thats the truth. I also hope this question can help others beginners developers too. Question: Can you help me to understand this subject a little bit more? Maybe some questions to start would help: When I develop a function, how should I test it? For example: when working with a sum function, should I test every input value possible or just some limits? How about testing functions with strings as parameters? In a big program, do I have to test every single piece of code of it? When you guys program do you test every code written? How automated test works and how can I try one? How tools for automated testing works and what they do? I`ve heard about unit testing. Can I have a brief explanation on this? What is a testing framework? If possible please post some code with examples to clarify the ideas. Any help on this topic is very welcome! Thanks.

    Read the article

  • Java-Eclipse-Spring 3.1 - the fastest way to get familiar with this set

    - by Leron
    I, know almost all of you at some point of your life as a programmer get to the point where you know (more or less) different technologies/languages/IDEs and a times come when you want to get things together and start using them once - more efficient and second - more closely to the real life situation where in fact just knowing Java, or some experience with Eclipse doesn't mean nothing, and what makes you a programmer worth something is the ability to work with the combination of 2 or more combinations. Having this in mind here is my question - what do you think is the optimal way of getting into Java+Eclipse+Spring3.1 world. I've read, and I've read a lot. I started writing real code but almost every step is discovering the wheel again and again, wondering how to do thing you know are some what trivial, but you've missed that one article where this topic was discussed and so on. I don't mind for paying for a good tutorial like for example, after a bit of research I decided that instead of losing a lot of time getting the different parts together I'd rather pay for the videos in http://knpuniversity.com/screencast/starting-in-symfony2-tutorial and save myself a lot of time (I hope) and get as fast as possible to writing a real code instead of wondering what do what and so on. But I find it much more difficult to find such sources of info especially when you want something more specific as me and that's the reason to ask this question. I know a lot of you go through the hard way, and I won't give up if I have to do the same, but to be honest I really hope to get post with good tutorials on the subject (paid or not) because in my situation time is literally money. Thanks Leron

    Read the article

  • Reference - What does this error mean in PHP?

    - by hakre
    On Stackoverflow you can see a lot of questions popping up about errors. Some users do not even know that error messages exists, others are asking about code that gives an error message but they do not understand the error message. If the error message is common, many questions about the same kind of error appears, but it is hard to find existing Q&A about the topic. Please add "your favorite" error message, one per answer, a short description what it means (even if it is only highlighting terms to their manual page) and a listing of existing Q&A that are of value. This will create a list. The question is a community wiki, so you are not answering for reputation but for creating a reference list for new users. It's based on error messages. Compare with the existing Reference - What does this symbol mean in PHP? question, which works pretty well. What are common errors in PHP and what are their Solutions. Index of Errors Just starting, but there are already some: Warning: Cannot modify header information - headers already sent Warning: mysql_fetch_array() expects parameter 1 to be resource, boolean given in ... on line Parse error: syntax error, unexpected T_XXX in YYY on line ZZZ Fatal Error: Call to a member function ... on a non-object

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • Reading bmp file for encrypting and decrypting txt file into it

    - by Shantanu Gupta
    I am trying to read a bmp file in C++(Turbo). But i m not able to print binary stream. I want to encode txt file into it and decrypt it. How can i do this. I read that bmp file header is of 54 byte. But how and where should i append txt file in bmp file. ? I know only Turbo C++, so it would be helpfull for me if u provide solution or suggestion related to topic for the same. int main() { ifstream fr; //reads ofstream fw; // wrrites to file char c; int random; clrscr(); char file[2][100]={"s.bmp","s.txt"}; fr.open(file[0],ios::binary);//file name, mode of open, here input mode i.e. read only if(!fr) cout<<"File can not be opened."; fw.open(file[1],ios::app);//file will be appended if(!fw) cout<<"File can not be opened"; while(!fr) cout<<fr.get(); // error should be here. but not able to find out what error is it fr.close(); fw.close(); getch(); } This code is running fine when i pass txt file in binary mode

    Read the article

  • How do I optimize this postfix expression tree for speed?

    - by Peter Stewart
    Thanks to the help I received in this post: I have a nice, concise recursive function to traverse a tree in postfix order: deque <char*> d; void Node::postfix() { if (left != __nullptr) { left->postfix(); } if (right != __nullptr) { right->postfix(); } d.push_front(cargo); return; }; This is an expression tree. The branch nodes are operators randomly selected from an array, and the leaf nodes are values or the variable 'x', also randomly selected from an array. char *values[10]={"1.0","2.0","3.0","4.0","5.0","6.0","7.0","8.0","9.0","x"}; char *ops[4]={"+","-","*","/"}; As this will be called billions of times during a run of the genetic algorithm of which it is a part, I'd like to optimize it for speed. I have a number of questions on this topic which I will ask in separate postings. The first is: how can I get access to each 'cargo' as it is found. That is: instead of pushing 'cargo' onto a deque, and then processing the deque to get the value, I'd like to start processing it right away. I don't yet know about parallel processing in c++, but this would ideally be done concurrently on two different processors. In python, I'd make the function a generator and access succeeding 'cargo's using .next(). But I'm using c++ to speed up the python implementation. I'm thinking that this kind of tree has been around for a long time, and somebody has probably optimized it already. Any Ideas? Thanks

    Read the article

  • How to detect a gamepad button press on OSX 10.5 and higher?

    - by Steph Thirion
    How do I detect a button press on a USB gamepad on OSX 10.5 and higher? I can't wrap my head around the ridiculously complex HID Manager (even though apparently it was simplified with 10.5), and the code samples at Apple have thousands of lines of code that would take days to understand and isolate what I need, so I'd appreciate if someone posts a simple, and fully coded solution for this isolated problem. EDIT: so far all answers are links to source code or semi obscure libraries for all kinds of HID devices, which will require more research time than what I'd like to invest on this. I am starting a bounty to get an actual snippet of code that solves this simple problem (using an external library or not). EDIT POS BOUNTY: thanks to all for you help; but unfortunately the answer that has been automatically selected by the system is not working for me, can't figure out why; and the author has not yet replied to my comments. Any insight would be appreciated, but until a fix is found, anyone looking for resources on this topic should take this answer with a pinch of salt.

    Read the article

  • Return 0 where django quersyet is none

    - by gramware
    I have a django queryset in my views whose values I pack before passing to my template. There is a problem when the queryset returns none since associated values are not unpacked. the quersyet is called comments. Here is my views.py def forums(request ): post_list = list(forum.objects.filter(child='0')&forum.objects.filter(deleted='0').order_by('postDate')) user = UserProfile.objects.get(pk=request.session['_auth_user_id']) newpostform = PostForm(request.POST) deletepostform = PostDeleteForm(request.POST) DelPostFormSet = modelformset_factory(forum, exclude=('child','postSubject','postBody','postPoster','postDate','childParentId')) readform = ReadForumForm(request.POST) comments =list( forum.objects.filter(deleted='0').filter(child='1').order_by('childParentId').values('childParentId').annotate(y=Count('childParentId'))) if request.user.is_staff== True : staff = 1 else: staff = 0 staffis = 1 if newpostform.is_valid(): topic = request.POST['postSubject'] poster = request.POST['postPoster'] newpostform.save() return HttpResponseRedirect('/forums') else: newpostform = PostForm(initial = {'postPoster':user.id}) if request.GET: form = SearchForm(request.GET) if form.is_valid(): query = form.cleaned_data['query'] post_list = list((forum.objects.filter(child='0')&forum.objects.filter(deleted='0')&forum.objects.filter(Q(postSubject__icontains=query)|Q(postBody__icontains=query)|Q(postDate__icontains=query)))or(forum.objects.filter(deleted='0')&forum.objects.filter(Q(postSubject__icontains=query)|Q(postBody__icontains=query)|Q(postDate__icontains=query)).values('childParentId'))) if request.method == 'POST': delpostformset = DelPostFormSet(request.POST) if delpostformset.is_valid(): delpostformset.save() return HttpResponseRedirect('/forums') else: delpostformset = DelPostFormSet(queryset=forum.objects.filter(child='0', deleted='0')) """if readform.is_valid(): user=get_object_or_404(UserProfile.objects.all()) readform.save() else: readform = ReadForumForm()""" post= zip( post_list,comments, delpostformset.forms) paginator = Paginator(post, 10) # Show 10 contacts per page # Make sure page request is an int. If not, deliver first page. try: page = int(request.GET.get('page', '1')) except ValueError: page = 1 # If page request (9999) is out of range, deliver last page of results. try: post = paginator.page(page) except (EmptyPage, InvalidPage): post = paginator.page(paginator.num_pages) return render_to_response('forum.html', {'post':post, 'newpostform': newpostform,'delpost':delpostformset, 'username':user.username, 'comments':comments, 'user':user, },context_instance = RequestContext( request ))

    Read the article

  • OSGI, Servlets and JPA hello world / tutorial / example

    - by Kamil
    I want to build a web application which basically is a restful web-service serving json messages. I would like it to be as simple as possible. I was thinking about using servlets (with annotations). JPA as a database layer is a must - Toplink or Hibernate. Preferably working on Tomcat. I want to have app divided into modules serving different functionality (auth service, customer service, etc..). And I would like to be able to update those modules without reinstalling whole application on the server - like eclipse plugins, user is notified (when he enters webapp's home url) that update is available, clicks it, and app is downloading and installing updated module. I think this functionality can be made with OSGI, but I can't find any example code, or tutorial with simple hello world updatable servlet providing some data from database through jpa. I'm looking for an advice: - Is OSGI the right tool for this or it can be done with something simpler? - Where can I find some examples covering topic (or topics) which I need for this project. - Which OSGI implementation would be best-simplest for this task. *My knowledge of OSGI is basic. I know how bundles are described, I understand concept of OSGI container and what it does. I have never created any OSGI app yet.

    Read the article

  • Record the timestamps of slide changes during a live Powerpoint presentation?

    - by StackedCrooked
    I am planning to implement a lecture capture solution. One of the requirements is to record both the presenter and the slideshow. The presenter is recorded with a videocamera obviously, and the slideshow will probably be captured using a tool like Camtasia. Now during playback three components are visible: the presenter, the slides and a table of contents. Clicking a chapter title in the TOC causes the video to navigate to the corresponding section. This means that a mapping must be made between chapter titles and their timestamps in the video. Usually a change of topic is accompanied with a slide change in the Powerpoint presentation. So the timestamps could be deduced from the slidechanges. However, this requires me to detect slide changes during the live presentation. And I don't know how to do that. Anyone here knows how to do detect slide changes? Is there a Powerpoint API where I can connect event handlers or something like that? I'd greatly appreciate your help! Edit This issue is no longer relevant for my current work so this question will not be updated by me. However, you are still free to help others by posting your answers/insights here.

    Read the article

  • How do I detect proximity of the mouse pointer to a line in Flex?

    - by Hanno Fietz
    I'm working on a charting UI in Flex. One of the features I want to implement is "snapping" of the mousepointer to the data points in the diagram. I. e., if the user hovers the mouse pointer over a line diagram and gets close to the data point, I want the pointer to move to the exact coordinates and show a marker, like this: Currently, the lines are drawn on a Shape, using the Graphics API. The Shape is a child DisplayObject of a custom UIComponent subclass with the exact same dimensions. This means, I already get mouseOver events on the parent of the diagram's canvas. Now I need a way to detect if the pointer is close to one of the data points. I. e. I need an answer to the question "Which data points lie within a radius of x pixels from my current position and which of them is closest?" upon each move of the mouse. I can think of the following possibilities: draw the lines not as simple lines in the graphics API, but as more advanced objects that can have their own mouseOver events. However, I want the snapping to trigger before the mouse is actually over the line. check the original data for possible candidates upon each mouse movement. Using binary search, I might be able to reduce the number of items I have to compare sufficently. prepare some kind of new data structure from the raw data that makes the above search more efficient. I don't know how that would look like. I'm guessing this is a pretty standard problem for a number of applications, but probably the actual code usually is inside of some framework. Is there anything I can read about this topic?

    Read the article

  • How would you implement a hashtable in language x?

    - by mk
    The point of this question is to collect a list of examples of hashtable implementations using arrays in different languages. It would also be nice if someone could throw in a pretty detailed overview of how they work, and what is happening with each example. Edit: Why not just use the built in hash functions in your specific language? Because we should know how hash tables work and be able to implement them. This may not seem like a super important topic, but knowing how one of the most used data structures works seems pretty important to me. If this is to become the wikipedia of programming, then these are some of the types of questions that I will come here for. I'm not looking for a CS book to be written here. I could go pull Intro to Algorithms off the shelf and read up on the chapter on hash tables and get that type of info. More specifically what I am looking for are code examples. Not only for me in particular, but also for others who would maybe one day be searching for similar info and stumble across this page. To be more specific: If you had to implement them, and could not use built-in functions, how would you do it? You don't need to put the code here. Put it in pastebin and just link it.

    Read the article

  • Is XSLT worth investing time in and are there any actual alternatives?

    - by Keeno
    I realize this has been a few other questions on this topic, and people are saying use your language of choice to manipulate the XML etc etc however, not quite fit my question exactly. Firstly, the scope of the project: We want to develop platform independent e-learning, currently, its a bunch of HTML pages but as they grow and develop they become hard to maintain. The idea: Generate up an XML file + Schema, then produce some XSLT files that process the XML into the eLearning modiles. XML to HTML via XSLT. Why: We would like the flexibilty to be able to easy reformat the content (I realize CSS is a viable alternative here) If we decide to alter the pages layout or functionality in anyway, im guessing altering the "shared" XSLT files would be easier than updating the HTML files. So far, we have about 30 modules, with up to 10-30 pages each Depending on some "parameters" we could output drastically different page layouts/structures, above and beyond what CSS can do Now, all this has to be platform independent, and to be able to run "offline" i.e. without a server powering the HTML Negatives I've read so far for XSLT: Overhead? Not exactly sure why...is it the compute power need to convert to HTML? Difficult to learn Better alternatives Now, what I would like to know exactly is: are there actually any viable alternatives for this "offline"? Am I going about it in the correct manner, do you guys have any advice or alternatives. Thanks!

    Read the article

  • Radio buttons being reset in FF on cache-refresh

    - by Andrew Song
    (This is technically an addendum to an earlier StackOverflow question I had posted, but my original post asked a different question which doesn't really cover this topic -- I don't want to edit my older question as I feel this is different enough to merit its own page) While browsing my website in Firefox 3.5 (and only FF3.5), I come across a page with two radio buttons that have the following HTML code: <input id="check1" type="radio" value="True" name="check" checked="checked"/> <input id="check2" type="radio" value="False" name="check"/> This page renders as expected, with 'check1' checked and 'check2' unchecked. When I then go to refresh the page by pressing Control + R, the two radio buttons render, but they are both unchecked even though the raw HTML code is the same (as above). If I do a cache-miss refresh (via Control + F5 or Control + Shift + R), the page returns back to the way you'd expect it. This is not a problem in any other browser I've tried except FF3.5. What is causing these radio buttons to be reset on a normal refresh? How can I avoid this?

    Read the article

  • Counting combinations in c or in python

    - by Dennis
    Hello I looked a bit on this topic here but I found nothing that could help me. I need a program in Python or in C that will give me all possible combinations of a and b that will meet the requirement n=2*a+b, for n from 0 to 10. a, b and n are integers. For example if n=0 both a and b must be 0. For n=1 a must be zero and b must be 1, for n=2 a can be 1 and b=0, or a=0 and b=2, etc. I'm not that good with programming. I made this: #include <stdio.h> int main(void){ int a,b,n; for(n = 0; n <= 10; n++){ for(a = 0; a <= 10; a++){ for(b = 0; b <= 10; b++) if(n == 2*a + b) printf("(%d, %d), ", (a,b)); } printf("\n"); } } But it keeps getting strange results like this: (0, -1079628000), (1, -1079628000), (2, -1079628000), (0, -1079628000), (3, -1079628000), (1, -1079628000), (4, -1079628000), (2, -1079628000), (0, -1079628000), (5, -1079628000), (3, -1079628000), (1, -1079628000), (6, -1079628000), (4, -1079628000), (2, -1079628000), (0, -1079628000), (7, -1079628000), (5, -1079628000), (3, -1079628000), (1, -1079628000), (8, -1079628000), (6, -1079628000), (4, -1079628000), (2, -1079628000), (0, -1079628000), (9, -1079628000), (7, -1079628000), (5, -1079628000), (3, -1079628000), (1, -1079628000), (10, -1079628000), (8, -1079628000), (6, -1079628000), (4, -1079628000), (2, -1079628000), (0, -1079628000), ideone Any idea what is wrong? Also if I could do this for Python it would be even cooler. :D

    Read the article

  • Multi-Part HTTP Request through xcode

    - by devsri
    Hello Everyone, i want to upload image,video and audio files to a server. I have read this thread on the similar topic but wasn't able to understand completely the flow of the code. It would be great if you can suggest me some sample code or tutorial to start with. I am using the following code to connect without any media to the server [UIApplication sharedApplication].networkActivityIndicatorVisible = YES; NSString *url =[[NSString alloc]initWithFormat:@"%@",[NetworkConstants getURL]]; NSURL *theURL =[NSURL URLWithString:url]; [url release]; NSMutableURLRequest *theRequest =[NSMutableURLRequest requestWithURL:theURL cachePolicy:NSURLRequestReloadIgnoringCacheData timeoutInterval:0.0f]; [theRequest setHTTPMethod:@"POST"]; NSString *theBodyString = [NSString stringWithFormat:@"json1=%@&userID=%@",jsonObject,[GlobalConstants getUID]]; NSData *theBodyData = [theBodyString dataUsingEncoding:NSUTF8StringEncoding]; [theRequest setHTTPBody:theBodyData]; NSURLConnection *conn = [[NSURLConnection alloc] initWithRequest:theRequest delegate:self]; if (conn) { NSLog(@"Successful in sending sync"); } else { NSLog(@"Failed Connection in sending sync"); } [conn release]; It would be really convenient for me if anything could be done editing this part of code. Any form of help would be highly appreciated. Thanks in advance!!

    Read the article

  • ASP.NET MVC Viewmodel trouble...

    - by ile
    I've already started similar topic, but still didn't find final solution... So here I am with new one :) ... I'm developing NerdDinner from scratch and now I came to point where I define DinnerViewModel. Following these instructions (starting from Listing 5) I came to this: namespace Nerd.Controllers { // View Model Classes public class DinnerViewModel { public DinnerViewModel(List<Dinner> dinners) { this.Dinners = dinners; } public List<Dinner> Dinners { get; private set; } } public class DinnerController : Controller { private DinnerRepository dinnerRepository = new DinnerRepository(); .... public ActionResult NewDinners() { // Create list of products var dinners = new List<Dinner>(); dinners.Add(new Dinner(/*Something to add*/)); // Return view return View(new DinnerViewModel(dinners)); } } } Also, the Dinner table in this new version of NerdDinner is a bit shortened (it contains of DinnerID, Title, EventDate and Description fields). No matter what I try to add here dinners.Add(new Dinner(/*Something to add*/)); I always get following error Error 1 'Nerd.Model.Dinner' does not contain a constructor that takes '1' arguments C:\Documents and Settings\ilija\My Documents\Visual Studio 2008\Projects\Nerd\Nerd\Controllers\DinnerController.cs 150 25 Nerd Because I'm total beginner in C# and generally OOP, I have no idea what to do here... I suppose I need to declare a constructor, but how and where exactly? Thanks, Ile

    Read the article

  • [OT a bit] Flex+JEE what is it good for?

    - by Zenzen
    Ok so sorry for being, I guess, a bit off topic but still I think this is the best place to ask. My new semester just started (don't worry I won't ask you to do my homework) and this time we have a rather cool subject about www programming in general where we have to do a web service, web abb - whatever as long as it's "web". Here's the problem though, my team and I want to do it with Flex and JEE but we don't have much experience about what are they actually used for. I mean we know you can do virtually anything with it, but we don't really want to lose time on doing something useless. My first idea was to do a "brainstorming" 3D room/service - a place where people could log in have a video conference, a whiteboard, a place to upload pictures everyone could see, some toolbars for google, youtube etc. plus some other features which would make real-time brainstorming easy when you can't get everyone in one place. But is Flex+JEE really suitable? I mean I'm 99% sure it's doable but is it really worth doing it in Flex+JEE or was the whole purpose of JEE completely different? @EDIT: well this was only one of our ideas obviously. I do know the basics of JSP, Servlets, JPA etc. of course but yeah the main goal of this project is to get some actual experience. The problem is we don't really know is it worth doing something like let's say a social network (something like extended facebook) for gamers (doesn't really matter if it already exists) in JEE or would it only look ridiculous (because PHP or whatever would be a far better choice)? Bottom line is that we are wondering are only large scale applications (for banks etc.) written in JEE or is it good for anything (even the smaller projects)?

    Read the article

  • Why doesn't java.lang.Number implement Comparable?

    - by Julien Chastang
    Does anyone know why java.lang.Number does not implement Comparable? This means that you cannot sort Numbers with Collections.sort which seems to me a little strange. Post discussion update: Thanks for all the helpful responses. I ended up doing some more research about this topic. The simplest explanation for why java.lang.Number does not implement Comparable is rooted in mutability concerns. For a bit of review, java.lang.Number is the abstract super-type of AtomicInteger, AtomicLong, BigDecimal, BigInteger, Byte, Double, Float, Integer, Long and Short. On that list, AtomicInteger and AtomicLong to do not implement Comparable. Digging around, I discovered that it is not a good practice to implement Comparable on mutable types because the objects can change during or after comparison rendering the result of the comparison useless. Both AtomicLong and AtomicInteger are mutable. The API designers had the forethought to not have Number implement Comparable because it would have constrained implementation of future subtypes. Indeed, AtomicLong and AtomicInteger were added in Java 1.5 long after java.lang.Number was initially implemented. Apart from mutability, there are probably other considerations here too. A compareTo implementation in Number would have to promote all numeric values to BigDecimal because it is capable of accommodating all the Number sub-types. The implication of that promotion in terms of mathematics and performance is a bit unclear to me, but my intuition finds that solution kludgy.

    Read the article

  • Should a developer be a coauthor to a paper presented about the application they developed?

    - by ved
    In our organization, project teams come up with a need and funding and developers are given a basic scope and are allowed to develop the solution. There is a certain degree of implementation freedom given to the developers. They drive the solution to pilot and live deployment from its inception. If the solution is presented in a conference as a technical paper/white paper what is the protocol for the list of authors: because for the most part I see the project manager's and the dev team manager's names as authors but no mention of the actual developer. Is this correct? A lot of us developers feel pretty bummed to never see our names as the coauthors. Appreciate any pointers. Answers to the FOLLOW UP questions (1) in what field of study is the paper, and what are the standards of authorship for that field? The paper is for Flood Plain Management - there is nothing on the abstract guidelines, I have called the contact person listed for comment - waiting to hear. 2) was the paper literally about the software application as your question implies, or were the software issues incidental to the topic of the paper? The paper specifically deals with a GIS Application that is used in Coastal Engineering, yes the software is not incidental, but the meat of the paper and mentioned in the Title. 2

    Read the article

< Previous Page | 116 117 118 119 120 121 122 123 124 125 126 127  | Next Page >