Search Results

Search found 8391 results on 336 pages for 'partial hash arguments'.

Page 124/336 | < Previous Page | 120 121 122 123 124 125 126 127 128 129 130 131  | Next Page >

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Why do the overloads of String.Format exist?

    - by GiddyUpHorsey
    I was using Reflector to look at the implementation of String.Format and had always been under the impression that the overloads of String.Format that took 1, 2 & 3 arguments were optimized versions of the method that takes an object array. However, what I found was that internally they create an object array and then call a method that takes an object array. 1 arg public static string Format(string format, object arg0) { if (format == null) { throw new ArgumentNullException("format"); } return Format(null, format, new object[] { arg0 }); } 2 args public static string Format(string format, object arg0, object arg1) { if (format == null) { throw new ArgumentNullException("format"); } return Format(null, format, new object[] { arg0, arg1 }); } 3 args public static string Format(string format, object arg0, object arg1, object arg2) { if (format == null) { throw new ArgumentNullException("format"); } return Format(null, format, new object[] { arg0, arg1, arg2 }); } Object array public static string Format(string format, params object[] args) { if ((format == null) || (args == null)) { throw new ArgumentNullException((format == null) ? "format" : "args"); } return Format(null, format, args); } Internally they all end up using the same code and so using the 1, 2 & 3 argument versions are no faster than the object array version. So my question is - why do they exist? When you use the object array version with a comma separated list of values, the compiler automatically converts the arguments into an object array because of the params/ParamArray keyword which is essentially what the 1, 2 & 3 versions do, so they seem redundant. Why did the BCL designers add these overloads?

    Read the article

  • Problem with MessageContract, Generic return types and clientside naming

    - by Soeteman
    I'm building a web service which uses MessageContracts, because I want to add custom fields to my SOAP header. In a previous topic, I learned that a composite response has to be wrapped. For this purpose, I devised a generic ResponseWrapper class. [MessageContract(WrapperNamespace = "http://mynamespace.com", WrapperName="WrapperOf{0}")] public class ResponseWrapper<T> { [MessageBodyMember(Namespace = "http://mynamespace.com")] public T Response { get; set; } } I made a ServiceResult base class, defined as follows: [MessageContract(WrapperNamespace = "http://mynamespace.com")] public class ServiceResult { [MessageBodyMember] public bool Status { get; set; } [MessageBodyMember] public string Message { get; set; } [MessageBodyMember] public string Description { get; set; } } To be able to include the request context in the response, I use a derived class of ServiceResult, which uses generics: [MessageContract(WrapperNamespace = "http://mynamespace.com", WrapperName = "ServiceResultOf{0}")] public class ServiceResult<TRequest> : ServiceResult { [MessageBodyMember] public TRequest Request { get; set; } } This is used in the following way [OperationContract()] ResponseWrapper<ServiceResult<HCCertificateRequest>> OrderHealthCertificate(RequestContext<HCCertificateRequest> context); I expected my client code to be generated as ServiceResultOfHCCertificateRequest OrderHealthCertificate(RequestContextOfHCCertificateRequest context); Instead, I get the following: ServiceResultOfHCCertificateRequestzSOTD_SSj OrderHealthCertificate(CompType1 c1, CompType2 c2, HCCertificateRequest context); CompType1 and CompType2 are properties of the RequestContext class. The problem is that a hash is added to the end of ServiceResultOfHCCertificateRequestzSOTD_SSj. How do I need define my generic return types in order for the client type to be generated as expected (without the hash)?

    Read the article

  • Should I store generated code in source control

    - by Ron Harlev
    This is a debate I'm taking a part in. I would like to get more opinions and points of view. We have some classes that are generated in build time to handle DB operations (in This specific case, with SubSonic, but I don't think it is very important for the question). The generation is set as a pre-build step in Visual Studio. So every time a developer (or the official build process) runs a build, these classes are generated, and then compiled into the project. Now some people are claiming, that having these classes saved in source control could cause confusion, in case the code you get, doesn't match what would have been generated in your own environment. I would like to have a way to trace back the history of the code, even if it is usually treated as a black box. Any arguments or counter arguments? UPDATE: I asked this question since I really believed there is one definitive answer. Looking at all the responses, I could say with high level of certainty, that there is no such answer. The decision should be made based on more than one parameter. Reading the answers below could provide a very good guideline to the types of questions you should be asking yourself when having to decide on this issue. I won't select an accepted answer at this point for the reasons mentioned above.

    Read the article

  • Secure Password Storage and Transfer

    - by Andras Zoltan
    I'm developing a new user store for my organisation and am now tackling password storage. The concepts of salting, HMAC etc are all fine with me - and want to store the users' passwords either salted and hashed, HMAC hashed, or HMAC salted and hashed - not sure what the best way will be - but in theory it won't matter as it will be able to change over time if required. I want to have an XML & JSON service that can act as a Security Token Service for client-side apps. I've already developed one for another system, which requires that the client double-encrypts a clear-text password using SHA1 first and then HMACSHA1 using a 128 unique key (or nonce) supplied by the server for that session only. I'd like to repeat this technique for the new system - upgrading the algo to SHA256 (chosen since implementations are readily available for all aforementioned platforms - and it's much stronger than SHA1) - but there is a problem. If I'm storing the password as a salted hash in the user-store, the client will need to be sent that salt in order to construct the correct hash before being HMACd with the unique session key. This would completely go against the point of using a salt in the first place. Equally, if I don't use salt for password storage, but instead use HMAC, it's still the same problem. At the moment, the only solution I can see is to use naked SHA256 hashing for the password in the user store, so that I can then use this as a starting point on both the server and the client for a more secure salted/hmacd password transfer for the web service. This still leaves the user store vulnerable to a dictionary attack were it ever to be accessed; and however unlikely that might be - assuming it will never happen simply doesn't sit well with me. Greatly appreciate any input.

    Read the article

  • MD5 Hashing Given a Key in C#

    - by Jared
    I've been looking for a way to hash a given string in C# that uses a predetermined key. On my adventures through the internet trying to find an example i have seen lots of MD5CryptoServiceProvider examples which seem to use a default key for the machine, but none of them that apply a specific key. I need to have a specific key to encode data as to synchronize it to someone else's server. I hand them a hashed string and an ID number and they use that analyze the data and return a similar set to me. So is there anyway to get md5 to hash via a specific key that would be consistent to both. I would prefer this to be done in C#, but if its not possible with the libraries can you do so with some web languages like php or asp? Edit: Misunderstood the scenario I was thrown into and after a little sitting and thinking about why they would have me use a key it appears they want a key appended to the end of the string and hashed. That way the server can appended the key it has along with the data passed to ensure its a valid accessing computer. Anyways... thanks all ^_^ Edit2: As my comment below says, it was the term 'salting' I was oblivious to. Oh the joys of getting thrown into something new with no directions.

    Read the article

  • forkpty - socket

    - by Alexxx
    Hi, I'm trying to develop a simple "telnet/server" daemon which have to run a program on a new socket connection. This part working fine. But I have to associate my new process to a pty, because this process have some terminal capabilities (like a readline). The code I've developped is (where socketfd is the new socket file descriptor for the new input connection) : int masterfd, pid; const char *prgName = "..."; char *arguments[10] = ....; if ((pid = forkpty(&masterfd, NULL, NULL, NULL)) < 0) perror("FORK"); else if (pid) return pid; else { close(STDOUT_FILENO); dup2(socketfd, STDOUT_FILENO); close(STDIN_FILENO); dup2(socketfd, STDIN_FILENO); close(STDERR_FILENO); dup2(socketfd, STDERR_FILENO); if (execvp(prgName, arguments) < 0) { perror("execvp"); exit(2); } } With that code, the stdin / stdout / stderr file descriptor of my "prgName" are associated to the socket (when looking with ls -la /proc/PID/fd), and so, the terminal capabilities of this process doesn't work. A test with a connection via ssh/sshd on the remote device, and executing "localy" (under the ssh connection) prgName, show that the stdin/stdout/stderr fd of this process "prgName" are associated to a pty (and so the terminal capabilities of this process are working fine). What I am doing wrong? How to associate my socketfd with the pty (created by forkpty) ? Thank Alex

    Read the article

  • How do I expose the columns collection of GridView control that is inside a user control

    - by Christopher Edwards
    See edit. I want to be able to do this in the aspx that consumes the user control. <uc:MyControl ID="MyGrid" runat="server"> <asp:BoundField DataField="FirstColumn" HeaderText="FirstColumn" /> <asp:BoundField DataField="SecondColumn" HeaderText="SecondColumn" /> </uc> I have this code (which doesn't work). Any ideas what I am doing wrong? VB Partial Public Class MyControl Inherits UserControl <System.Web.UI.IDReferenceProperty(GetType(DataControlFieldCollection))> _ Public Property Columns() As DataControlFieldCollection Get Return MyGridView.Columns End Get Set(ByVal value As DataControlFieldCollection) ' The Columns collection of the GridView is ReadOnly, so I rebuild it MyGridView.Columns.Clear() For Each c As DataControlField In value MyGridView.Columns.Add(c) Next End Set End Property ... End Class C# public partial class MyControl : UserControl {         [System.Web.UI.IDReferenceProperty(typeof(DataControlFieldCollection))]     public DataControlFieldCollection Columns {         get { return MyGridView.Columns; }         set {             MyGridView.Columns.Clear();             foreach (DataControlField c in value) {                 MyGridView.Columns.Add(c);             }         }     } ... } EDIT: Actually it does work, but auto complete does not work between the uc:MyControl opening and closing tags and I get compiler warnings:- Content is not allowed between the opening and closing tags for element 'MyControl'. Validation (XHTML 1.0 Transitional): Element 'columns' is not supported. Element 'BoundField' is not a known element. This can occur if there is a compilation error in the Web site, or the web.config file is missing. So I guess I need to use some sort of directive to tell the complier to expect content between the tags. Any ideas?

    Read the article

  • Generic allocator class without variadic templates?

    - by rainer
    I am trying to write a generic allocator class that does not really release an object's memory when it is free()'d but holds it in a queue and returns a previously allocated object if a new one is requested. Now, what I can't wrap my head around is how to pass arguments to the object's constructor when using my allocator (at least without resorting to variadic templates, that is). The alloc() function i came up with looks like this: template <typename... T> inline T *alloc(const &T... args) { T *p; if (_free.empty()) { p = new T(args...); } else { p = _free.front(); _free.pop(); // to call the ctor of T, we need to first call its DTor p->~T(); p = new( p ) T(args...); } return p; } Still, I need the code to be compatible with today's C++ (and older versions of GCC that do not support variadic templates). Is there any other way to go about passing an arbitrary amount of arguments to the objects constructor?

    Read the article

  • WPF Designer has bug with parsing generic control with overrided property

    - by Ivan Laktyunkin
    I've created a generic lookless control with virtual property: public abstract class TestControlBase<TValue> : Control { public static readonly DependencyProperty ValueProperty; static TestControlBase() { ValueProperty = DependencyProperty.Register("Value", typeof(TValue), typeof(TestControlBase<TValue>)); } protected TestControlBase() { Focusable = false; Value = default(TValue); } public virtual TValue Value { get { return (TValue)GetValue(ValueProperty); } set { SetValue(ValueProperty, value); } } } Then I've made a control derived from it and overrided Value property: public class TestControl : TestControlBase<int> { public override int Value { get { return base.Value; } set { base.Value = value; } } } So I use it in a Window XAML: <TestControls:TestControl /> When I open window in designer all is OK, but when I put mouse cursor to this line, or to this control in designer I receive exception: Exception has been thrown by the target of an invocation. at System.RuntimeMethodHandle._InvokeMethodFast(Object target, Object[] arguments, SignatureStruct& sig, MethodAttributes methodAttributes, RuntimeTypeHandle typeOwner) at System.RuntimeMethodHandle.InvokeMethodFast(Object target, Object[] arguments, Signature sig, MethodAttributes methodAttributes, RuntimeTypeHandle typeOwner) at System.Reflection.RuntimeMethodInfo.Invoke(Object obj, BindingFlags invokeAttr, Binder binder, Object[] parameters, CultureInfo culture, Boolean skipVisibilityChecks) at System.Delegate.DynamicInvokeImpl(Object[] args) at System.Windows.Threading.ExceptionWrapper.InternalRealCall(Delegate callback, Object args, Boolean isSingleParameter) at System.Windows.Threading.ExceptionWrapper.TryCatchWhen(Object source, Delegate callback, Object args, Boolean isSingleParameter, Delegate catchHandler) Ambiguous match found. at System.RuntimeType.GetPropertyImpl(String name, BindingFlags bindingAttr, Binder binder, Type returnType, Type[] types, ParameterModifier[] modifiers) at System.Type.GetProperty(String name) at MS.Internal.ComponentModel.DependencyPropertyKind.get_IsDirect() at MS.Internal.ComponentModel.DependencyPropertyKind.get_IsAttached() at MS.Internal.ComponentModel.APCustomTypeDescriptor.GetProperties(Attribute[] attributes) at MS.Internal.ComponentModel.APCustomTypeDescriptor.GetProperties() at System.ComponentModel.TypeDescriptor.TypeDescriptionNode.DefaultExtendedTypeDescriptor.System.ComponentModel.ICustomTypeDescriptor.GetProperties() at System.ComponentModel.TypeDescriptor.GetPropertiesImpl(Object component, Attribute[] attributes, Boolean noCustomTypeDesc, Boolean noAttributes) at System.ComponentModel.TypeDescriptor.GetProperties(Object component) at MS.Internal.Model.ModelPropertyCollectionImpl.GetProperties(String propertyNameHint) at MS.Internal.Model.ModelPropertyCollectionImpl.<GetEnumerator>d__0.MoveNext() at MS.Internal.Designer.PropertyEditing.Model.ModelPropertyMerger.<GetFirstProperties>d__0.MoveNext() at MS.Internal.Designer.PropertyEditing.PropertyInspector.UpdateCategories(Selection selection) at MS.Internal.Designer.PropertyEditing.PropertyInspector.OnSelectionChangedIdle() Who know this problem? Please explain :) I have no ideas except that WPF Designer doesn't like generics. If I replace generics by Object all is OK.

    Read the article

  • How to pull one commit at a time from a remote git repository?

    - by Norman Ramsey
    I'm trying to set up a darcs mirror of a git repository. I have something that works OK, but there's a significant problem: if I push a whole bunch of commits to the git repo, those commits get merged into a single darcs patchset. I really want to make sure each git commit gets set up as a single darcs patchset. I bet this is possible by doing some kind of git fetch followed by interrogation of the local copy of the remote branch, but my git fu is not up to the job. Here's the (ksh) code I'm using now, more or less: git pull -v # pulls all the commits from remote --- bad! # gets information about only the last commit pulled -- bad! author="$(git log HEAD^..HEAD --pretty=format:"%an <%ae>")" logfile=$(mktemp) git log HEAD^..HEAD --pretty=format:"%s%n%b%n" > $logfile # add all new files to darcs and record a patchset. this part is OK darcs add -q --umask=0002 -r . darcs record -a -A "$author" --logfile="$logfile" darcs push -a rm -f $logfile My idea is Try git fetch to get local copy of the remote branch (not sure exactly what arguments are needed) Somehow interrogate the local copy to get a hash for every commit since the last mirroring operation (I have no idea how to do this) Loop through all the hashes, pulling just that commit and recording the associated patchset (I'm pretty sure I know how to do this if I get my hands on the hash) I'd welcome either help fleshing out the scenario above or suggestions about something else I should try. Ideas?

    Read the article

  • What is the correct way to create dynamic javascript in ASP.net MVC2?

    - by sabbour
    I'm creating a Google Maps partial view/user control in my project that is passed a strongly typed list of objects containing latitude and longitude values. Currently, this is the code I have for the partial: <%@ Control Language="C#" Inherits="System.Web.Mvc.ViewUserControl<IEnumerable<Project.Models.Entities.Location>>" %> <!-- Place for google to put the map --> <div id="report_map_canvas" style="width: 100%; height: 728px; margin-bottom: 2px;"> </div> <script type='text/javascript'> google.load("maps", "2"); $(document).ready(initializeMap); function initializeMap() { if (GBrowserIsCompatible()) { var map = new GMap2(document.getElementById('report_map_canvas')); map.setCenter(new GLatLng(51.5, -0.1167), 2); <% foreach (var item in Model) { %> map.addOverlay(new GMarker(new GLatLng('<%= Html.Encode(item.latitude)%>','<%= Html.Encode(item.longitude)%>'),{ title: '<%= Html.Encode(String.Format("{0:F}",item.speed)) %> km/h '})); <% } %> map.setUIToDefault(); } } </script> Is it right to dynamically create the javascript file this way by looping over the list and emitting javascript? Is there a better way to do it?

    Read the article

  • Execute multiple command lines with the same process using C#

    - by rima
    Hi according to my last question here I try to write a sql Editor or some thing like this,in this way I try to connect to CMD from C# and execute my command. now my problem is for example I connect to SQLPLUS after that I cant get SQLPLUS command,and the other resource I review don't satisfy me.Please help me how after I connected to Sqlplus ,I can a live my process to run my sql command? right now I use this code: //Create process System.Diagnostics.Process pProcess = new System.Diagnostics.Process(); //strCommand is path and file name of command to run pProcess.StartInfo.FileName = strCommand; //strCommandParameters are parameters to pass to program pProcess.StartInfo.Arguments = strCommandParameters; pProcess.StartInfo.UseShellExecute = false; //Set output of program to be written to process output stream pProcess.StartInfo.RedirectStandardOutput = true; //Optional pProcess.StartInfo.WorkingDirectory = strWorkingDirectory; //Start the process pProcess.Start(); //Get program output string strOutput = pProcess.StandardOutput.ReadToEnd(); //Wait for process to finish pProcess.WaitForExit(); but i customize it.I separate the initialize, i mean i just create process object one time,but I still have problem. to run the second command I use these codes for second time calling: pProcess.StartInfo.FileName = strCommand; //strCommandParameters are parameters to pass to program pProcess.StartInfo.Arguments = strCommandParameters; //Start the process pProcess.Start(); //Get program output string strOutput = pProcess.StandardOutput.ReadToEnd(); //Wait for process to finish pProcess.WaitForExit(); Thanks in advance

    Read the article

  • Using MD5 to generate an encryption key from password?

    - by Charles
    I'm writing a simple program for file encryption. Mostly as an academic exercise but possibly for future serious use. All of the heavy lifting is done with third-party libraries, but putting the pieces together in a secure manner is still quite a challenge for the non-cryptographer. Basically, I've got just about everything working the way I think it should. I'm using 128-bit AES for the encryption with a 128-bit key length. I want users to be able to enter in variable-length passwords, so I decided to hash the password with MD5 and then use the hash as the key. I figured this was acceptable--the key is always supposed to be a secret, so there's no reason to worry about collision attacks. Now that I've implemented this, I ran across a couple articles indicating that this is a bad idea. My question is: why? If a good password is chosen, the cipher is supposed to be strong enough on its own to never reveal the key except via an extraordinary (read: currently infeasible) brute-force effort, right? Should I be using something like PBKDF2 to generate the key or is that just overkill for all but the most extreme cryptographic applications?

    Read the article

  • #indent "off" in F#

    - by anta40
    I just started learning F#, and tried a code from the wiki: I prefer tabs to spaces, so I change the code a bit into this: #indent "off" open System open System.Windows.Forms let form = new Form(Visible=true, TopMost=true, Text="Welcome to F#") let label = let temp = new Label() let x = 3 + (4 * 5) temp.Text <- sprintf "x = %d" x temp form.Controls.Add(label) [<STAThread>] Application.Run(form) The output is: Microsoft (R) F# 2.0 Compiler build 4.0.30319.1 Copyright (c) Microsoft Corporation. All Rights Reserved. fstest2.fs(1,1): warning FS0062: This construct is for ML compatibility. Conside r using a file with extension '.ml' or '.mli' instead. You can disable this warn ing by using '--mlcompatibility' or '--nowarn:62'. fstest2.fs(9,2): error FS0010: Unexpected keyword 'let' or 'use' in expression. Expected 'in' or other token. fstest2.fs(13,1): error FS0597: Successive arguments should be separated by spac es or tupled, and arguments involving function or method applications should be parenthesized fstest2.fs(9,14): error FS0374: Invalid expression on left of assignment fstest2.fs(16,1): error FS0010: Unexpected identifier in definition Guess the error is somewhere in the let label block, but couldn't figure it out.

    Read the article

  • LINQ Datacontext Disposal Issues

    - by Refracted Paladin
    I am getting a Cannot access object: DataContext after it's been disposed in the below DAL method. I thought that I would be okay calling dispose there. result is an IEnumurable and I thought it was IQueryable that caused these kinds of problems. What am I doing wrong? How SHOULD I be disposing of my DataContext. Is there something better to be returning then a DataTable? This is a Desktop app that points at SQL 2005. Example method that causes this error -- public static DataTable GetEnrolledMembers(Guid workerID) { var DB = CmoDataContext.Create(); var AllEnrollees = from enrollment in DB.tblCMOEnrollments where enrollment.CMOSocialWorkerID == workerID || enrollment.CMONurseID == workerID join supportWorker in DB.tblSupportWorkers on enrollment.EconomicSupportWorkerID equals supportWorker.SupportWorkerID into workerGroup from worker in workerGroup.DefaultIfEmpty() select new { enrollment.ClientID, enrollment.CMONurseID, enrollment.CMOSocialWorkerID, enrollment.EnrollmentDate, enrollment.DisenrollmentDate, ESFirstName = worker.FirstName, ESLastName = worker.LastName, ESPhone = worker.Phone }; var result = from enrollee in AllEnrollees.AsEnumerable() where (enrollee.DisenrollmentDate == null || enrollee.DisenrollmentDate > DateTime.Now) //let memberName = BLLConnect.MemberName(enrollee.ClientID) let lastName = BLLConnect.MemberLastName(enrollee.ClientID) let firstName = BLLConnect.MemberFirstName(enrollee.ClientID) orderby enrollee.DisenrollmentDate ascending, lastName ascending select new { enrollee.ClientID, //MemberName = memberName, LastName = lastName, FirstName = firstName, NurseName = BLLAspnetdb.NurseName(enrollee.CMONurseID), SocialWorkerName = BLLAspnetdb.SocialWorkerName(enrollee.CMOSocialWorkerID), enrollee.EnrollmentDate, enrollee.DisenrollmentDate, ESWorkerName = enrollee.ESFirstName + " " + enrollee.ESLastName, enrollee.ESPhone }; DB.Dispose(); return result.CopyLinqToDataTable(); } partial class where I create the DataContext -- partial class CmoDataContext { public static bool IsDisconnectedUser { get { return Settings.Default.IsDisconnectedUser; } } public static CmoDataContext Create() { var cs = IsDisconnectedUser ? Settings.Default.CMOConnectionString : Settings.Default.Central_CMOConnectionString; return new CmoDataContext(cs); }

    Read the article

  • Windows Media Encoder object not created in ASP.NET on MS Server 2003 64 bit

    - by Ron
    Hello, I created (and used) a Windows Media Encoder object in Microsoft Visual C# 2008 Express Edition on MS Server 2003 64 bit. This worked fine. However, when I attempted to create the equivalent Windows Media Encoder object using Microsoft Visual Web Developer 2008 on MS Server 2003 64 bit, the following exception was thrown: "Retrieving the COM class factory for component with CLSID {632B606A-BBC6-11D2-A329-006097C4E476} failed due to the following error: 80040154." It cannot be that the component isn’t registered, because both have a reference to the same WMEncEng.dll file. The Microsoft Visual Web Developer 2008 code also worked fine on XP 32 bit. Could it be a problem with permissions? Regardless, anyone have any ideas why this problem is occurring and, more importantly, how to resolve it? Thank you. Here are the two code snippets from MS Server 2003 64 bit: Microsoft Visual Web Developer 2008 (did not work): using System; using WMEncoderLib; namespace TestWMEnc { public partial class _Default : System.Web.UI.Page { protected void Page_Load(object sender, EventArgs e) { try { WMEncoder encoder = new WMEncoder(); //exception thrown // ... } catch (Exception err) { string exception = err.Message; } } } } Microsoft Visual C# 2008 Express Edition (worked fine): using System; using System.Windows.Forms; using WMEncoderLib; namespace testWMEncoder { public partial class Form1 : Form { public Form1() { InitializeComponent(); } private void button1_Click(object sender, EventArgs e) { try { WMEncoder encoder = new WMEncoder(); // ... } catch (Exception err) { string exception = err.Message; } } } }

    Read the article

  • Using of Templated Helpers in MVC 2.0 : How can use the name of the property that I'm rendering insi

    - by Andrey Tagaew
    Hi. I'm reviewing new features of ASP.NET MVC 2.0. During the review i found really interesting using Templated Helpers. As they described it, the primary reason of using them is to provide common way of how some datatypes should be rendered. Now i want to use this way in my project for DateTime datatype My project was written for the MVC 1.0 so generating of editbox is looking like this: <%= Html.TextBox("BirthDate", Model.BirthDate, new { maxlength = 10, size = 10, @class = "BirthDate-date" })%> <script type="text/javascript"> $(document).ready(function() { $(".BirthDate-date").datepicker({ showOn: 'button', buttonImage: '<%=Url.Content("~/images/i_calendar.gif") %>', buttonImageOnly: true }); }); </script> Now i want to use Template Helper, so i want to have above code once i type next sentence: <%=Html.EditorFor(f=>f.BirthDate) %> According to the manual I create DataTime.ascx partial view inside Shared/EditorTemplates folder. I put there above code and stacked with the problem. How can i pass the name of the property that I'm rendering with template helper? As you can see from my example, i really need it, since I'm using the name of the property to specify data value and parameter name that will be send during the POST requsest. Also, I'm using it to generate class name for JS calendar building. I tried to remove my partial class for template helper and made MVC to generate its default behavior. Here what it generated for me: <input type="text" value="04/29/2010" name="LoanApplicationDays" id="LoanApplicationDays" class="text-box single-line"> As you can see, it used the name of the property for "name" and "id" attributes. This example let me to presume that Template Helper knows about the name of the property. So, there should be some way of how to use it in custom implementation. Thanks for your help!

    Read the article

  • How to include a child object's child object in Entity Framework 5

    - by Brendan Vogt
    I am using Entity Framework 5 code first and ASP.NET MVC 3. I am struggling to get a child object's child object to populate. Below are my classes.. Application class; public class Application { // Partial list of properties public virtual ICollection<Child> Children { get; set; } } Child class: public class Child { // Partial list of properties public int ChildRelationshipTypeId { get; set; } public virtual ChildRelationshipType ChildRelationshipType { get; set; } } ChildRelationshipType class: public class ChildRelationshipType { public int Id { get; set; } public string Name { get; set; } } Part of GetAll method in the repository to return all the applications: return DatabaseContext.Applications .Include("Children"); The Child class contains a reference to the ChildRelationshipType class. To work with an application's children I would have something like this: foreach (Child child in application.Children) { string childName = child.ChildRelationshipType.Name; } I get an error here that the object context is already closed. How do I specify that each child object must include the ChildRelationshipType object like what I did above?

    Read the article

  • Matlab and .net problem with character string function input

    - by Peter
    I have a MATLAB function that I've compiled into a .net library. The function is a simple one that takes a character array as an input and a numeric array as output: function insert = money(dateLimit) .. insert = [1 2]; The function works fine when no function arguments are specified (a default argument is provided inside the function) Dim sf As New SpreadFinder.SpreadFinder Dim output = sf.money() As soon as an argument is specified .net complains. I'm thinking this should be easy and has been done before but searching through MATLAB documentation doesn't offer much help. Here's what I've tried. The sf.money() overload for the function with arguments is (numArgsOut as Integer, argsOut as MWArray, argsIn as MWArray) and hence that's what I've tried. What am I missing? Dim sf As New SpreadFinder.SpreadFinder Dim inputArgs(1) As Arrays.MWCharArray Dim dateLimitString As String = "some string" inputArgs(0) = New Arrays.MWCharArray(dateLimitString) Dim outputArgs(1) As Arrays.MWNumericArray outputArgs(0) = New Arrays.MWNumericArray() sf.money(1, outputArgs, inputArgs) Gives System.NullReferenceException : Object reference not set to an instance of an object. at MathWorks.MATLAB.NET.Utility.MWMCR.EvaluateFunction(String functionName, Int32 numArgsOut, Int32 numArgsIn, MWArray[] argsIn) at MathWorks.MATLAB.NET.Utility.MWMCR.EvaluateFunction(String functionName, Int32 numArgsOut, MWArray[]& argsOut, MWArray[] argsIn) at SpreadFinder.SpreadFinder.money(Int32 numArgsOut, MWArray[]& argsOut, MWArray[] argsIn)

    Read the article

  • Using MinHash to find similiarities between 2 images

    - by Sung Meister
    I am using MinHash algorithm to find similar images between images. I have run across this post, How can I recognize slightly modified images? which pointed me to MinHash algorithm. Being a bit mathematically challenged, I was using a C# implementation from this blog post, Set Similarity and Min Hash. But while trying to use the implementation, I have run into 2 problems. What value should I set universe value to? When passing image byte array to HashSet, it only contains distinct byte values; thus comparing values from 1 ~ 256. What is this universe in MinHash? And what can I do to improve the C# MinHash implementation? Since HashSet<byte> contains values upto 256, similarity value always come out to 1. Here is the source that uses the C# MinHash implementation from Set Similarity and Min Hash: class Program { static void Main(string[] args) { var imageSet1 = GetImageByte(@".\Images\01.JPG"); var imageSet2 = GetImageByte(@".\Images\02.TIF"); //var app = new MinHash(256); var app = new MinHash(Math.Min(imageSet1.Count, imageSet2.Count)); double imageSimilarity = app.Similarity(imageSet1, imageSet2); Console.WriteLine("similarity = {0}", imageSimilarity); } private static HashSet<byte> GetImageByte(string imagePath) { using (var fs = new FileStream(imagePath, FileMode.Open, FileAccess.Read)) using (var br = new BinaryReader(fs)) { //List<int> bytes = br.ReadBytes((int)fs.Length).Cast<int>().ToList(); var bytes = new List<byte>(br.ReadBytes((int) fs.Length).ToArray()); return new HashSet<byte>(bytes); } } }

    Read the article

  • Initialize webservice WSDL at runtime using Flex and Mate framework

    - by GroovyB
    I am developing a Flex application on top of Mate framework. In this application, I am using a webservice to retrieve data. As this webservice as not a fix location URL (depending on where customers installed it), I define this URL in a config file. When the Flex application starts, it first reads this config file, then I would like to use the value I found to initialize the webservice. But currently, I have no idea how to this. Here is my EventMap.mxml <EventMap> <services:Services id="services" /> <EventHandlers type="{FlexEvent.PREINITIALIZE}"> <HTTPServiceInvoker instance="{services.configService}"> <resultHandlers> <MethodInvoker generator="{ConfigManager}" method="loadFromXml" arguments="{resultObject}" /> </resultHandlers> <faultHandlers> <InlineInvoker method="Alert.show" arguments="ERROR: Unable to load config.xml !" /> </faultHandlers> </HTTPServiceInvoker> In this part, the ConfigManager parse the config file and intitialize a bindable property called webServiceWsdl Here is my Services.mxml <mx:Object> <mx:Script> <![CDATA[ [Bindable] public var webservice:String; ]]> </mx:Script> <mx:HTTPService id="configService" url="config.xml" useProxy="false" /> <mx:WebService id="dataService" wsdl="{webservice}" useProxy="false"/> </mx:Object> How can I initialize this webservice property ?

    Read the article

  • Can't disable method parenthesis auto-complete in Eclipse

    - by cvig
    I'm trying to disable the automatic closing of brackets in Eclipse, and while I've mostly succeeded, I can't stop the editor from inserting a closing parenthesis for a method call. The result is that when I type: myBool.equals(true); it inserts a closing parenthesis as soon as I type the opening parenthesis, and what I actually get is: myBool.equals(true);) I've disabled all of the auto-complete options in the Preferences - Java - Editor - Typing menu, as well as Preferences - Java - Editor - Content Assist - Fill method arguments and show guessed arguments. I also disabled the smart insert mode option under the Edit menu. Is there another option somewhere else I need to use to stop Eclipse from doing this? This is with Eclipse 3.5.2 (Build ID M20100211-1343) in case it matters. Edited to add: I should also mention that this only happens if I wait for the "intellisense" pop-up with suggested method names to appear after I type the period. If I just continuously type the code without waiting for the suggestion box to appear, the closing parenthesis doesn't get inserted.

    Read the article

  • Binding UpdateSourceTrigger=Explicit, updates source at program startup

    - by GTD
    I have following code: <Window x:Class="WpfApplication1.Window1" xmlns="http://schemas.microsoft.com/winfx/2006/xaml/presentation" xmlns:x="http://schemas.microsoft.com/winfx/2006/xaml" Title="Window1" Height="300" Width="300"> <Grid> <TextBox Text="{Binding Path=Name, Mode=OneWayToSource, UpdateSourceTrigger=Explicit, FallbackValue=default text}" KeyUp="TextBox_KeyUp" x:Name="textBox1"/> </Grid> public partial class Window1 : Window { public Window1() { InitializeComponent(); } private void TextBox_KeyUp(object sender, KeyEventArgs e) { if (e.Key == Key.Enter) { BindingExpression exp = this.textBox1.GetBindingExpression(TextBox.TextProperty); exp.UpdateSource(); } } } public class ViewModel { public string Name { set { Debug.WriteLine("setting name: " + value); } } } public partial class App : Application { protected override void OnStartup(StartupEventArgs e) { base.OnStartup(e); Window1 window = new Window1(); window.DataContext = new ViewModel(); window.Show(); } } I want to update source only when "Enter" key is pressed in textbox. This works fine. However binding updates source at program startup. How can I avoid this? Am I missing something?

    Read the article

  • How to pass filename to StandardInput (Process) in C#?

    - by Cosmo
    Hello Guys! I'm using the native windows application spamc.exe (SpamAssassin - sawin32) from command line as follows: C:\SpamAssassin\spamc.exe -R < C:\email.eml Now I'd like to call this process from C#: Process p = new Process(); p.StartInfo.UseShellExecute = false; p.StartInfo.RedirectStandardOutput = true; p.StartInfo.RedirectStandardInput = true; p.StartInfo.FileName = @"C:\SpamAssassin\spamc.exe"; p.StartInfo.Arguments = @"-R"; p.Start(); p.StandardInput.Write(@"C:\email.eml"); p.StandardInput.Close(); Console.Write(p.StandardOutput.ReadToEnd()); p.WaitForExit(); p.Close(); The above code just passes the filename as string to spamc.exe (not the content of the file). However, this one works: Process p = new Process(); p.StartInfo.UseShellExecute = false; p.StartInfo.RedirectStandardOutput = true; p.StartInfo.RedirectStandardInput = true; p.StartInfo.FileName = @"C:\SpamAssassin\spamc.exe"; p.StartInfo.Arguments = @"-R"; p.Start(); StreamReader sr = new StreamReader(@"C:\email.eml"); string msg = sr.ReadToEnd(); sr.Close(); p.StandardInput.Write(msg); p.StandardInput.Close(); Console.Write(p.StandardOutput.ReadToEnd()); p.WaitForExit(); p.Close(); Could someone point me out why it's working if I read the file and pass the content to spamc, but doesn't work if I just pass the filename as I'd do in windows command line?

    Read the article

< Previous Page | 120 121 122 123 124 125 126 127 128 129 130 131  | Next Page >