Search Results

Search found 70774 results on 2831 pages for 'problem domains'.

Page 1260/2831 | < Previous Page | 1256 1257 1258 1259 1260 1261 1262 1263 1264 1265 1266 1267  | Next Page >

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • Prove that the set of regular languages is a proper subset of the set of the context-free languages

    - by David Relihan
    I was brushing up (not homework)on some computation-theory and came accross this problem: How can you prove that the set of regular languages is a proper subset of the set of the context-free languages. Now I know a language is regular iff it is accepted by a finite automaton. And I know a language is context-free iff it is accepted by a pushdown automaton. But I'm not sure of what solution is.

    Read the article

  • Java - How to force resize JCheckBox to prevent clicking the empty space ?

    - by Brad
    When i create a JCheckBox in my Swing application i leave some extra space after its label, so if the JCheckBox label is for example 100 pixels width, i make the JCheckBox 120 pixels for safety. The problem as at runtime, it's not nice that a user can click on the empty space after the JCheckBox label and it can be actually clicked, like this : I wonder if there is a way to resize the JCheckBox at runtime to exactly fit the text inside it, depending on the font type/size used ? This seems fancy a bit, but i like to make things look perfect :)

    Read the article

  • How to get ROI of an image in Android

    - by uday
    Hi All, I have an image file (.jpg) which contains image like Face. From my application i want to capture that particular Face part and copy that part into a new bitmap file. I have a rectangular co-ordinates of that Face part, so how do i capture only Face part from the image file and copy that into a bitmap file?? Could any body help me to get rid of this problem.... Thanks & Regards Uday Kiran

    Read the article

  • problems with cut (unix)

    - by lego69
    hello everybody, I've got strange problem with cut I wrote script, there I have row: ... | cut -d" " -f3,4 >! out cut recieves this data (I checked it with echo) James James 033333333 0 0.00 but I recieve empty lines in out, can somebody explain why?

    Read the article

  • How to resolve “Unit JclCompression was compiled with a different version of sevenzip.IOutArchive”?

    - by John
    Hello, There is already a similar question(link).The thing is I don't understand what unit I have to delete. I have installed the latest JCL library and added 'JclCompression' to the uses list in a unit and I get the error: "Unit JclCompression was compiled with a different version of sevenzip.IOutArchive". Please explain to me in a simpler way how to resolve the problem. Thanks in advance!

    Read the article

  • Exporting classes containing std:: objects (vector, map, etc) from a dll

    - by RnR
    I'm trying to export classes from a DLL that contain objects such as std::vectors and std::stings - the whole class is declared as dll export through: class DLL_EXPORT FontManager { The problem is that for members of the complex types I get this warning: warning C4251: 'FontManager::m__fonts' : class 'std::map<_Kty,_Ty' needs to have dll-interface to be used by clients of class 'FontManager' with [ _Kty=std::string, _Ty=tFontInfoRef ] I'm able to remove some of the warnings by putting the following forward class declaration before them even though I'm not changing the type of the member variables themselves: template class DLL_EXPORT std::allocator<tCharGlyphProviderRef>; template class DLL_EXPORT std::vector<tCharGlyphProviderRef,std::allocator<tCharGlyphProviderRef> >; std::vector<tCharGlyphProviderRef> m_glyphProviders; Looks like the forward declaration "injects" the DLL_EXPORT for when the member is compiled but is it safe? Does it realy change anything when the client compiles this header and uses the std container on his side? Will it make all future uses of such a container DLL_EXPORT (and possibly not inline?)? And does it really solve the problem that the warning tries to warn about? Is this warning anything I should be worried about or would it be best to disable it in the scope of these constructs? The clients and the dll will always be built using the same set of libraries and compilers and those are header only classes... I'm using Visual Studio 2003 with the standard STD library. ---- Update ---- I'd like to target you more though as I see the answers are general and here we're talking about std containers and types (such as std::string) - maybe the question really is: Can we disable the warning for standard containers and types available to both the client and the dll through the same library headers and treat them just as we'd treat an int or any other built-in type? (It does seem to work correctly on my side.) If so would should be the conditions under which we can do this? Or should maybe using such containers be prohibited or at least ultra care taken to make sure no assignment operators, copy constructors etc will get inlined into the dll client? In general I'd like to know if you feel designing a dll interface having such objects (and for example using them to return stuff to the client as return value types) is a good idea or not and why - I'd like to have a "high level" interface to this functionality... maybe the best solution is what Neil Butterworth suggested - creating a static library?

    Read the article

  • Redirect question using mod_rewrite (no extensions - root of site)

    - by alex
    Hi, I'm having a small problem with mod_rewrite I have the following in my .htacces: Options +FollowSymlinks RewriteEngine on RewriteRule ^(.+)\.htm$ index.php?name=$1 [NC] This is my index.php file: <?php echo $_GET['name]; ?> This works great for the following url: www.mySite.com/this is an example.htm this would display "this is an example" What i'm trying to do however, is get it to do the same, without the .htm extension: for example: www.mySite.com/this is an example Any ideas? (dont think it's relevant but i'm using xampp to test this)

    Read the article

  • adjustment of footer in website

    - by Mayur
    Hi All, I m web designer and getting problem in adjustment of footer. I need footer should be fixed at specific height and it will get down if content incresed otherwise it will be at same position please help me .... Thanks Mayur

    Read the article

  • Get invalid user input with a Spring typeMismatch error

    - by TimmyJ
    I've implemented a ReloadableResourceBundleMessageSource in my Spring MVC application which I use to display prettier error messages for binding exceptions. The problem I'm having is that, due to a company policy, these errors must be displayed in the following format: [inputData] is not a valid [fieldName]. The field name is accessible by default in my message properties file (as the {0} argument), but I can't figure out a way to display the invalid user input. Is this possible?

    Read the article

  • CSS: Stopping div pushing content

    - by Melt
    Hi all, I'm trying to implement a CSS menu and am having a problem with the menu pushing the other content/divs down when the menu expands. http://bit.ly/bAcS56 Can anyone tell me what CSS I need to stop the main body content being pushed when the menu expands? Thanks

    Read the article

  • Data-annotation getting errormessage out database

    - by Masna
    Hello, With asp.net mvc you can use the annotation [Required (errormessage="This is required")] How can I create something like this: [Required (errormessage="ERRORXX")] So I can look up in a database what this ERRORXX is and display it on my form. Now my form displays ERRORXX. How can I create something that solves my problem? Thx!

    Read the article

  • Where are global settings stored?

    - by Philipp
    Hi, sometimes after logging out and in again, my settings in Tools/Options/Projects and Solutions/VC++ Directories are lost. To investigate the problem I tried to find the file where Visual Studio (2008 Team) stores those settings on disk. (Or is it in the registry?) Can anybody point me to where it is? Thanks a lot!

    Read the article

  • Any picture Gallery Control for .NET 1.1 in WinForms?

    - by Romias
    I need a UserControl to display pictures as a Gallery in Winforms. I have my pictures as a Image Collection but no problem to change to fit Control capabilities. It could be nice if it is for .NET 1.1 but since I'm planning to migrate all our code to 2.0 if the control is in that framework it could be useful in the future If it is free much better :) Does any of you know a control like this? Thanks!

    Read the article

  • Redirecting using 301 rule in .htaccess

    - by user220755
    I am having a problem with redirecting a page from example.com (to) www.example.com The code I have is: RewriteEngine on RewriteCond %{HTTP_HOST} ^subdomain\.domain\.com$ [NC] RewriteRule ^(.*)$ http://www.subdomain.domain.com/$1 [L,R=301] And it is not working, any help?

    Read the article

  • Python: Is there a way to reflectivly list all attributes of a class

    - by hhafez
    Given a class such as def MyClass text = "hello" number = 123 Is there a way in python to inspect MyClass an determine that it has the two attributes text and number. I can not use something like inspect.getSource(object) because the class I am to get it's attributes for are generate using SWIG (so they are hidden in .so :) ). So I am really looking for something equivalant to Java's [Class.getDeclardFields][1] Any help would be appreciated, otherwise I'll have to solve this problem with SWIG + JAVA instead of SWIG + Python.

    Read the article

  • ABSMIDDLE works differently on firefox and chrome?

    - by Axel
    Hi, i have an icon image and text like the following, the code source of everything is : <img src="...." align="absmiddle" /> My Title Here The problem is that the icon is not aligned vertically with the title in chrome better than firefox. I think the absmiddle doesn't work at all ! is there any solution, i don't want to use a table with 2 columns to fix this issue. Thanks

    Read the article

  • Partial views in asp.net mvc

    - by Renu123
    i am using partial view for my project but my problem is that my links are on right side of masterpage and when i clicked on particular link the view should displayed on left side on contentplace holder of master page. but right now its showing exactly below so my whole disgne is distrubed. so please if anyone know the solution tell me. thanks

    Read the article

  • How can you tell if an activities state is stored?

    - by Joren
    I have an activity which pulls some JSON from my server, and then uses it to draw a list. That list launches further activities. My problem is that I can't figure out a way to tell if the activity is still alive when you go back to it, so I end up re-querying my JSON from the server and redrawing the list every time the user goes back to the activity. How can I tell if my activity is still alive so I can skip the redraw?

    Read the article

  • Upside down question mark issue

    - by Madhumita
    We have a very strange problem in out application, all of a sudden we started noticing upside down question marks being saved along with other text typed in to the fields on the screen. These upside down question marks were not originally entered by the users and it is unclear where they come from. We are using Oracle 10g with java. And this is happening, even when no data is copied from Microsoft Word

    Read the article

  • UNIX pipes on C block on read

    - by Toni Cárdenas
    I'm struggling to implement a shell with pipelines for class. typedef struct { char** cmd; int in[2]; int out[2]; } cmdio; cmdio cmds[MAX_PIPE + 1]; Commands in the pipeline are read and stored in cmds. cmdio[i].in is the pair of file descriptors of the input pipe returned by pipe(). For the first command, which reads from terminal input, it is just {fileno(stdin), -1}. cmdin[i].outis similar for the output pipe/terminal output. cmdio[i].in is the same as cmd[i-1].out. For example: $ ls -l | sort | wc CMD: ls -l IN: 0 -1 OUT: 3 4 CMD: sort IN: 3 4 OUT: 5 6 CMD: wc IN: 5 6 OUT: -1 1 We pass each command to process_command, which does a number of things: for (cmdi = 0; cmds[cmdi].cmd != NULL; cmdi++) { process_command(&cmds[cmdi]); } Now, inside process_command: if (!(pid_fork = fork())) { dup2(cmd->in[0], fileno(stdin)); dup2(cmd->out[1], fileno(stdout)); if (cmd->in[1] >= 0) { if (close(cmd->in[1])) { perror(NULL); } } if (cmd->out[0] >= 0) { if (close(cmd->out[0])) { perror(NULL); } } execvp(cmd->cmd[0], cmd->cmd); exit(-1); } The problem is that reading from the pipe blocks forever: COMMAND $ ls | wc Created pipe, in: 5 out: 6 Foreground pid: 9042, command: ls, Exited, info: 0 [blocked running read() within wc] If, instead of exchanging the process with execvp, I just do this: if (!(pid_fork = fork())) { dup2(cmd->in[0], fileno(stdin)); dup2(cmd->out[1], fileno(stdout)); if (cmd->in[1] >= 0) { if (close(cmd->in[1])) { perror(NULL); } } if (cmd->out[0] >= 0) { if (close(cmd->out[0])) { perror(NULL); } } char buf[6]; read(fileno(stdin), buf, 5); buf[5] = '\0'; printf("%s\n", buf); exit(0); } It happens to work: COMMAND $ cmd1 | cmd2 | cmd3 | cmd4 | cmd5 Pipe creada, in: 11 out: 12 Pipe creada, in: 13 out: 14 Pipe creada, in: 15 out: 16 Pipe creada, in: 17 out: 18 hola! Foreground pid: 9251, command: cmd1, Exited, info: 0 Foreground pid: 9252, command: cmd2, Exited, info: 0 Foreground pid: 9253, command: cmd3, Exited, info: 0 Foreground pid: 9254, command: cmd4, Exited, info: 0 hola! Foreground pid: 9255, command: cmd5, Exited, info: 0 What could be the problem?

    Read the article

  • Multiple datepicker sucks if same ID

    - by namezero
    hi, here is my problem: then i apply datepicker on dom (by classname) $('.datepick1').datepicker(); $('.datepick2').datepicker(); $('.datepick3').datepicker(); = the three dom have datepicker but, onselect date, it change automatically the first one (datepick1) HELP

    Read the article

< Previous Page | 1256 1257 1258 1259 1260 1261 1262 1263 1264 1265 1266 1267  | Next Page >