Search Results

Search found 330 results on 14 pages for 'hashtable'.

Page 13/14 | < Previous Page | 9 10 11 12 13 14  | Next Page >

  • "ResolveAssemblyReference" task fails and System.BadImageFormatException, but assembly isn't used an

    - by bdwakefield
    I am getting an error about the assembly "C:\Ora10g\bin\Zip.exe". The trouble is this solution does NOT use anything in Oracle at all. I could not find a single reference to 10g anywhere in the project. I inherited this from another person who left our group. He never had this issue. Another member of my team said he got this before but reinstalling the client portion of 10g fixed it. No such luck there. I even tried using WinGrep to search the entire solution folder for "Ora10g" but it wasn't there. Any ideas? I can't build this solution until I can figure out how to get rid of this false reference to Oracle. VS 2005 solution. Contains a couple WinForm apps, a couple class libraries, and a web service. The error occurs in the main class library project. Here is the error message: Error 1 The "ResolveAssemblyReference" task failed unexpectedly. System.BadImageFormatException: Could not load file or assembly 'C:\Ora10g\bin\Zip.exe' or one of its dependencies. The module was expected to contain an assembly manifest. File name: 'C:\Ora10g\bin\Zip.exe' at System.Reflection.AssemblyName.nGetFileInformation(String s) at System.Reflection.AssemblyName.GetAssemblyName(String assemblyFile) at Microsoft.Build.Shared.AssemblyNameExtension.GetAssemblyNameEx(String path) at Microsoft.Build.Tasks.SystemState.GetAssemblyName(String path) at Microsoft.Build.Tasks.Resolver.FileMatchesAssemblyName(AssemblyNameExtension assemblyName, Boolean isPrimaryProjectReference, Boolean wantSpecificVersion, Boolean allowMismatchBetweenFusionNameAndFileName, String pathToCandidateAssembly, ResolutionSearchLocation searchLocation) at Microsoft.Build.Tasks.Resolver.ResolveAsFile(String fullPath, AssemblyNameExtension assemblyName, Boolean isPrimaryProjectReference, Boolean wantSpecificVersion, Boolean allowMismatchBetweenFusionNameAndFileName, ArrayList assembliesConsideredAndRejected) at Microsoft.Build.Tasks.Resolver.ResolveFromDirectory(AssemblyNameExtension assemblyName, Boolean isPrimaryProjectReference, Boolean wantSpecificVersion, String[] executableExtensions, String directory, ArrayList assembliesConsideredAndRejected) at Microsoft.Build.Tasks.AssemblyFoldersResolver.Resolve(AssemblyNameExtension assemblyName, String rawFileNameCandidate, Boolean isPrimaryProjectReference, Boolean wantSpecificVersion, String[] executableExtensions, String hintPath, String assemblyFolderKey, ArrayList assembliesConsideredAndRejected, String& foundPath, Boolean& userRequestedSpecificFile) at Microsoft.Build.Tasks.AssemblyResolution.ResolveReference(IEnumerable`1 jaggedResolvers, AssemblyNameExtension assemblyName, String rawFileNameCandidate, Boolean isPrimaryProjectReference, Boolean wantSpecificVersion, String[] executableExtensions, String hintPath, String assemblyFolderKey, ArrayList assembliesConsideredAndRejected, String& resolvedSearchPath, Boolean& userRequestedSpecificFile) at Microsoft.Build.Tasks.ReferenceTable.ResolveReference(AssemblyNameExtension assemblyName, String rawFileNameCandidate, Reference reference) at Microsoft.Build.Tasks.ReferenceTable.ResolveAssemblyFilenames() at Microsoft.Build.Tasks.ReferenceTable.ComputeClosure() at Microsoft.Build.Tasks.ReferenceTable.ComputeClosure(DependentAssembly[] remappedAssembliesValue, ITaskItem[] referenceAssemblyFiles, ITaskItem[] referenceAssemblyNames, ArrayList exceptions) at Microsoft.Build.Tasks.ResolveAssemblyReference.Execute(FileExists fileExists, DirectoryExists directoryExists, GetDirectories getDirectories, GetAssemblyName getAssemblyName, GetAssemblyMetadata getAssemblyMetadata, GetRegistrySubKeyNames getRegistrySubKeyNames, GetRegistrySubKeyDefaultValue getRegistrySubKeyDefaultValue, GetLastWriteTime getLastWriteTime) at Microsoft.Build.Tasks.ResolveAssemblyReference.Execute() at Microsoft.Build.BuildEngine.TaskEngine.ExecuteTask(ExecutionMode howToExecuteTask, Hashtable projectItemsAvailableToTask, BuildPropertyGroup projectPropertiesAvailableToTask, Boolean& taskClassWasFound) WRN: Assembly binding logging is turned OFF. To enable assembly bind failure logging, set the registry value [HKLM\Software\Microsoft\Fusion!EnableLog] (DWORD) to 1. Note: There is some performance penalty associated with assembly bind failure logging. To turn this feature off, remove the registry value [HKLM\Software\Microsoft\Fusion!EnableLog].

    Read the article

  • A couple questions using fwrite/fread with data structures

    - by Nazgulled
    Hi, I'm using fwrite() and fread() for the first time to write some data structures to disk and I have a couple of questions about best practices and proper ways of doing things. What I'm writing to disk (so I can later read it back) is all user profiles inserted in a Graph structure. Each graph vertex is of the following type: typedef struct sUserProfile { char name[NAME_SZ]; char address[ADDRESS_SZ]; int socialNumber; char password[PASSWORD_SZ]; HashTable *mailbox; short msgCount; } UserProfile; And this is how I'm currently writing all the profiles to disk: void ioWriteNetworkState(SocialNetwork *social) { Vertex *currPtr = social->usersNetwork->vertices; UserProfile *user; FILE *fp = fopen("save/profiles.dat", "w"); if(!fp) { perror("fopen"); exit(EXIT_FAILURE); } fwrite(&(social->usersCount), sizeof(int), 1, fp); while(currPtr) { user = (UserProfile*)currPtr->value; fwrite(&(user->socialNumber), sizeof(int), 1, fp); fwrite(user->name, sizeof(char)*strlen(user->name), 1, fp); fwrite(user->address, sizeof(char)*strlen(user->address), 1, fp); fwrite(user->password, sizeof(char)*strlen(user->password), 1, fp); fwrite(&(user->msgCount), sizeof(short), 1, fp); break; currPtr = currPtr->next; } fclose(fp); } Notes: The first fwrite() you see will write the total user count in the graph so I know how much data I need to read back. The break is there for testing purposes. There's thousands of users and I'm still experimenting with the code. My questions: After reading this I decided to use fwrite() on each element instead of writing the whole structure. I also avoid writing the pointer to to the mailbox as I don't need to save that pointer. So, is this the way to go? Multiple fwrite()'s instead of a global one for the whole structure? Isn't that slower? How do I read back this content? I know I have to use fread() but I don't know the size of the strings, cause I used strlen() to write them. I could write the output of strlen() before writing the string, but is there any better way without extra writes?

    Read the article

  • How to add an XML parameter to a stored procedure in C#?

    - by salvationishere
    I am developing a C# web application in VS 2008 which interacts with my Adventureworks database in my SQL Server 2008. Now I am trying to add new records to one of the tables which has an XML column in it. How do I do this? This is the error I'm getting: System.Data.SqlClient.SqlException was caught Message="XML Validation: Text node is not allowed at this location, the type was defined with element only content or with simple content. Location: /" Source=".Net SqlClient Data Provider" ErrorCode=-2146232060 Class=16 LineNumber=22 Number=6909 Procedure="AppendDataC" Server="." State=1 StackTrace: at System.Data.SqlClient.SqlConnection.OnError(SqlException exception, Boolean breakConnection) at System.Data.SqlClient.SqlInternalConnection.OnError(SqlException exception, Boolean breakConnection) at System.Data.SqlClient.TdsParser.ThrowExceptionAndWarning(TdsParserStateObject stateObj) at System.Data.SqlClient.TdsParser.Run(RunBehavior runBehavior, SqlCommand cmdHandler, SqlDataReader dataStream, BulkCopySimpleResultSet bulkCopyHandler, TdsParserStateObject stateObj) at System.Data.SqlClient.SqlCommand.FinishExecuteReader(SqlDataReader ds, RunBehavior runBehavior, String resetOptionsString) at System.Data.SqlClient.SqlCommand.RunExecuteReaderTds(CommandBehavior cmdBehavior, RunBehavior runBehavior, Boolean returnStream, Boolean async) at System.Data.SqlClient.SqlCommand.RunExecuteReader(CommandBehavior cmdBehavior, RunBehavior runBehavior, Boolean returnStream, String method, DbAsyncResult result) at System.Data.SqlClient.SqlCommand.InternalExecuteNonQuery(DbAsyncResult result, String methodName, Boolean sendToPipe) at System.Data.SqlClient.SqlCommand.ExecuteNonQuery() at ADONET_namespace.ADONET_methods.AppendDataC(DataRow d, Hashtable ht) in C:\Documents and Settings\Admin\My Documents\Visual Studio 2008\Projects\AddFileToSQL\AddFileToSQL\ADONET methods.cs:line 212 InnerException: And this is a portion of my code in C#: try { SqlConnection conn2 = new SqlConnection(connString); SqlCommand cmd = conn2.CreateCommand(); cmd.CommandText = "dbo.AppendDataC"; cmd.CommandType = CommandType.StoredProcedure; cmd.Connection = conn2; ... sqlParam10.SqlDbType = SqlDbType.VarChar; SqlParameter sqlParam11 = cmd.Parameters.AddWithValue("@" + ht["@col11"], d[10]); sqlParam11.SqlDbType = SqlDbType.VarChar; SqlParameter sqlParam12 = cmd.Parameters.AddWithValue("@" + ht["@col12"], d[11]); sqlParam12.SqlDbType = SqlDbType.Xml; ... conn2.Open(); cmd.ExecuteNonQuery(); //This is the line it fails on and then jumps //to the Catch statement conn2.Close(); errorMsg = "The Person.Contact table was successfully updated!"; } catch (Exception ex) { Right now in my text input MDF file I have the XML parameter as: '<Products><id>3</id><id>6</id><id>15</id></Products>' Is this valid format for XML?

    Read the article

  • PHP: How to process SOAP response to get a tag value?

    - by understack
    I've a SOAP response in a var $soap_response like this: <SOAP-ENV:Envelope SOAP-ENV:encodingStyle="http://schemas.xmlsoap.org/soap/encoding/" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xmlns:xsd="http://www.w3.org/2001/XMLSchema" xmlns:SOAP-ENC="http://schemas.xmlsoap.org/soap/encoding/" xmlns:SOAP-ENV="http://schemas.xmlsoap.org/soap/envelope/" xmlns:clr="http://schemas.microsoft.com/soap/encoding/clr/1.0"> <SOAP-ENV:Header> <h3:__MethodSignature xsi:type="SOAP-ENC:methodSignature" SOAP-ENC:root="1" xmlns:h3="http://schemas.microsoft.com/clr/soap/messageProperties" xmlns:a2="http://schemas.microsoft.com/clr/ns/System.Collections">xsd:string a2:Hashtable</h3:__MethodSignature> </SOAP-ENV:Header> <SOAP-ENV:Body> <i4:ReturnDataSetResponse id="ref-1" xmlns:i4="http://schemas.microsoft.com/clr/nsassem/TOIServerAppl.clsRSchedule/TOIServerAppl"> <return href="#ref-6"/> </i4:ReturnDataSetResponse> <a3:DataSet id="ref-6" xmlns:a3="http://schemas.microsoft.com/clr/nsassem/System.Data/System.Data%2C%20Version%3D1.0.5000.0%2C%20Culture%3Dneutral%2C%20PublicKeyToken%3Db77a5c561934e089"> <XmlSchema id="ref-7"><![CDATA[<?xml version="1.0" encoding="utf-16"?> <xs:schema id="NewDataSet" xmlns="" xmlns:xs="http://www.w3.org/2001/XMLSchema" xmlns:msdata="urn:schemas-microsoft-com:xml-msdata"> <xs:element name="NewDataSet" msdata:IsDataSet="true"> <xs:complexType> <xs:choice maxOccurs="unbounded"> <xs:element name="Table"> <xs:complexType> <xs:sequence> <xs:element name="id" type="xs:long" msdata:targetNamespace="" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> </xs:choice> </xs:complexType> </xs:element> </xs:schema>]]> </XmlSchema> <XmlDiffGram id="ref-8"> <id>4437031</id> </XmlDiffGram> </a3:DataSet> </SOAP-ENV:Body> </SOAP-ENV:Envelope> How can I extract id value from <id>4437031</id>? simplexml_load_string($soap_response); returns empty object array. I've seen someplaces that I might have to replace all those namespaces to make it work?

    Read the article

  • C++ Using a class template argument as a template argument for another type

    - by toefel
    Hey Everyone, I'm having this problem while writing my own HashTable. It all works, but when I try to templatize the thing, it gave me errors. I recreated the problem as follows: THIS CODE WORKS: typedef double Item; class A { public: A() { v.push_back(pair<string, Item>("hey", 5.0)); } void iterate() { for(Iterator iter = v.begin(); iter != v.end(); ++iter) cout << iter->first << ", " << iter->second << endl; } private: vector<pair<string, double> > v; typedef vector< pair<string, double> >::iterator Iterator; }; THIS CODE DOES NOT: template<typename ValueType> class B { public: B(){} void iterate() { for(Iterator iter = v.begin(); iter != v.end(); ++iter) cout << iter->first << ", " << iter->second << endl; } private: vector<pair<string, ValueType> > v; typedef vector< pair<string, ValueType> >::iterator Iterator; }; the error messages: g++ -O0 -g3 -Wall -c -fmessage-length=0 -omain.o ..\main.cpp ..\main.cpp:50: error: type std::vector<std::pair<std::string, ValueType>, std::allocator<std::pair<std::string, ValueType> > >' is not derived from typeB' ..\main.cpp:50: error: ISO C++ forbids declaration of `iterator' with no type ..\main.cpp:50: error: expected `;' before "Iterator" ..\main.cpp: In member function `void B::iterate()': ..\main.cpp:44: error: `Iterator' was not declared in this scope ..\main.cpp:44: error: expected `;' before "iter" ..\main.cpp:44: error: `iter' was not declared in this scope Does anybody know why this is happening? Thanks!

    Read the article

  • What is a proper way to store site-level global variables in a SharePoint site?

    - by ccomet
    One thing that has driven me nuts about SharePoint2007 is the apparent inability to have defineable settings that apply specifically to a site or site collection itself, and not the content. I mean, you have some pre-defined settings like the Site Logo, the Site Name, and various other things, but there doesn't appear to be anywhere to add new kinds of settings. The application I am working on needs to be able to create multiple kinds of "project site collections" that all follow a basic template, but have certain additional settings that apply specifically to that site collection and that one alone. In addition to the standard site name we also need to define the Project Number, the Project Name, and the Client Name. And given the requests of some of our clients, we also reach a point where we have to have configurable settings that alter how some of the workflows work, like whether files are marked with Letters or Numbers. Our current solution, which I'm hesitant about, has been to store an XML file on the SharePoint server. This file contains one node for each site collection, identified by the URL of the root site. Inside the node are all of the elements that need to be defined for that site collection. When we need them, we have to access the XML file (which will always require SPSecurity.RunWithElevatedPrivileges to access files right on the server) every time to load it and retrieve the data. There are a lot of automated processes which will have to do this, and I'm hesitant about the stability of this method when we reach hundreds of sites with thousands of files running tens of thousands of workflows, all wanting to access this file. Maybe they're unfounded worries, but I'd rather worry than risk everything breaking in a couple years. I was looking into the SPWeb object and found the AllProperties hashtable. It looks like just the kind of thing which might work, but I don't know how safe it is to be modifying this. I read through both MSDN and the WSS SDK but found nothing that clarified on adding completely new properties into AllProperties. Is it safe to use AllProperties for this kind of thing? Or is there yet another feature that I am missing, which could handle the concept of global variables at the site collection or site scope?

    Read the article

  • What does these FindBug messages show?

    - by Hans Klock
    Not every description from from http://findbugs.sourceforge.net/bugDescriptions.html is clear to me. Sure, I can study the implementation but if somebody is more experienced then me, some explanation and examples would be great. Do you have some examples for UI_INHERITANCE_UNSAFE_GETRESOURCE when this is getting a problem? In BX_UNBOXED_AND_COERCED_FOR_TERNARY_OPERATOR I don't see the problem either. If one type is "bigger" then the other, for example int and float, then the result is float. If its Integer and Float its the wrapper Float too. That's what I expect. Does the GC_UNRELATED_TYPES really help to find errors? Isn't it the job of the compiler to check, if--taking the given example--Foo can't go into a Collection<String>. Does HE_SIGNATURE_DECLARES_HASHING_OF_UNHASHABLE_CLASS mean something like bla(Foo f){hashtable.put(f);}, where ´Foo´ is not hashable? Does FingBugs "see" the subclasses too? NP_GUARANTEED_DEREF_ON_EXCEPTION_PATH is stronger "wrong" then NP_ALWAYS_NULL_EXCEPTION? Why two error cases and with NP_NULL_ON_SOME_PATH_EXCEPTION even one more? Sounds very similar to me. What is an example of SIO_SUPERFLUOUS_INSTANCEOF? Something like foo(String s){if (s intenceof String) .... This does a null check too, but this is not the test here... NN_NAKED_NOTIFY. I my opinion the description is not clear. A change of the state is not necessary. If I use new Object() to wait and notify on I don't change the object state. Or is state the lock-state? I don't get it. SP_SPIN_ON_FIELD. Can this really happen that a compiler will move this outside from a loop? This doesn't make sense to me because from outside a Thread can always change the values. And if the variable is volatile the JVM can't cache the value. So what's the meaning? That is the difference between STCAL_STATIC_CALENDAR_INSTANCE and STCAL_INVOKE_ON_STATIC_CALENDAR_INSTANCE or STCAL_INVOKE_ON_STATIC_DATE_FORMAT_INSTANCE/STCAL_STATIC_SIMPLE_DATE_FORMAT_INSTANCE? Why is XXXX.class in WL_USING_GETCLASS_RATHER_THAN_CLASS_LITERAL better then getClass()? A getClass() in a superclass called from the subclass will always return the Class object from the subclass which is good I think. What exactly does EQ_UNUSUAL do? It should check that the argument is of the same type of the class itself but it does't? Did you ever had problems with breaks? Is there real value with SF_SWITCH_FALLTHROUGH? Sounds to strong for me. No idea what TQ_EXPLICIT_UNKNOWN_SOURCE_VALUE_REACHES_ALWAYS_SINK and TQ_EXPLICIT_UNKNOWN_SOURCE_VALUE_REACHES_NEVER_SINK could be.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • delphi vs c# post returns different strings - utf problem?

    - by argh
    I'm posting two forms - one in c# and one in delphi. But the result string seems to be different: c# returns: ¤@@1@@@@1@@@@1@@xsm˱Â0Ð... delphi returns: #$1E'@@1@@@@1@@@@1@@x'#$009C... and sice both are compressed streams I'm getting errors while trying to decompress it... The C# is 'correct' - ie. extracts. I'm not an expert on delphi - I just need to convert some piece of code from c# to delphi. c# code: string GetData(Hashtable aParam, string ServerURL) { string Result = ""; WebRequest Request = HttpWebRequest.Create(ServerURL); Request.Method = "POST"; Request.ContentType = "application/x-www-form-urlencoded; charset=UTF-8"; UTF8Encoding encUTF8 = new System.Text.UTF8Encoding(false); StreamWriter writer = new StreamWriter(Request.GetRequestStream(), encUTF8); foreach (DictionaryEntry element in aParam) { writer.Write(element.Key + "=" + element.Value + "&"); } writer.Close(); writer.Dispose(); WebResponse Response = Request.GetResponse(); StreamReader Reader = new StreamReader(Response.GetResponseStream(), System.Text.Encoding.Default); Result = Reader.ReadToEnd(); Reader.Close(); Response.Close(); Reader.Dispose(); return Result; } delphi code: function GetData(aParam:TStringList; ServerURL:string):string; var req: TIdHTTP; res: string; begin req := TIdHTTP.Create(); with req do begin Request.ContentType := 'application/x-www-form-urlencoded; charset=UTF-8'; Request.Method := 'POST'; Request.CharSet := 'utf-8'; Request.AcceptCharSet := 'utf-8'; res := Post(ServerURL, aParam); end; Result := res; req.Free; end; -edit- I'm using delphi 2010

    Read the article

  • mod_mono 'Service Temporarily Unavailable' issue

    - by Charlie Somerville
    I've deployed an ASP.NET web application on a Linux (Debian) server running Apache 2.2 and mod_mono 1.9 It's working well, however Mono occasionally segfaults and uses the entire CPU which causes the website to stop working and display 'Service Temporarily Unavailable' Killing mono fixes it, but obviously this isn't a good solution. I tailed the system log after this happened and I saw the following error messages from the kernel: Apr 20 01:49:37 charliesomerville kernel: [1596436.204158] mono[17909]: segfault at b645f671 ip b645f671 sp b4ffb604 error 4<6>mono[19047]: segfault at b645f66e ip b645f66e sp b4bf7604 error 4<6>mono[18017]: segfault at b645f66e ip b645f66e sp b52fe604 error 4<6>mono[19668]: segfault at b645f5e6 ip b645f5e6 sp b48f4604 error 4<6>mono[22565]: segfault at b645f674 ip b645f674 sp b45f1604 error 4<6>mono[17700]: segfault at b645f661 ip b645f661 sp b51fd604 error 4<6>mono[19596]: segfault at b645f5e6 ip b645f5e6 sp b49f5604 error 4 Apr 20 01:49:37 charliesomerville kernel: [1596436.208172] mono[23219]: segfault at b645f66e ip b645f66e sp b44f0604 error 4 At the end of Apache's error.log are the following errors: [Tue Apr 20 03:10:23 2010] [error] (70014)End of file found: read_data failed [Tue Apr 20 03:10:23 2010] [error] Command stream corrupted, last command was 1 [Tue Apr 20 03:10:23 2010] [error] Command stream corrupted, last command was 1 [Tue Apr 20 03:10:23 2010] [error] Command stream corrupted, last command was 1 System.ArgumentNullException: null key Parameter name: key at System.Collections.Hashtable.get_Item (System.Object key) [0x00000] at System.Runtime.Serialization.SerializationCallbacks.GetSerializationCallbacks (System.Type t) [0x00000] at System.Runtime.Serialization.ObjectManager.RaiseOnDeserializingEvent (System.Object obj) [0x00000] at System.Runtime.Serialization.Formatters.Binary.ObjectReader.ReadObjectContent (System.IO.BinaryReader reader, System.Runtime.Serialization.Formatters.Binary.TypeMetadata metadata, Int64 objectId, System.Object& objectInstance, System.Runtime.Serialization.SerializationInfo& info) [0x00000] at System.Runtime.Serialization.Formatters.Binary.ObjectReader.ReadObjectInstance (System.IO.BinaryReader reader, Boolean isRuntimeObject, Boolean hasTypeInfo, System.Int64& objectId, System.Object& value, System.Runtime.Serialization.SerializationInfo& info) [0x00000] at System.Runtime.Serialization.Formatters.Binary.ObjectReader.ReadObject (BinaryElement element, System.IO.BinaryReader reader, System.Int64& objectId, System.Object& value, System.Runtime.Serialization.SerializationInfo& info) [0x00000] at System.Runtime.Serialization.Formatters.Binary.ObjectReader.ReadNextObject (System.IO.BinaryReader reader) [0x00000] at System.Runtime.Serialization.Formatters.Binary.ObjectReader.ReadObjectGraph (System.IO.BinaryReader reader, Boolean readHeaders, System.Object& result, System.Runtime.Remoting.Messaging.Header[]& headers) [0x00000] at System.Runtime.Serialization.Formatters.Binary.BinaryFormatter.NoCheckDeserialize (System.IO.Stream serializationStream, System.Runtime.Remoting.Messaging.HeaderHandler handler) [0x00000] at System.Runtime.Serialization.Formatters.Binary.BinaryFormatter.Deserialize (System.IO.Stream serializationStream) [0x00000] at System.Runtime.Remoting.Channels.CADSerializer.DeserializeObject (System.IO.MemoryStream mem) [0x00000] at System.Runtime.Remoting.RemotingServices.GetDomainProxy (System.AppDomain domain) [0x00000] at System.AppDomain.CreateDomain (System.String friendlyName, System.Security.Policy.Evidence securityInfo, System.AppDomainSetup info) [0x00000] at System.Web.Hosting.ApplicationHost.CreateApplicationHost (System.Type hostType, System.String virtualDir, System.String physicalDir) [0x00000] at Mono.WebServer.VPathToHost.CreateHost (Mono.WebServer.ApplicationServer server, Mono.WebServer.WebSource webSource) [0x00000] at Mono.WebServer.ApplicationServer.GetApplicationForPath (System.String vhost, Int32 port, System.String path, Boolean defaultToRoot) [0x00000] at (wrapper remoting-invoke-with-check) Mono.WebServer.ApplicationServer:GetApplicationForPath (string,int,string,bool) at Mono.WebServer.ModMonoWorker.GetOrCreateApplication (System.String vhost, Int32 port, System.String filepath, System.String virt) [0x00000] at Mono.WebServer.ModMonoWorker.InnerRun (System.Object state) [0x00000] at Mono.WebServer.ModMonoWorker.Run (System.Object state) [0x00000] [Tue Apr 20 03:10:26 2010] [error] (70014)End of file found: read_data failed [Tue Apr 20 03:10:26 2010] [error] Command stream corrupted, last command was -1 Along with the above errors, Apache's error.log is packed with hundreds (if not thousands) of the following error: Maximum number (20) of concurrent mod_mono requests to /tmp/mod_mono_dashboard_default_2.lock reached. Droping request. At the moment, I'm thinking there might be something wrong with configuration here (it's basically running on out-of-the-box config)

    Read the article

  • Is Berkeley DB a NoSQL solution?

    - by Gregory Burd
    Berkeley DB is a library. To use it to store data you must link the library into your application. You can use most programming languages to access the API, the calls across these APIs generally mimic the Berkeley DB C-API which makes perfect sense because Berkeley DB is written in C. The inspiration for Berkeley DB was the DBM library, a part of the earliest versions of UNIX written by AT&T's Ken Thompson in 1979. DBM was a simple key/value hashtable-based storage library. In the early 1990s as BSD UNIX was transitioning from version 4.3 to 4.4 and retrofitting commercial code owned by AT&T with unencumbered code, it was the future founders of Sleepycat Software who wrote libdb (aka Berkeley DB) as the replacement for DBM. The problem it addressed was fast, reliable local key/value storage. At that time databases almost always lived on a single node, even the most sophisticated databases only had simple fail-over two node solutions. If you had a lot of data to store you would choose between the few commercial RDBMS solutions or to write your own custom solution. Berkeley DB took the headache out of the custom approach. These basic market forces inspired other DBM implementations. There was the "New DBM" (ndbm) and the "GNU DBM" (GDBM) and a few others, but the theme was the same. Even today TokyoCabinet calls itself "a modern implementation of DBM" mimicking, and improving on, something first created over thirty years ago. In the mid-1990s, DBM was the name for what you needed if you were looking for fast, reliable local storage. Fast forward to today. What's changed? Systems are connected over fast, very reliable networks. Disks are cheep, fast, and capable of storing huge amounts of data. CPUs continued to follow Moore's Law, processing power that filled a room in 1990 now fits in your pocket. PCs, servers, and other computers proliferated both in business and the personal markets. In addition to the new hardware entire markets, social systems, and new modes of interpersonal communication moved onto the web and started evolving rapidly. These changes cause a massive explosion of data and a need to analyze and understand that data. Taken together this resulted in an entirely different landscape for database storage, new solutions were needed. A number of novel solutions stepped up and eventually a category called NoSQL emerged. The new market forces inspired the CAP theorem and the heated debate of BASE vs. ACID. But in essence this was simply the market looking at what to trade off to meet these new demands. These new database systems shared many qualities in common. There were designed to address massive amounts of data, millions of requests per second, and scale out across multiple systems. The first large-scale and successful solution was Dynamo, Amazon's distributed key/value database. Dynamo essentially took the next logical step and added a twist. Dynamo was to be the database of record, it would be distributed, data would be partitioned across many nodes, and it would tolerate failure by avoiding single points of failure. Amazon did this because they recognized that the majority of the dynamic content they provided to customers visiting their web store front didn't require the services of an RDBMS. The queries were simple, key/value look-ups or simple range queries with only a few queries that required more complex joins. They set about to use relational technology only in places where it was the best solution for the task, places like accounting and order fulfillment, but not in the myriad of other situations. The success of Dynamo, and it's design, inspired the next generation of Non-SQL, distributed database solutions including Cassandra, Riak and Voldemort. The problem their designers set out to solve was, "reliability at massive scale" so the first focal point was distributed database algorithms. Underneath Dynamo there is a local transactional database; either Berkeley DB, Berkeley DB Java Edition, MySQL or an in-memory key/value data structure. Dynamo was an evolution of local key/value storage onto networks. Cassandra, Riak, and Voldemort all faced similar design decisions and one, Voldemort, choose Berkeley DB Java Edition for it's node-local storage. Riak at first was entirely in-memory, but has recently added write-once, append-only log-based on-disk storage similar type of storage as Berkeley DB except that it is based on a hash table which must reside entirely in-memory rather than a btree which can live in-memory or on disk. Berkeley DB evolved too, we added high availability (HA) and a replication manager that makes it easy to setup replica groups. Berkeley DB's replication doesn't partitioned the data, every node keeps an entire copy of the database. For consistency, there is a single node where writes are committed first - a master - then those changes are delivered to the replica nodes as log records. Applications can choose to wait until all nodes are consistent, or fire and forget allowing Berkeley DB to eventually become consistent. Berkeley DB's HA scales-out quite well for read-intensive applications and also effectively eliminates the central point of failure by allowing replica nodes to be elected (using a PAXOS algorithm) to mastership if the master should fail. This implementation covers a wide variety of use cases. MemcacheDB is a server that implements the Memcache network protocol but uses Berkeley DB for storage and HA to replicate the cache state across all the nodes in the cache group. Google Accounts, the user authentication layer for all Google properties, was until recently running Berkeley DB HA. That scaled to a globally distributed system. That said, most NoSQL solutions try to partition (shard) data across nodes in the replication group and some allow writes as well as reads at any node, Berkeley DB HA does not. So, is Berkeley DB a "NoSQL" solution? Not really, but it certainly is a component of many of the existing NoSQL solutions out there. Forgetting all the noise about how NoSQL solutions are complex distributed databases when you boil them down to a single node you still have to store the data to some form of stable local storage. DBMs solved that problem a long time ago. NoSQL has more to do with the layers on top of the DBM; the distributed, sometimes-consistent, partitioned, scale-out storage that manage key/value or document sets and generally have some form of simple HTTP/REST-style network API. Does Berkeley DB do that? Not really. Is Berkeley DB a "NoSQL" solution today? Nope, but it's the most robust solution on which to build such a system. Re-inventing the node-local data storage isn't easy. A lot of people are starting to come to appreciate the sophisticated features found in Berkeley DB, even mimic them in some cases. Could Berkeley DB grow into a NoSQL solution? Absolutely. Our key/value API could be extended over the net using any of a number of existing network protocols such as memcache or HTTP/REST. We could adapt our node-local data partitioning out over replicated nodes. We even have a nice query language and cost-based query optimizer in our BDB XML product that we could reuse were we to build out a document-based NoSQL-style product. XML and JSON are not so different that we couldn't adapt one to work with the other interchangeably. Without too much effort we could add what's missing, we could jump into this No SQL market withing a single product development cycle. Why isn't Berkeley DB already a NoSQL solution? Why aren't we working on it? Why indeed...

    Read the article

  • Overriding Object.Equals() instance method in C#; now Code Analysis / FxCop warning CA2218: "should

    - by Chris W. Rea
    I've got a complex class in my C# project on which I want to be able to do equality tests. It is not a trivial class; it contains a variety of scalar properties as well as references to other objects and collections (e.g. IDictionary). For what it's worth, my class is sealed. To enable a performance optimization elsewhere in my system (an optimization that avoids a costly network round-trip), I need to be able to compare instances of these objects to each other for equality – other than the built-in reference equality – and so I'm overriding the Object.Equals() instance method. However, now that I've done that, Visual Studio 2008's Code Analysis a.k.a. FxCop, which I keep enabled by default, is raising the following warning: warning : CA2218 : Microsoft.Usage : Since 'MySuperDuperClass' redefines Equals, it should also redefine GetHashCode. I think I understand the rationale for this warning: If I am going to be using such objects as the key in a collection, the hash code is important. i.e. see this question. However, I am not going to be using these objects as the key in a collection. Ever. Feeling justified to suppress the warning, I looked up code CA2218 in the MSDN documentation to get the full name of the warning so I could apply a SuppressMessage attribute to my class as follows: [SuppressMessage("Microsoft.Naming", "CA2218:OverrideGetHashCodeOnOverridingEquals", Justification="This class is not to be used as key in a hashtable.")] However, while reading further, I noticed the following: How to Fix Violations To fix a violation of this rule, provide an implementation of GetHashCode. For a pair of objects of the same type, you must ensure that the implementation returns the same value if your implementation of Equals returns true for the pair. When to Suppress Warnings ----- Do not suppress a warning from this rule. [arrow & emphasis mine] So, I'd like to know: Why shouldn't I suppress this warning as I was planning to? Doesn't my case warrant suppression? I don't want to code up an implementation of GetHashCode() for this object that will never get called, since my object will never be the key in a collection. If I wanted to be pedantic, instead of suppressing, would it be more reasonable for me to override GetHashCode() with an implementation that throws a NotImplementedException? Update: I just looked this subject up again in Bill Wagner's good book Effective C#, and he states in "Item 10: Understand the Pitfalls of GetHashCode()": If you're defining a type that won't ever be used as the key in a container, this won't matter. Types that represent window controls, web page controls, or database connections are unlikely to be used as keys in a collection. In those cases, do nothing. All reference types will have a hash code that is correct, even if it is very inefficient. [...] In most types that you create, the best approach is to avoid the existence of GetHashCode() entirely. ... that's where I originally got this idea that I need not be concerned about GetHashCode() always.

    Read the article

  • System.InvalidOperationException: Unable to generate a temporary class (result=1).

    - by keepsmilinyaar
    Hi, I have developed an application using .net 3.5 and have deployed it as an .exe on a number of machines with the same environment. However, on one particular machine I get the following error. Am puttin in the Stack Trace. See the end of this message for details on invoking just-in-time (JIT) debugging instead of this dialog box. ********** Exception Text ********** System.InvalidOperationException: Unable to generate a temporary class (result=1). error CS2001: Source file 'C:\WINDOWS\TEMP\wz58eig4.0.cs' could not be found error CS2008: No inputs specified at System.Xml.Serialization.Compiler.Compile(Assembly parent, String ns, XmlSerializerCompilerParameters xmlParameters, Evidence evidence) at System.Xml.Serialization.TempAssembly.GenerateAssembly(XmlMapping[] xmlMappings, Type[] types, String defaultNamespace, Evidence evidence, XmlSerializerCompilerParameters parameters, Assembly assembly, Hashtable assemblies) at System.Xml.Serialization.TempAssembly..ctor(XmlMapping[] xmlMappings, Type[] types, String defaultNamespace, String location, Evidence evidence) at System.Xml.Serialization.XmlSerializer.GetSerializersFromCache(XmlMapping[] mappings, Type type) at System.Xml.Serialization.XmlSerializer.FromMappings(XmlMapping[] mappings, Type type) at System.Web.Services.Protocols.SoapClientType..ctor(Type type) at System.Web.Services.Protocols.SoapHttpClientProtocol..ctor() at SSOClient..ctor() at sc.tradesvc.SSOManager..ctor() at sc.tradesvc.SSOManager.get_Inst() at sc.cashflowgenerator.Controls.LoginForm.btnLogin_Click(Object sender, EventArgs e) at System.Windows.Forms.Control.OnClick(EventArgs e) at System.Windows.Forms.Button.OnClick(EventArgs e) at System.Windows.Forms.Button.PerformClick() at System.Windows.Forms.Form.ProcessDialogKey(Keys keyData) at System.Windows.Forms.TextBoxBase.ProcessDialogKey(Keys keyData) at System.Windows.Forms.Control.PreProcessMessage(Message& msg) at System.Windows.Forms.Control.PreProcessControlMessageInternal(Control target, Message& msg) at System.Windows.Forms.Application.ThreadContext.PreTranslateMessage(MSG& msg) ********** Loaded Assemblies ********** mscorlib Assembly Version: 2.0.0.0 Win32 Version: 2.0.50727.1433 (REDBITS.050727-1400) CodeBase: file:///C:/WINDOWS/Microsoft.NET/Framework/v2.0.50727/mscorlib.dll CashflowGenerator Assembly Version: 1.0.0.0 Win32 Version: 1.0.0.0 CodeBase: file:///C:/DATA/DEVEL/Output/CashflowGenerator.exe System.Windows.Forms Assembly Version: 2.0.0.0 Win32 Version: 2.0.50727.1433 (REDBITS.050727-1400) CodeBase: file:///C:/WINDOWS/assembly/GAC_MSIL/System.Windows.Forms/2.0.0.0__b77a5c561934e089/System.Windows.Forms.dll System Assembly Version: 2.0.0.0 Win32 Version: 2.0.50727.1433 (REDBITS.050727-1400) CodeBase: file:///C:/WINDOWS/assembly/GAC_MSIL/System/2.0.0.0__b77a5c561934e089/System.dll System.Drawing Assembly Version: 2.0.0.0 Win32 Version: 2.0.50727.1433 (REDBITS.050727-1400) CodeBase: file:///C:/WINDOWS/assembly/GAC_MSIL/System.Drawing/2.0.0.0__b03f5f7f11d50a3a/System.Drawing.dll System.Configuration Assembly Version: 2.0.0.0 Win32 Version: 2.0.50727.1433 (REDBITS.050727-1400) CodeBase: file:///C:/WINDOWS/assembly/GAC_MSIL/System.Configuration/2.0.0.0__b03f5f7f11d50a3a/System.Configuration.dll System.Xml Assembly Version: 2.0.0.0 Win32 Version: 2.0.50727.1433 (REDBITS.050727-1400) CodeBase: file:///C:/WINDOWS/assembly/GAC_MSIL/System.Xml/2.0.0.0__b77a5c561934e089/System.Xml.dll System.Core Assembly Version: 3.5.0.0 Win32 Version: 3.5.21022.8 built by: RTM CodeBase: file:///C:/WINDOWS/assembly/GAC_MSIL/System.Core/3.5.0.0__b77a5c561934e089/System.Core.dll System.Web.Services Assembly Version: 2.0.0.0 Win32 Version: 2.0.50727.1433 (REDBITS.050727-1400) CodeBase: file:///C:/WINDOWS/assembly/GAC_MSIL/System.Web.Services/2.0.0.0__b03f5f7f11d50a3a/System.Web.Services.dll ********** JIT Debugging ********** To enable just-in-time (JIT) debugging, the .config file for this application or computer (machine.config) must have the jitDebugging value set in the system.windows.forms section. The application must also be compiled with debugging enabled. For example: When JIT debugging is enabled, any unhandled exception will be sent to the JIT debugger registered on the computer rather than be handled by this dialog box. Could someone help me with this? As I am new to .net could someone also tell me when why a temporary class needs to be created in the first place? Thank you very much.

    Read the article

  • "Could not establish secure channel for SSL/TLS" in .NET CF application on smart phone

    - by Stefan Mohr
    I have a stubborn communications issue with an application running on the .NET Compact Framework 3.5 on Windows Mobile smartphones. I am constructing a web request using this code: UTF8Encoding encoding = new System.Text.UTF8Encoding(); byte[] Data = encoding.GetBytes(HttpUtility.ConstructQueryString(parameters)); httpRequest = WebRequest.Create((domain)) as HttpWebRequest; httpRequest.Timeout = 10000000; httpRequest.ReadWriteTimeout = 10000000; httpRequest.Credentials = CredentialCache.DefaultCredentials; httpRequest.Method = "POST"; httpRequest.ContentType = "application/x-www-form-urlencoded"; httpRequest.ContentLength = Data.Length; Stream SendReq = httpRequest.GetRequestStream(); SendReq.Write(Data, 0, Data.Length); SendReq.Close(); HttpWebResponse httpResponse = (HttpWebResponse)httpRequest.GetResponse(); return httpResponse.GetResponseStream(); The web service functions by receiving a JSON-encoded document as part of the URL (eg. https://site.com/ws/sync??document={"version":"1.0.0","items":[{"item_1":"item1"}]}&user=usr&password=pw), and as a response receives another JSON document as response data. This code runs fine on all emulators and PDAs running WM 5 and 6. We have seen an issue with a couple of customers running Treo smartphones (and only on the Sprint network). We have tested the code on an identical device on the AT&T network (via DeviceAnywhere) and once again the code worked as we expected. This has to be some sort of security policy on the phone, but we've been unable to determine a workaround or diagnose it thoroughly as we cannot reproduce it in house and have had to resort to getting users to assist with running test drivers for us. When this code executes, the user's device throws the following exception: System.Net.WebException Could not establish secure channel for SSL/TLS Stack trace: at System.Net.HttpWebRequest.finishGetRequestStream() at System.Net.HttpWebRequest.GetRequestStream() at OurApp.GetResponseStream(String domain, Hashtable parameters) inner exception: System.IO.IOException Authentication failed because the remote party has closed the transport stream. Stack trace: at System.Net.SslConnectionState.ClientSideHandshake() at System.Net.SslConnectionState.PerformClientHandShake() at System.Net.Connection.connect(Object ignored) at System.Threading.ThreadPool.WorkItem.doWork(Object o) at System.Threading.Timer.ring() Examining the server Apache logs shows no hits from the user's IP - I don't think the device is even attempting to send a packet before failing. If relevant, the server is running Apache on Linux and is written using the TurboGears Python framework. The server certificate is issued by a CA and is still valid. The test driver where this error was copied from was not code signed, however the same error (without the error messages) is signed with a GeoTrust certificate so we don't believe this is a code signing issue. The application installs and launches without issue on all phones - it's just establishing this SSL connection that is breaking for these users. One significant issue in troubleshooting is that there is a substantial inconvenience each time we try out a solution (need to find a "volunteer" customer), so we're really looking for a silver bullet or a better understanding of the handshaking process so we can be reasonably confident we only need to ask the user to test it one or two more times. One final mention: we have tried the sync both over ActiveSync and also over GPRS with identical results. Any thoughts would be greatly appreciated!

    Read the article

  • black screen while retrieving result from webservices in android

    - by Aswan
    Hi Folks i am using following webservices for retrieving data from server server side:.net client side:ksoap2 whenever activity start, onCreate i am using spinner for displying data returned by the webservices when this activity start it showing black screen after lunching the activity .i found black screen is coming when activity connecting to webservices How to resolve this MyCode public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); try { //Display the online and busy people display in spinner //people are display in relative people only(Mygroup) /* get the online and busy people who are in user group from DB*/ users_names_ids=new ParseXMLString().convertusernames(new DataParsingComm().ILGetOnlinePeoples("<spGetOnlinePeoples><UserID>"+GetCurrentUserID.id+"</UserID></spGetOnlinePeoples>")); /* create an array with the size of number of peoples whose status is online or busy */ String[] array =new String[users_names_ids.size()]; int setselction=0;// initialize the selection to 0. /* if array length is greater than zero, that means getting at least one person whose status is online or busy */ if(array.length>0){ /* Returns an enumeration on the keys of this Hashtable instance. And assigns into Enumeration instance variable */ Enumeration e= users_names_ids.keys(); /* Iterate list Enumeration until it does't has any more elements */ for(int i=0;e.hasMoreElements();i++) try{ /* get all persons names into the array list */ array[i]=e.nextElement().toString(); /* Get the ChatUserName value from the ChatInPeopleDetails preferences. And If it is in this list set selection to the index 'i' */ if(getSharedPreferences("ChatInPeopleDetails", 0).getString("ChatUserName", "").equals(array[i])) setselction=i; /* * Get the String value of Relname, that previously added with putExtra() as extended data to the parent intent * If that value is not null and exists in the array list then * set the selection to the index 'i'. * */ else if(getIntent().getStringExtra("Relname")!=null && getIntent().getStringExtra("Relname").equals(array[i])) setselction=i; }catch(Exception ex){ ex.printStackTrace(); } finally { System.gc(); System.runFinalization(); } } /* create a new array adapter with the ChatForm context and array objects */ ArrayAdapter<String> adapter2 = new ArrayAdapter<String>(ChatForm.this,android.R.layout.simple_spinner_item, array); /* Set the layout resource to create the drop down views. */ adapter2.setDropDownViewResource(android.R.layout.simple_spinner_dropdown_item); /* The Adapter is used to provide the data which backs this Spinner SpinnerUsersToChat. */ ((Spinner)findViewById(R.id.SpinnerUsersToChat)).setAdapter(adapter2); /* Get the ChatUserName value from the ChatInPeopleDetails preferences. If this value is not null*/ if(getSharedPreferences("ChatInPeopleDetails", 0).getString("ChatUserName", "") !=null) { /* Set the currently selected item of spinner based on selection variable value */ ((Spinner)findViewById(R.id.SpinnerUsersToChat)).setSelection(setselction); } /* Register a callback to be invoked when an item in this AdapterView has been selected.*/ ((Spinner)findViewById(R.id.SpinnerUsersToChat)).setOnItemSelectedListener(new OnItemSelectedListener() { public void onItemSelected(AdapterView<?> parent,View v,int position,long id) { /* call getMsg() to get messages and display them*/ getMsg(); /* Causes the Runnable to be added to the message queue. The runnable will be run on the user interface thread.*/ ((ScrollView)findViewById(R.id.ScrollView06)).post(new Runnable() { public void run() { /* This fullScroll() method will scroll the view to the bottom .*/ ((ScrollView)findViewById(R.id.ScrollView06)).fullScroll(View.FOCUS_DOWN); } }); } /* on nothing selected to do somthing . this an overridden method */ public void onNothingSelected(AdapterView<?> arg0) { } }); } catch (Exception e1) { e1.printStackTrace(); } }

    Read the article

  • Why might a System.String object not cache its hash code?

    - by Dan Tao
    A glance at the source code for string.GetHashCode using Reflector reveals the following (for mscorlib.dll version 4.0): public override unsafe int GetHashCode() { fixed (char* str = ((char*) this)) { char* chPtr = str; int num = 0x15051505; int num2 = num; int* numPtr = (int*) chPtr; for (int i = this.Length; i > 0; i -= 4) { num = (((num << 5) + num) + (num >> 0x1b)) ^ numPtr[0]; if (i <= 2) { break; } num2 = (((num2 << 5) + num2) + (num2 >> 0x1b)) ^ numPtr[1]; numPtr += 2; } return (num + (num2 * 0x5d588b65)); } } Now, I realize that the implementation of GetHashCode is not specified and is implementation-dependent, so the question "is GetHashCode implemented in the form of X or Y?" is not really answerable. I'm just curious about a few things: If Reflector has disassembled the DLL correctly and this is the implementation of GetHashCode (in my environment), am I correct in interpreting this code to indicate that a string object, based on this particular implementation, would not cache its hash code? Assuming the answer is yes, why would this be? It seems to me that the memory cost would be minimal (one more 32-bit integer, a drop in the pond compared to the size of the string itself) whereas the savings would be significant, especially in cases where, e.g., strings are used as keys in a hashtable-based collection like a Dictionary<string, [...]>. And since the string class is immutable, it isn't like the value returned by GetHashCode will ever even change. What could I be missing? UPDATE: In response to Andras Zoltan's closing remark: There's also the point made in Tim's answer(+1 there). If he's right, and I think he is, then there's no guarantee that a string is actually immutable after construction, therefore to cache the result would be wrong. Whoa, whoa there! This is an interesting point to make (and yes it's very true), but I really doubt that this was taken into consideration in the implementation of GetHashCode. The statement "therefore to cache the result would be wrong" implies to me that the framework's attitude regarding strings is "Well, they're supposed to be immutable, but really if developers want to get sneaky they're mutable so we'll treat them as such." This is definitely not how the framework views strings. It fully relies on their immutability in so many ways (interning of string literals, assignment of all zero-length strings to string.Empty, etc.) that, basically, if you mutate a string, you're writing code whose behavior is entirely undefined and unpredictable. I guess my point is that for the author(s) of this implementation to worry, "What if this string instance is modified between calls, even though the class as it is publicly exposed is immutable?" would be like for someone planning a casual outdoor BBQ to think to him-/herself, "What if someone brings an atomic bomb to the party?" Look, if someone brings an atom bomb, party's over.

    Read the article

  • How to cope with developing against a poor 3rd party API/application?

    - by wsanville
    I'm a web developer, and my organization has recently started to use a proprietary ASP.NET CMS for our web sites. I was excited to get started using the CMS, thinking it would bring a lot of value to our end users and be fun to work with, since my skills are a good match for the types of projects we're using it for. That was about a year ago. Since then, we've ran into all kinds of issues, from blatant bugs in the product, to nasty edge cases in the APIs, to extremely poor documentation for developers. On about a weekly basis, we are forced to pursue workarounds and rewrite some of the out of the box functionality, and even find some of the basic features unusable. In many cases, since this is a closed source application (and obfuscated of course), there's nothing we can do as developers to solve these issues. So my question is, how does one attempt to develop a good application in such a scenario? The application mostly works when using the the exact out of the box behavior, or using one of the company's starter sites. However, my attempts to use the underlying APIs to implement slightly different, yet reasonable behavior has proved to be extremely time consuming (not to mention just as buggy), given the lack of good information about the APIs. I've given this a lot of thought, and my conflicting viewpoints are the following: Strongly advise against any customization to the CMS, as development time will rise exponentially, or even have an extremely high chance of failing. While this is accurate, I do not want to give the impression that I am not willing to code my own solutions to problems and take the initiative to implement something difficult or complex. I don't want to be perceived as someone who is not motivated, lazy, or not knowledgeable to do anything complex, because this is simply not the case. I love coding my own solutions, trying new/difficult things, I just dislike the vendor app we're using. Continue on the path I'm on now, which is hacking my way past all issues I encounter and try my best to deliver an application that meets the needs and specs exactly. My goals are to make it as seamless and easy to use as possible to the end user, even when integrating the CMS with our other applications internally. The problem I'm finding with this approach is it is very time consuming. I open support cases with the vendor on a regular basis to solve issues and to gain knowledge of their APIs, but this is extremely time consuming, and in some cases it leads to dead ends. I post on the vendors forums on a regular basis but have become frustrated as most of my posts get 0 replies. So, what would you, a reasonable developer, do in this case? How can I make the best of the situation? And just for fun, here are some of the code smells and anti-patterns I've dealt with using the product (aside from their own code blatantly failing): Use of StringBuilder to concatenate a giant string that is hard coded and does not change. They use it to concatenate their Javascript and write it out into the body tags of their pages. Methods that accept object or Microsoft.VisualBasic.Collection as the parameters. In the case of the VB Collection, the data is not a list of any kind, it's used instead of making a class. Methods that return a Hashtable of VB Collections Method names of the form MethodName_v45, MethodName_v20, etc... Multiple classes with the same name in different namespaces with different functionality/behavior. Intellisense that reads "Note: this parameter is non functional" Complete lack of coding standards, API is filled with magic numbers and magic strings. Properties with a getter of type object that accepts totally different things, like enum or strings, and throw exceptions at runtime when you pass in something not supported. And much, much, more...

    Read the article

  • Opening a file with a variable as name and checking for undefined values

    - by Harm De Weirdt
    I'm having some problems writing data into a file using Perl. sub startNewOrder{ my $name = makeUniqueFileName(); open (ORDER, ">$name.txt") or die "can't open file: $!\n"; format ORDER_TOP = PRODUCT<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<CODE<<<<<<<<AANTAL<<<<EENHEIDSPRIJS<<<<<<TOTAAL<<<<<<< . format ORDER = @<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<< @<<<<<<<< @<<<< @<<<<<< @<<<<< $title, $code, $amount, $price, $total . close (ORDER); } This is the sub I use to make the file. (I translated most of it.) The makeUniqueFileName method makes a fileName based upon current time("minuteshoursdayOrder"). The problem now is that I have to write to this file in another sub. sub addToOrder{ print "give productcode:"; $code = <STDIN>; chop $code; print "Give amount:"; $amount = <STDIN>; chop $amount; if($inventory{$code} eq undef){ #Does the product exist? print "This product does not exist"; }elsif($inventory{$code}[2] < $amount && !defined($inventaris{$code}[2]) ){ #Is there enough in the inventory? print "There is not enough in stock" }else{ $inventory{$code}[2] -= $amount; #write in order file open (ORDER ">>$naam.txt") or die "can't open file: $!\n"; $title = $inventory{$code}[0]; $code = $code; $amount = $inventory{$code}[2]; $price = $inventory{$code}[1]; $total = $inventory{$code}[1]; write; close(ORDER); } %inventory is a hashtable that has the productcode as key and an array with the title, price and amount as value. There are two problems here: when I enter an invalid product number, I still have to enter an amount even while my code says it should print the error directly after checking if there is a product with the given code. The second problem is that the writing doesn't seem to work. It always give's a "No such file or directory" error. Is there a way to open the ORDER file I made in the first sub without having to make $name not local? Or just a way to write in this file? I really don't know how to start here. I can't really find much info on writing a file that has been closed before, and in a different sub. Any help is appreciated, Harm

    Read the article

  • Opening a file with a variable as name & checking for undefined values

    - by Harm De Weirdt
    Hello everyone. I'm having some problems writing data into a file using perl. sub startNewOrder{ my $name = makeUniqueFileName(); open (ORDER, ">$name.txt") or die "can't open file: $!\n"; format ORDER_TOP = PRODUCT<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<CODE<<<<<<<<AANTAL<<<<EENHEIDSPRIJS<<<<<<TOTAAL<<<<<<< . format ORDER = @<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<< @<<<<<<<< @<<<< @<<<<<< @<<<<< $title, $code, $amount, $price, $total . close (ORDER); } This is the sub I use to make the file. (I translated most of it) The makeUniqueFileName method makes a fileName based upon current time("minuteshoursdayOrder"). The problem now is that I have to write in this file in another sub. sub addToOrder{ print "give productcode:"; $code = <STDIN>; chop $code; print "Give amount:"; $amount = <STDIN>; chop $amount; if($inventory{$code} eq undef){ #Does the product exist? print "This product does not exist"; }elsif($inventory{$code}[2] < $amount && !defined($inventaris{$code}[2]) ){ #Is there enough in the inventory? print "There is not enough in stock" }else{ $inventory{$code}[2] -= $amount; #write in order file open (ORDER ">>$naam.txt") or die "can't open file: $!\n"; $title = $inventory{$code}[0]; $code = $code; $amount = $inventory{$code}[2]; $price = $inventory{$code}[1]; $total = $inventory{$code}[1]; write; close(ORDER); } %inventory is a hashtable that has the productcode as key and an array with the title, price and amount as value. There are two problems here: when I enter an invalid product number, I still have to enter an amount even while my code says it should print the error directly after checking if there is a product with the given code. The second problem is that the writing doesn't seem to work. It always give's a "No such file or directory" error. Is there a way to open the ORDER file i made in the first sub without having to make $name not local? Or just a way to write in this file? I really don't know how to start here. I can't really find much info on writing a file that has been closed before, and in a different sub.. Any help is appreciated, Harm

    Read the article

  • A Simple Approach For Presenting With Code Samples

    - by Jesse Taber
    Originally posted on: http://geekswithblogs.net/GruffCode/archive/2013/07/31/a-simple-approach-for-presenting-with-code-samples.aspxI’ve been getting ready for a presentation and have been struggling a bit with the best way to show and execute code samples. I don’t present often (hardly ever), but when I do I like the presentation to have a lot of succinct and executable code snippets to help illustrate the points that I’m making. Depending on what the presentation is about, I might just want to build an entire sample application that I would run during the presentation. In other cases, however, building a full-blown application might not really be the best way to present the code. The presentation I’m working on now is for an open source utility library for dealing with dates and times. I could have probably cooked up a sample app for accepting date and time input and then contrived ways in which it could put the library through its paces, but I had trouble coming up with one app that would illustrate all of the various features of the library that I wanted to highlight. I finally decided that what I really needed was an approach that met the following criteria: Simple: I didn’t want the user interface or overall architecture of a sample application to serve as a distraction from the demonstration of the syntax of the library that the presentation is about. I want to be able to present small bits of code that are focused on accomplishing a single task. Several of these examples will look similar, and that’s OK. I want each sample to “stand on its own” and not rely much on external classes or methods (other than the library that is being presented, of course). “Debuggable” (not really a word, I know): I want to be able to easily run the sample with the debugger attached in Visual Studio should I want to step through any bits of code and show what certain values might be at run time. As far as I know this rules out something like LinqPad, though using LinqPad to present code samples like this is actually a very interesting idea that I might explore another time. Flexible and Selectable: I’m going to have lots of code samples to show, and I want to be able to just package them all up into a single project or module and have an easy way to just run the sample that I want on-demand. Since I’m presenting on a .NET framework library, one of the simplest ways in which I could execute some code samples would be to just create a Console application and use Console.WriteLine to output the pertinent info at run time. This gives me a “no frills” harness from which to run my code samples, and I just hit ‘F5’ to run it with the debugger. This satisfies numbers 1 and 2 from my list of criteria above, but item 3 is a little harder. By default, just running a console application is going to execute the ‘main’ method, and then terminate the program after all code is executed. If I want to have several different code samples and run them one at a time, it would be cumbersome to keep swapping the code I want in and out of the ‘main’ method of the console application. What I really want is an easy way to keep the console app running throughout the whole presentation and just have it run the samples I want when I want. I could setup a simple Windows Forms or WPF desktop application with buttons for the different samples, but then I’m getting away from my first criteria of keeping things as simple as possible. Infinite Loops To The Rescue I found a way to have a simple console application satisfy all three of my requirements above, and it involves using an infinite loop and some Console.ReadLine calls that will give the user an opportunity to break out and exit the program. (All programs that need to run until they are closed explicitly (or crash!) likely use similar constructs behind the scenes. Create a new Windows Forms project, look in the ‘Program.cs’ that gets generated, and then check out the docs for the Application.Run method that it calls.). Here’s how the main method might look: 1: static void Main(string[] args) 2: { 3: do 4: { 5: Console.Write("Enter command or 'exit' to quit: > "); 6: var command = Console.ReadLine(); 7: if ((command ?? string.Empty).Equals("exit", StringComparison.OrdinalIgnoreCase)) 8: { 9: Console.WriteLine("Quitting."); 10: break; 11: } 12: 13: } while (true); 14: } The idea here is the app prompts me for the command I want to run, or I can type in ‘exit’ to break out of the loop and let the application close. The only trick now is to create a set of commands that map to each of the code samples that I’m going to want to run. Each sample is already encapsulated in a single public method in a separate class, so I could just write a big switch statement or create a hashtable/dictionary that maps command text to an Action that will invoke the proper method, but why re-invent the wheel? CLAP For Your Own Presentation I’ve blogged about the CLAP library before, and it turns out that it’s a great fit for satisfying criteria #3 from my list above. CLAP lets you decorate methods in a class with an attribute and then easily invoke those methods from within a console application. CLAP was designed to take the arguments passed into the console app from the command line and parse them to determine which method to run and what arguments to pass to that method, but there’s no reason you can’t re-purpose it to accept command input from within the infinite loop defined above and invoke the corresponding method. Here’s how you might define a couple of different methods to contain two different code samples that you want to run during your presentation: 1: public static class CodeSamples 2: { 3: [Verb(Aliases="one")] 4: public static void SampleOne() 5: { 6: Console.WriteLine("This is sample 1"); 7: } 8:   9: [Verb(Aliases="two")] 10: public static void SampleTwo() 11: { 12: Console.WriteLine("This is sample 2"); 13: } 14: } A couple of things to note about the sample above: I’m using static methods. You don’t actually need to use static methods with CLAP, but the syntax ends up being a bit simpler and static methods happen to lend themselves well to the “one self-contained method per code sample” approach that I want to use. The methods are decorated with a ‘Verb’ attribute. This tells CLAP that they are eligible targets for commands. The “Aliases” argument lets me give them short and easy-to-remember aliases that can be used to invoke them. By default, CLAP just uses the full method name as the command name, but with aliases you can simply the usage a bit. I’m not using any parameters. CLAP’s main feature is its ability to parse out arguments from a command line invocation of a console application and automatically pass them in as parameters to the target methods. My code samples don’t need parameters ,and honestly having them would complicate giving the presentation, so this is a good thing. You could use this same approach to invoke methods with parameters, but you’d have a couple of things to figure out. When you invoke a .NET application from the command line, Windows will parse the arguments and pass them in as a string array (called ‘args’ in the boilerplate console project Program.cs). The parsing that gets done here is smart enough to deal with things like treating strings in double quotes as one argument, and you’d have to re-create that within your infinite loop if you wanted to use parameters. I plan on either submitting a pull request to CLAP to add this capability or maybe just making a small utility class/extension method to do it and posting that here in the future. So I now have a simple class with static methods to contain my code samples, and an infinite loop in my ‘main’ method that can accept text commands. Wiring this all up together is pretty easy: 1: static void Main(string[] args) 2: { 3: do 4: { 5: try 6: { 7: Console.Write("Enter command or 'exit' to quit: > "); 8: var command = Console.ReadLine(); 9: if ((command ?? string.Empty).Equals("exit", StringComparison.OrdinalIgnoreCase)) 10: { 11: Console.WriteLine("Quitting."); 12: break; 13: } 14:   15: Parser.Run<CodeSamples>(new[] { command }); 16: Console.WriteLine("---------------------------------------------------------"); 17: } 18: catch (Exception ex) 19: { 20: Console.Error.WriteLine("Error: " + ex.Message); 21: } 22:   23: } while (true); 24: } Note that I’m now passing the ‘CodeSamples’ class into the CLAP ‘Parser.Run’ as a type argument. This tells CLAP to inspect that class for methods that might be able to handle the commands passed in. I’m also throwing in a little “----“ style line separator and some basic error handling (because I happen to know that some of the samples are going to throw exceptions for demonstration purposes) and I’m good to go. Now during my presentation I can just have the console application running the whole time with the debugger attached and just type in the alias of the code sample method that I want to run when I want to run it.

    Read the article

  • New release of Microsoft All-In-One Code Framework is available for download - March 2011

    - by Jialiang
    A new release of Microsoft All-In-One Code Framework is available on March 8th. Download address: http://1code.codeplex.com/releases/view/62267#DownloadId=215627 You can download individual code samples or browse code samples grouped by technology in the updated code sample index. If it’s the first time that you hear about Microsoft All-In-One Code Framework, please read this Microsoft News Center article http://www.microsoft.com/presspass/features/2011/jan11/01-13codeframework.mspx, or watch the introduction video on YouTube http://www.youtube.com/watch?v=cO5Li3APU58, or read the introduction on our homepage http://1code.codeplex.com/. -------------- New Silverlight code samples CSSLTreeViewCRUDDragDrop Download: http://1code.codeplex.com/releases/view/62253#DownloadId=215808 The code sample was created by Amit Dey. It demonstrates a custom TreeView with added functionalities of CRUD (Create, Read, Update, Delete) and drag-and-drop operations. Silverlight TreeView control with CRUD and drag & drop is a frequently asked programming question in Silverlight  forums. Many customers also requested this code sample in our code sample request service. We hope that this sample can reduce developers' efforts in handling this typical programming scenario. The following blog article introduces the sample in detail: http://blogs.msdn.com/b/codefx/archive/2011/02/15/silverlight-treeview-control-with-crud-and-drag-amp-drop.aspx. CSSL4FileDragDrop and VBSL4FileDragDrop Download: http://1code.codeplex.com/releases/view/62253#DownloadId=215809 http://1code.codeplex.com/releases/view/62253#DownloadId=215810 The code sample demonstrates the new drag&drop feature of Silverlight 4 to implement dragging picures from the local file system to a Silverlight application.   Sometimes we want to change SiteMapPath control's titles and paths according to Query String values. And sometimes we want to create the SiteMapPath dynamically. This code sample shows how to achieve these goals by handling SiteMap.SiteMapResolve event. CSASPNETEncryptAndDecryptConfiguration, VBASPNETEncryptAndDecryptConfiguration Download: http://1code.codeplex.com/releases/view/62253#DownloadId=215027 http://1code.codeplex.com/releases/view/62253#DownloadId=215106 In this sample, we encrypt and decrypt some sensitive information in the config file of a web application by using the RSA asymmetric encryption. This project contains two snippets. The first one demonstrates how to use RSACryptoServiceProvider to generate public key and the corresponding private key and then encrypt/decrypt string value on page. The second part shows how to use RSA configuration provider to encrypt and decrypt configuration section in web.config of web application. connectionStrings section in plain text: Encrypted connectionString:  Note that if you store sensitive data in any of the following configuration sections, we cannot encrypt it by using a protected configuration provider <processModel> <runtime> <mscorlib> <startup> <system.runtime.remoting> <configProtectedData> <satelliteassemblies> <cryptographySettings> <cryptoNameMapping> CSASPNETFileUploadStatus Download: http://1code.codeplex.com/releases/view/62253#DownloadId=215028 I believe ASP.NET programmers will like this sample, because in many cases we need customers know the current status of the uploading files, including the upload speed and completion percentage and so on. Under normal circumstances, we need to use COM components to accomplish this function, such as Flash, Silverlight, etc. The uploading data can be retrieved in two places, the client-side and the server-side. For the client, for the safety factors, the file upload status information cannot be got from JavaScript or server-side code, so we need COM component, like Flash and Silverlight to accomplish this, I do not like this approach because the customer need to install these components, but also we need to learn another programming framework. For the server side, we can get the information through coding, but the key question is how to tell the client results. In this case, We will combine custom HTTPModule and AJAX technology to illustrate how to analyze the HTTP protocol, how to break the file request packets, how to customize the location of the server-side file caching, how to return the file uploading status back to the client and so on . CSASPNETHighlightCodeInPage, VBASPNETHighlightCodeInPage Download: http://1code.codeplex.com/releases/view/62253#DownloadId=215029 http://1code.codeplex.com/releases/view/62253#DownloadId=215108 This sample imitates a system that needs display the highlighted code in an ASP.NET page . As a matter of fact, sometimes we input code like C# or HTML in a web page and we need these codes to be highlighted for a better reading experience. It is convenient for us to keep the code in mind if it is highlighted. So in this case, the sample shows how to highlight the code in an ASP.NET page. It is not difficult to highlight the code in a web page by using String.Replace method directly. This  method can return a new string in which all occurrences of a specified string in the current instance are replaced with another specified string. However, it may not be a good idea, because it's not extremely fast, in fact, it's pretty slow. In addition, it is hard to highlight multiple keywords by using String.Replace method directly. Sometimes we need to copy source code from visual studio to a web page, for readability purpose, highlight the code is important while set the different types of keywords to different colors in a web page by using String.Replace method directly is not available. To handle this issue, we need to use a hashtable variable to store the different languages of code and their related regular expressions with matching options. Furthermore, define the css styles which used to highlight the code in a web page. The sample project can auto add the style object to the matching string of code. A step-by-step guide illustrating how to highlight the code in an ASP.NET page: 1. the HighlightCodePage.aspx page Choose a type of language in the dropdownlist control and paste the code in the textbox control, then click the HighLight button. 2.  Display the highlighted code in an ASP.NET page After user clicks the HighLight button, the highlighted code will be displayed at right side of the page.        CSASPNETPreventMultipleWindows Download: http://1code.codeplex.com/releases/view/62253#DownloadId=215032 This sample demonstrates a step-by-step guide illustrating how to detect and prevent multiple windows or tab usage in Web Applications. The sample imitates a system that need to prevent multiple windows or tabs to solve some problems like sharing sessions, protect duplicated login, data concurrency, etc. In fact, there are many methods achieving this goal. Here we give a solution of use JavaScript, Sample shows how to use window.name property check the correct links and throw other requests to invalid pages. This code-sample use two user controls to make a distinction between base page and target page, user only need drag different controls to appropriate web form pages. so user need not write repetitive code in every page, it will make coding work lightly and convenient for modify your code.  JSVirtualKeyboard Download: http://1code.codeplex.com/releases/view/62253#DownloadId=215093 This article describes an All-In-One framework sample that demonstrates a step-by-step guide illustrating how to build a virtual keyboard in your HTML page. Sometimes we may need to offer a virtual keyboard to let users input something without their real keyboards. This scenario often occurs when users will enter their password to get access to our sites and we want to protect the password from some kinds of back-door software, a Key-logger for example, and we will find a virtual keyboard on the page will be a good choice here. To create a virtual keyboard, we firstly need to add some buttons to the page. And when users click on a certain button, the JavaScript function handling the onclick event will input an appropriated character to the textbox. That is the simple logic of this feature. However, if we indeed want a virtual keyboard to substitute for the real keyboard completely, we will need more advanced logic to handle keys like Caps-Lock and Shift etc. That will be a complex work to achieve. CSASPNETDataListImageGallery Download: http://1code.codeplex.com/releases/view/62261#DownloadId=215267 This code sample demonstrates how to create an Image Gallery application by using the DataList control in ASP.NET. You may find the Image Gallery is widely used in many social networking sites, personal websites and E-Business websites. For example, you may use the Image Gallery to show a library of personal uploaded images on a personal website. Slideshow is also a popular tool to display images on websites. This code sample demonstrates how to use the DataList and ImageButton controls in ASP.NET to create an Image Gallery with image navigation. You can click on a thumbnail image in the Datalist control to display a larger version of the image on the page. This sample code reads the image paths from a certain directory into a FileInfo array. Then, the FileInfo array is used to populate a custom DataTable object which is bound to the Datalist control. This code sample also implements a custom paging system that allows five images to be displayed horizontally on one page. The following link buttons are used to implement a custom paging system:   •     First •     Previous •     Next •     Last Note We recommend that you use this method to load no more than five images at a time. You can also set the SelectedIndex property for the DataList control to limit the number of the thumbnail images that can be selected. To indicate which image is selected, you can set the SelectedStyle property for the DataList control. VBASPNETSearchEngine Download: http://1code.codeplex.com/releases/view/62253#DownloadId=215112 This sample shows how to implement a simple search engine in an ASP.NET web site. It uses LIKE condition in SQL statement to search database. Then it highlights keywords in search result by using Regular Expression and JavaScript. New Windows General code samples CSCheckEXEType, VBCheckEXEType Downloads: http://1code.codeplex.com/releases/view/62253#DownloadId=215045 http://1code.codeplex.com/releases/view/62253#DownloadId=215120 The sample demonstrates how to check an executable file type.  For a given executable file, we can get 1 whether it is a console application 2 whether it is a .Net application 3 whether it is a 32bit native application. 4 The full display name of a .NET application, e.g. System, Version=2.0.0.0, Culture=neutral, PublicKeyToken=b77a5c561934e089, processorArchitecture=MSIL New Internet Explorer code samples CSIEExplorerBar, VBIEExplorerBar Downloads: http://1code.codeplex.com/releases/view/62253#DownloadId=215060 http://1code.codeplex.com/releases/view/62253#DownloadId=215133 The sample demonstrates how to create and deploy an IE Explorer Bar which could list all the images in a web page. CSBrowserHelperObject, VBBrowserHelperObject Downloads: http://1code.codeplex.com/releases/view/62253#DownloadId=215044 http://1code.codeplex.com/releases/view/62253#DownloadId=215119 The sample demonstrates how to create and deploy a Browser Helper Object,  and the BHO in this sample is used to disable the context menu in IE. New Windows Workflow Foundation code samples CSWF4ActivitiesCorrelation Download: http://1code.codeplex.com/releases/view/62253#DownloadId=215085 Consider that there are two such workflow instances:       start                                   start          |                                           | Receive activity      Receive activity         |                                           | Receive2 activity      Receive2 activity         |                                           | A WCF request comes to call the second Receive2 activity. Which one should take care of the request? The answer is Correlation. This sample will show you how to correlate two workflow service to work together. -------------- New ASP.NET code samples CSASPNETBreadcrumbWithQueryString Download: http://1code.codeplex.com/releases/view/62253#DownloadId=215022

    Read the article

  • Differences Between NHibernate and Entity Framework

    - by Ricardo Peres
    Introduction NHibernate and Entity Framework are two of the most popular O/RM frameworks on the .NET world. Although they share some functionality, there are some aspects on which they are quite different. This post will describe this differences and will hopefully help you get started with the one you know less. Mind you, this is a personal selection of features to compare, it is by no way an exhaustive list. History First, a bit of history. NHibernate is an open-source project that was first ported from Java’s venerable Hibernate framework, one of the first O/RM frameworks, but nowadays it is not tied to it, for example, it has .NET specific features, and has evolved in different ways from those of its Java counterpart. Current version is 3.3, with 3.4 on the horizon. It currently targets .NET 3.5, but can be used as well in .NET 4, it only makes no use of any of its specific functionality. You can find its home page at NHForge. Entity Framework 1 came out with .NET 3.5 and is now on its second major version, despite being version 4. Code First sits on top of it and but came separately and will also continue to be released out of line with major .NET distributions. It is currently on version 4.3.1 and version 5 will be released together with .NET Framework 4.5. All versions will target the current version of .NET, at the time of their release. Its home location is located at MSDN. Architecture In NHibernate, there is a separation between the Unit of Work and the configuration and model instances. You start off by creating a Configuration object, where you specify all global NHibernate settings such as the database and dialect to use, the batch sizes, the mappings, etc, then you build an ISessionFactory from it. The ISessionFactory holds model and metadata that is tied to a particular database and to the settings that came from the Configuration object, and, there will typically be only one instance of each in a process. Finally, you create instances of ISession from the ISessionFactory, which is the NHibernate representation of the Unit of Work and Identity Map. This is a lightweight object, it basically opens and closes a database connection as required and keeps track of the entities associated with it. ISession objects are cheap to create and dispose, because all of the model complexity is stored in the ISessionFactory and Configuration objects. As for Entity Framework, the ObjectContext/DbContext holds the configuration, model and acts as the Unit of Work, holding references to all of the known entity instances. This class is therefore not lightweight as its NHibernate counterpart and it is not uncommon to see examples where an instance is cached on a field. Mappings Both NHibernate and Entity Framework (Code First) support the use of POCOs to represent entities, no base classes are required (or even possible, in the case of NHibernate). As for mapping to and from the database, NHibernate supports three types of mappings: XML-based, which have the advantage of not tying the entity classes to a particular O/RM; the XML files can be deployed as files on the file system or as embedded resources in an assembly; Attribute-based, for keeping both the entities and database details on the same place at the expense of polluting the entity classes with NHibernate-specific attributes; Strongly-typed code-based, which allows dynamic creation of the model and strongly typing it, so that if, for example, a property name changes, the mapping will also be updated. Entity Framework can use: Attribute-based (although attributes cannot express all of the available possibilities – for example, cascading); Strongly-typed code mappings. Database Support With NHibernate you can use mostly any database you want, including: SQL Server; SQL Server Compact; SQL Server Azure; Oracle; DB2; PostgreSQL; MySQL; Sybase Adaptive Server/SQL Anywhere; Firebird; SQLLite; Informix; Any through OLE DB; Any through ODBC. Out of the box, Entity Framework only supports SQL Server, but a number of providers exist, both free and commercial, for some of the most used databases, such as Oracle and MySQL. See a list here. Inheritance Strategies Both NHibernate and Entity Framework support the three canonical inheritance strategies: Table Per Type Hierarchy (Single Table Inheritance), Table Per Type (Class Table Inheritance) and Table Per Concrete Type (Concrete Table Inheritance). Associations Regarding associations, both support one to one, one to many and many to many. However, NHibernate offers far more collection types: Bags of entities or values: unordered, possibly with duplicates; Lists of entities or values: ordered, indexed by a number column; Maps of entities or values: indexed by either an entity or any value; Sets of entities or values: unordered, no duplicates; Arrays of entities or values: indexed, immutable. Querying NHibernate exposes several querying APIs: LINQ is probably the most used nowadays, and really does not need to be introduced; Hibernate Query Language (HQL) is a database-agnostic, object-oriented SQL-alike language that exists since NHibernate’s creation and still offers the most advanced querying possibilities; well suited for dynamic queries, even if using string concatenation; Criteria API is an implementation of the Query Object pattern where you create a semi-abstract conceptual representation of the query you wish to execute by means of a class model; also a good choice for dynamic querying; Query Over offers a similar API to Criteria, but using strongly-typed LINQ expressions instead of strings; for this, although more refactor-friendlier that Criteria, it is also less suited for dynamic queries; SQL, including stored procedures, can also be used; Integration with Lucene.NET indexer is available. As for Entity Framework: LINQ to Entities is fully supported, and its implementation is considered very complete; it is the API of choice for most developers; Entity-SQL, HQL’s counterpart, is also an object-oriented, database-independent querying language that can be used for dynamic queries; SQL, of course, is also supported. Caching Both NHibernate and Entity Framework, of course, feature first-level cache. NHibernate also supports a second-level cache, that can be used among multiple ISessionFactorys, even in different processes/machines: Hashtable (in-memory); SysCache (uses ASP.NET as the cache provider); SysCache2 (same as above but with support for SQL Server SQL Dependencies); Prevalence; SharedCache; Memcached; Redis; NCache; Appfabric Caching. Out of the box, Entity Framework does not have any second-level cache mechanism, however, there are some public samples that show how we can add this. ID Generators NHibernate supports different ID generation strategies, coming from the database and otherwise: Identity (for SQL Server, MySQL, and databases who support identity columns); Sequence (for Oracle, PostgreSQL, and others who support sequences); Trigger-based; HiLo; Sequence HiLo (for databases that support sequences); Several GUID flavors, both in GUID as well as in string format; Increment (for single-user uses); Assigned (must know what you’re doing); Sequence-style (either uses an actual sequence or a single-column table); Table of ids; Pooled (similar to HiLo but stores high values in a table); Native (uses whatever mechanism the current database supports, identity or sequence). Entity Framework only supports: Identity generation; GUIDs; Assigned values. Properties NHibernate supports properties of entity types (one to one or many to one), collections (one to many or many to many) as well as scalars and enumerations. It offers a mechanism for having complex property types generated from the database, which even include support for querying. It also supports properties originated from SQL formulas. Entity Framework only supports scalars, entity types and collections. Enumerations support will come in the next version. Events and Interception NHibernate has a very rich event model, that exposes more than 20 events, either for synchronous pre-execution or asynchronous post-execution, including: Pre/Post-Load; Pre/Post-Delete; Pre/Post-Insert; Pre/Post-Update; Pre/Post-Flush. It also features interception of class instancing and SQL generation. As for Entity Framework, only two events exist: ObjectMaterialized (after loading an entity from the database); SavingChanges (before saving changes, which include deleting, inserting and updating). Tracking Changes For NHibernate as well as Entity Framework, all changes are tracked by their respective Unit of Work implementation. Entities can be attached and detached to it, Entity Framework does, however, also support self-tracking entities. Optimistic Concurrency Control NHibernate supports all of the imaginable scenarios: SQL Server’s ROWVERSION; Oracle’s ORA_ROWSCN; A column containing date and time; A column containing a version number; All/dirty columns comparison. Entity Framework is more focused on Entity Framework, so it only supports: SQL Server’s ROWVERSION; Comparing all/some columns. Batching NHibernate has full support for insertion batching, but only if the ID generator in use is not database-based (for example, it cannot be used with Identity), whereas Entity Framework has no batching at all. Cascading Both support cascading for collections and associations: when an entity is deleted, their conceptual children are also deleted. NHibernate also offers the possibility to set the foreign key column on children to NULL instead of removing them. Flushing Changes NHibernate’s ISession has a FlushMode property that can have the following values: Auto: changes are sent to the database when necessary, for example, if there are dirty instances of an entity type, and a query is performed against this entity type, or if the ISession is being disposed; Commit: changes are sent when committing the current transaction; Never: changes are only sent when explicitly calling Flush(). As for Entity Framework, changes have to be explicitly sent through a call to AcceptAllChanges()/SaveChanges(). Lazy Loading NHibernate supports lazy loading for Associated entities (one to one, many to one); Collections (one to many, many to many); Scalar properties (thing of BLOBs or CLOBs). Entity Framework only supports lazy loading for: Associated entities; Collections. Generating and Updating the Database Both NHibernate and Entity Framework Code First (with the Migrations API) allow creating the database model from the mapping and updating it if the mapping changes. Extensibility As you can guess, NHibernate is far more extensible than Entity Framework. Basically, everything can be extended, from ID generation, to LINQ to SQL transformation, HQL native SQL support, custom column types, custom association collections, SQL generation, supported databases, etc. With Entity Framework your options are more limited, at least, because practically no information exists as to what can be extended/changed. It features a provider model that can be extended to support any database. Integration With Other Microsoft APIs and Tools When it comes to integration with Microsoft technologies, it will come as no surprise that Entity Framework offers the best support. For example, the following technologies are fully supported: ASP.NET (through the EntityDataSource); ASP.NET Dynamic Data; WCF Data Services; WCF RIA Services; Visual Studio (through the integrated designer). Documentation This is another point where Entity Framework is superior: NHibernate lacks, for starters, an up to date API reference synchronized with its current version. It does have a community mailing list, blogs and wikis, although not much used. Entity Framework has a number of resources on MSDN and, of course, several forums and discussion groups exist. Conclusion Like I said, this is a personal list. I may come as a surprise to some that Entity Framework is so behind NHibernate in so many aspects, but it is true that NHibernate is much older and, due to its open-source nature, is not tied to product-specific timeframes and can thus evolve much more rapidly. I do like both, and I chose whichever is best for the job I have at hands. I am looking forward to the changes in EF5 which will add significant value to an already interesting product. So, what do you think? Did I forget anything important or is there anything else worth talking about? Looking forward for your comments!

    Read the article

  • C#/.NET Fundamentals: Choosing the Right Collection Class

    - by James Michael Hare
    The .NET Base Class Library (BCL) has a wide array of collection classes at your disposal which make it easy to manage collections of objects. While it's great to have so many classes available, it can be daunting to choose the right collection to use for any given situation. As hard as it may be, choosing the right collection can be absolutely key to the performance and maintainability of your application! This post will look at breaking down any confusion between each collection and the situations in which they excel. We will be spending most of our time looking at the System.Collections.Generic namespace, which is the recommended set of collections. The Generic Collections: System.Collections.Generic namespace The generic collections were introduced in .NET 2.0 in the System.Collections.Generic namespace. This is the main body of collections you should tend to focus on first, as they will tend to suit 99% of your needs right up front. It is important to note that the generic collections are unsynchronized. This decision was made for performance reasons because depending on how you are using the collections its completely possible that synchronization may not be required or may be needed on a higher level than simple method-level synchronization. Furthermore, concurrent read access (all writes done at beginning and never again) is always safe, but for concurrent mixed access you should either synchronize the collection or use one of the concurrent collections. So let's look at each of the collections in turn and its various pros and cons, at the end we'll summarize with a table to help make it easier to compare and contrast the different collections. The Associative Collection Classes Associative collections store a value in the collection by providing a key that is used to add/remove/lookup the item. Hence, the container associates the value with the key. These collections are most useful when you need to lookup/manipulate a collection using a key value. For example, if you wanted to look up an order in a collection of orders by an order id, you might have an associative collection where they key is the order id and the value is the order. The Dictionary<TKey,TVale> is probably the most used associative container class. The Dictionary<TKey,TValue> is the fastest class for associative lookups/inserts/deletes because it uses a hash table under the covers. Because the keys are hashed, the key type should correctly implement GetHashCode() and Equals() appropriately or you should provide an external IEqualityComparer to the dictionary on construction. The insert/delete/lookup time of items in the dictionary is amortized constant time - O(1) - which means no matter how big the dictionary gets, the time it takes to find something remains relatively constant. This is highly desirable for high-speed lookups. The only downside is that the dictionary, by nature of using a hash table, is unordered, so you cannot easily traverse the items in a Dictionary in order. The SortedDictionary<TKey,TValue> is similar to the Dictionary<TKey,TValue> in usage but very different in implementation. The SortedDictionary<TKey,TValye> uses a binary tree under the covers to maintain the items in order by the key. As a consequence of sorting, the type used for the key must correctly implement IComparable<TKey> so that the keys can be correctly sorted. The sorted dictionary trades a little bit of lookup time for the ability to maintain the items in order, thus insert/delete/lookup times in a sorted dictionary are logarithmic - O(log n). Generally speaking, with logarithmic time, you can double the size of the collection and it only has to perform one extra comparison to find the item. Use the SortedDictionary<TKey,TValue> when you want fast lookups but also want to be able to maintain the collection in order by the key. The SortedList<TKey,TValue> is the other ordered associative container class in the generic containers. Once again SortedList<TKey,TValue>, like SortedDictionary<TKey,TValue>, uses a key to sort key-value pairs. Unlike SortedDictionary, however, items in a SortedList are stored as an ordered array of items. This means that insertions and deletions are linear - O(n) - because deleting or adding an item may involve shifting all items up or down in the list. Lookup time, however is O(log n) because the SortedList can use a binary search to find any item in the list by its key. So why would you ever want to do this? Well, the answer is that if you are going to load the SortedList up-front, the insertions will be slower, but because array indexing is faster than following object links, lookups are marginally faster than a SortedDictionary. Once again I'd use this in situations where you want fast lookups and want to maintain the collection in order by the key, and where insertions and deletions are rare. The Non-Associative Containers The other container classes are non-associative. They don't use keys to manipulate the collection but rely on the object itself being stored or some other means (such as index) to manipulate the collection. The List<T> is a basic contiguous storage container. Some people may call this a vector or dynamic array. Essentially it is an array of items that grow once its current capacity is exceeded. Because the items are stored contiguously as an array, you can access items in the List<T> by index very quickly. However inserting and removing in the beginning or middle of the List<T> are very costly because you must shift all the items up or down as you delete or insert respectively. However, adding and removing at the end of a List<T> is an amortized constant operation - O(1). Typically List<T> is the standard go-to collection when you don't have any other constraints, and typically we favor a List<T> even over arrays unless we are sure the size will remain absolutely fixed. The LinkedList<T> is a basic implementation of a doubly-linked list. This means that you can add or remove items in the middle of a linked list very quickly (because there's no items to move up or down in contiguous memory), but you also lose the ability to index items by position quickly. Most of the time we tend to favor List<T> over LinkedList<T> unless you are doing a lot of adding and removing from the collection, in which case a LinkedList<T> may make more sense. The HashSet<T> is an unordered collection of unique items. This means that the collection cannot have duplicates and no order is maintained. Logically, this is very similar to having a Dictionary<TKey,TValue> where the TKey and TValue both refer to the same object. This collection is very useful for maintaining a collection of items you wish to check membership against. For example, if you receive an order for a given vendor code, you may want to check to make sure the vendor code belongs to the set of vendor codes you handle. In these cases a HashSet<T> is useful for super-quick lookups where order is not important. Once again, like in Dictionary, the type T should have a valid implementation of GetHashCode() and Equals(), or you should provide an appropriate IEqualityComparer<T> to the HashSet<T> on construction. The SortedSet<T> is to HashSet<T> what the SortedDictionary<TKey,TValue> is to Dictionary<TKey,TValue>. That is, the SortedSet<T> is a binary tree where the key and value are the same object. This once again means that adding/removing/lookups are logarithmic - O(log n) - but you gain the ability to iterate over the items in order. For this collection to be effective, type T must implement IComparable<T> or you need to supply an external IComparer<T>. Finally, the Stack<T> and Queue<T> are two very specific collections that allow you to handle a sequential collection of objects in very specific ways. The Stack<T> is a last-in-first-out (LIFO) container where items are added and removed from the top of the stack. Typically this is useful in situations where you want to stack actions and then be able to undo those actions in reverse order as needed. The Queue<T> on the other hand is a first-in-first-out container which adds items at the end of the queue and removes items from the front. This is useful for situations where you need to process items in the order in which they came, such as a print spooler or waiting lines. So that's the basic collections. Let's summarize what we've learned in a quick reference table.  Collection Ordered? Contiguous Storage? Direct Access? Lookup Efficiency Manipulate Efficiency Notes Dictionary No Yes Via Key Key: O(1) O(1) Best for high performance lookups. SortedDictionary Yes No Via Key Key: O(log n) O(log n) Compromise of Dictionary speed and ordering, uses binary search tree. SortedList Yes Yes Via Key Key: O(log n) O(n) Very similar to SortedDictionary, except tree is implemented in an array, so has faster lookup on preloaded data, but slower loads. List No Yes Via Index Index: O(1) Value: O(n) O(n) Best for smaller lists where direct access required and no ordering. LinkedList No No No Value: O(n) O(1) Best for lists where inserting/deleting in middle is common and no direct access required. HashSet No Yes Via Key Key: O(1) O(1) Unique unordered collection, like a Dictionary except key and value are same object. SortedSet Yes No Via Key Key: O(log n) O(log n) Unique ordered collection, like SortedDictionary except key and value are same object. Stack No Yes Only Top Top: O(1) O(1)* Essentially same as List<T> except only process as LIFO Queue No Yes Only Front Front: O(1) O(1) Essentially same as List<T> except only process as FIFO   The Original Collections: System.Collections namespace The original collection classes are largely considered deprecated by developers and by Microsoft itself. In fact they indicate that for the most part you should always favor the generic or concurrent collections, and only use the original collections when you are dealing with legacy .NET code. Because these collections are out of vogue, let's just briefly mention the original collection and their generic equivalents: ArrayList A dynamic, contiguous collection of objects. Favor the generic collection List<T> instead. Hashtable Associative, unordered collection of key-value pairs of objects. Favor the generic collection Dictionary<TKey,TValue> instead. Queue First-in-first-out (FIFO) collection of objects. Favor the generic collection Queue<T> instead. SortedList Associative, ordered collection of key-value pairs of objects. Favor the generic collection SortedList<T> instead. Stack Last-in-first-out (LIFO) collection of objects. Favor the generic collection Stack<T> instead. In general, the older collections are non-type-safe and in some cases less performant than their generic counterparts. Once again, the only reason you should fall back on these older collections is for backward compatibility with legacy code and libraries only. The Concurrent Collections: System.Collections.Concurrent namespace The concurrent collections are new as of .NET 4.0 and are included in the System.Collections.Concurrent namespace. These collections are optimized for use in situations where multi-threaded read and write access of a collection is desired. The concurrent queue, stack, and dictionary work much as you'd expect. The bag and blocking collection are more unique. Below is the summary of each with a link to a blog post I did on each of them. ConcurrentQueue Thread-safe version of a queue (FIFO). For more information see: C#/.NET Little Wonders: The ConcurrentStack and ConcurrentQueue ConcurrentStack Thread-safe version of a stack (LIFO). For more information see: C#/.NET Little Wonders: The ConcurrentStack and ConcurrentQueue ConcurrentBag Thread-safe unordered collection of objects. Optimized for situations where a thread may be bother reader and writer. For more information see: C#/.NET Little Wonders: The ConcurrentBag and BlockingCollection ConcurrentDictionary Thread-safe version of a dictionary. Optimized for multiple readers (allows multiple readers under same lock). For more information see C#/.NET Little Wonders: The ConcurrentDictionary BlockingCollection Wrapper collection that implement producers & consumers paradigm. Readers can block until items are available to read. Writers can block until space is available to write (if bounded). For more information see C#/.NET Little Wonders: The ConcurrentBag and BlockingCollection Summary The .NET BCL has lots of collections built in to help you store and manipulate collections of data. Understanding how these collections work and knowing in which situations each container is best is one of the key skills necessary to build more performant code. Choosing the wrong collection for the job can make your code much slower or even harder to maintain if you choose one that doesn’t perform as well or otherwise doesn’t exactly fit the situation. Remember to avoid the original collections and stick with the generic collections.  If you need concurrent access, you can use the generic collections if the data is read-only, or consider the concurrent collections for mixed-access if you are running on .NET 4.0 or higher.   Tweet Technorati Tags: C#,.NET,Collecitons,Generic,Concurrent,Dictionary,List,Stack,Queue,SortedList,SortedDictionary,HashSet,SortedSet

    Read the article

  • CodePlex Daily Summary for Tuesday, November 08, 2011

    CodePlex Daily Summary for Tuesday, November 08, 2011Popular ReleasesFacebook C# SDK: v5.3.2: This is a RTW release which adds new features and bug fixes to v5.2.1. Query/QueryAsync methods uses graph api instead of legacy rest api. removed dependency from Code Contracts enabled Task Parallel Support in .NET 4.0+ (experimental) added support for early preview for .NET 4.5 (binaries not distributed in codeplex nor nuget.org, will need to manually build from Facebook-Net45.sln) added additional method overloads for .NET 4.5 to support IProgress<T> for upload progress added ne...Delete Inactive TS Ports: List and delete the Inactive TS Ports: List and delete the Inactive TS Ports - The InactiveTSPortList.EXE accepts command line arguments The InactiveTSPortList.Standalone.WithoutPrompt.exe runs as a standalone exe without the need for any command line arguments.ClosedXML - The easy way to OpenXML: ClosedXML 0.60.0: Added almost full support for auto filters (missing custom date filters). See examples Filter Values, Custom Filters Fixed issues 7016, 7391, 7388, 7389, 7198, 7196, 7194, 7186, 7067, 7115, 7144Microsoft Research Boogie: Nightly builds: This download category contains automatically released nightly builds, reflecting the current state of Boogie's development. We try to make sure each nightly build passes the test suite. If you suspect that was not the case, please try the previous nightly build to see if that really is the problem. Also, please see the installation instructions.DotSpatial: Release 821: Updated releaseGoogleMap Control: GoogleMap Control 6.0: Major design changes to the control in order to achieve better scalability and extensibility for the new features comming with GoogleMaps API. GoogleMap control switched to GoogleMaps API v3 and .NET 4.0. GoogleMap control is 100% ScriptControl now, it requires ScriptManager to be registered on the pages where and before it is used. Markers, polylines, polygons and directions were implemented as ExtenderControl, instead of being inner properties of GoogleMap control. Better perfomance. Better...WDTVHubGen - Adds Metadata, thumbnails and subtitles to WDTV Live Hubs: V2.1: Version 2.1 (click on the right) this uses V4.0 of .net Version 2.1 adds the following features: (apologize if I forget some, added a lot of little things) Manual Lookup with TV or Movie (finally huh!), you can look up a movie or TV episode directly, you can right click on anythign, and choose manual lookup, then will allow you to type anything you want to look up and it will assign it to the file you right clicked. No Rename: a very popular request, this is an option you can set so that t...SubExtractor: Release 1020: Feature: added "baseline double quotes" character to selector box Feature: added option to save SRT files as ANSI (instead of previous UTF-8 only) Feature: made "Save Sup files to Source directory" apply to both Sup and Idx source files. Fix: removed SDH text (...) or [...] that is split over 2 lines Fix: better decision-making in when to prefix a line with a '-' because SDH was removedAcDown????? - Anime&Comic Downloader: AcDown????? v3.6.1: ?? ● AcDown??????????、??????,??????????????????????,???????Acfun、Bilibili、???、???、???、Tucao.cc、SF???、?????80????,???????????、?????????。 ● AcDown???????????????????????????,???,???????????????????。 ● AcDown???????C#??,????.NET Framework 2.0??。?????"Acfun?????"。 ????32??64? Windows XP/Vista/7 ????????????? ??:????????Windows XP???,?????????.NET Framework 2.0???(x86)?.NET Framework 2.0???(x64),?????"?????????"??? ??????????????,??????????: ??"AcDown?????"????????? ?? v3.6.1?? ??.hlv...Track Folder Changes: Track Folder Changes 1.1: Fixed exception when right-clicking the root nodeMapWindow 4: MapWindow GIS v4.8.6 - Final release - 32Bit: This is the final release of MapWindow v4.8. It has 4.8.6 as version number. This version has been thoroughly tested. If you do get an exception send the exception to us. Don't forget to include your e-mail address. Use the forums at http://www.mapwindow.org/phorum/ for questions. Please consider donating a small portion of the money you have saved by having free GIS tools: http://www.mapwindow.org/pages/donate.php What’s New in 4.8.6 (Final release) · A few minor issues have been fixed Wha...Kinect Paint: Kinect Paint 1.1: Updated for Kinect for Windows SDK v1.0 Beta 2!Kinect Mouse Cursor: Kinect Mouse Cursor 1.1: Updated for Kinect for Windows SDK v1.0 Beta 2!Coding4Fun Kinect Toolkit: Coding4Fun Kinect Toolkit 1.1: Updated for Kinect for Windows SDK v1.0 Beta 2!Async Executor: 1.0: Source code of the AsyncExecutorMedia Companion: MC 3.421b Weekly: Ensure .NET 4.0 Full Framework is installed. (Available from http://www.microsoft.com/download/en/details.aspx?id=17718) Ensure the NFO ID fix is applied when transitioning from versions prior to 3.416b. (Details here) TV Show Resolutions... Fix to show the season-specials.tbn when selecting an episode from season 00. Before, MC would try & load season00.tbn Fix for issue #197 - new show added by 'Manually Add Path' not being picked up. Also made non-visible the same thing in Root Folders...?????????? - ????????: All-In-One Code Framework ??? 2011-11-02: http://download.codeplex.com/Project/Download/FileDownload.aspx?ProjectName=1codechs&DownloadId=216140 ??????,11??,?????20????Microsoft OneCode Sample,????6?Program Language Sample,2?Windows Base Sample,2?GDI+ Sample,4?Internet Explorer Sample?6?ASP.NET Sample。?????????????。 ????,?????。http://i3.codeplex.com/Project/Download/FileDownload.aspx?ProjectName=1code&DownloadId=128165 Program Language CSImageFullScreenSlideShow VBImageFullScreenSlideShow CSDynamicallyBuildLambdaExpressionWithFie...Python Tools for Visual Studio: 1.1 Alpha: We’re pleased to announce the release of Python Tools for Visual Studio 1.1 Alpha. Python Tools for Visual Studio (PTVS) is an open-source plug-in for Visual Studio which supports programming with the Python programming language. This release includes new core IDE features, a couple of new sample libraries for interacting with Kinect and Excel, and many bug fixes for issues reported since the release of 1.0. For the core IDE features we’ve added many new features which improve the basic edit...BExplorer (Better Explorer): Better Explorer 2.0.0.631 Alpha: Changelog: Added: Some new functions in ribbon Added: Possibility to choose displayed columns Added: Basic Search Fixed: Some bugs after navigation Fixed: Attempt to fix slow navigation and slow start Known issues: - BreadcrumbBar fails on some situations - Basic search does not work well in some situations Please if anyone finds bugs be kind and report them at the Issue Tracker! Thanks!DotNetNuke® Community Edition: 05.06.04: Major Highlights Fixed issue with upgrades on systems that had upgraded the Telerik library to 6.0.0 Fixed issue with Razor Host upgrade to 5.6.3 The logic for module administration checks contains incorrect logic in 1 place, opening the possibility of a user with edit permissions gaining access to functionality they should not have through a particularly crafted url Security FixesBrowsers support the ability to remember common strings such as usernames/addresses etc. Code was adde...New ProjectsAddThis for DotNetNuke: A simple AddThis module (plugin) for DotNetNukeAgnisExchange: <AGNIS>as A Growable Network Infor;ation System is developped in <C#>Blogger auto poster: Do you want to have a links blog? Share your favorites links in Google+ and then allow BAP(Blogger auto poster) to read its JSON feed and post its daily summary at your Blogger weblog automatically. CarbonEmissions: CarbonEmissionsCredivale: CredivaleCRM 2011 TreeView for Lookup: CRM 2011 WebResource Utility for showing Self-Joined Lookup data in TreeView form.Dafuscator: Dafuscator is a database data obfuscation system that allows you to tactically obfuscate or delete data out of your production database while leaving most of the data intact.DigDesDevSchoolHomeSaleSystem: This is study project. Done by Russian students. Use ASP.NET MVC.Dynamic Data Extensions: Dynamic Data Extensions add new features to the current ASP.Net 4 Dynamic Data versionEchosoft NoCrash From Scratch: Nocrash From scratch, a operating system designed (but not promised to be) almost invincible from viruses and %20 Windows-like using DoubleTime emulation to make it act like Windows 2000EdiProj: Just a PHP and Asp.Net project.experteer: decision theory class projectFlan Project: Fast-paced Action-RPG (2D Scrolling)GameXNA_Master: XNA MASETR GD 2011 Gyrf: SecretJogo Da Velha em CSharp: Jogo da velha feito para o curso de c#.Jogo das cores: Projeto da aula de extensão de C#Kookaburra: Kookaburra is a framework based on Windows PowerShell 2.0 that can be used for automating SharePoint 2010 administration. It contains a menu, several functions and a well defined structure for adding PowerShell scriptlets.LaunchWithParams: LaunchWithParams is a Windows Explorer add-on that allows you to launch an application executable with specific command-line parameters without having to open a command prompt.MerchantTribe - Shopping Cart and Ecommerce Platform in C# MVC ASP.NET: MerchantTribe is a free, open-source ASP.NET MVC ecommerce platform in C#. For more than a decade, we've been building and selling commercial .NET shopping cart software. Now, we're releasing an open-source project based on our award winning BV Commerce software. Thousands of companies use our shopping cart include Pebble Beach Resorts, DataPipe, TastyKake, MathBlaster and Chesapeake Energy. We need as many people as possible using MerchantTribe for it to thrive. We need Merchants, De...NaiveAlgorithms: Naive C# implementation of basic, general purpose algorithms, with an emphasis on readability, maintainability and correctness. While asymptotic complexity of algorithms is preserved, there is no premature optimisation performed to improve performance. NeonMikaWebserver: NeonMikaWebserver is easy to set up on your .Net MF device, as long as it has an ethernet port. It's espacially created for the Netduino, but I think it's no big work to port it to other plattforms. It provides the following functionalities: -XML Responses ... Just create an Instance of XMLResponse, give it an URI to listen for and fill a Hashtable with your response keys and values... Voila ;) -File Response ... No XML Response fitting your URL? Probably you want to watch a file sa...Next Action: The Next Action web application is a GTD task manager implemented with using MVC3, jQuery, Entity Framework. Orchard Comments Refactoring: Refactoring Orchard's comments moduleoutsource: outsourceScutex: Scutex, pronounced (sec-u-techs), is a 100% managed .Net Framework licensing platform for your applications. Scutex is a flexible licensing system allowing multiple licensing schemes allowing you the most control over how you licensing your products. Unlike any other licensing system on the market, Scutex provides 4 distinct licensing schemes, allowing you to protect your products at different levels using completely different licensing schemes, key types and protection systems. Using Scut...sigem2: Proyecto sigem2SSDL: An easy way to call and manage stored procedures in .NET.Trabalho C# - Datilografia: Software de datilografia produzido para o curso de extensão em C# da UFSCar Sorocaba.triliporra: Triliporra Euro 2012User Interface Toolkit: Ever dreamed about having one framework to write UI independently of your targetted client ? Now your dream has come true !vimrc: my vimrc fileVisuospatial Web Browsing using Kinect: The Kinect Web Browser project explores how users might use the Kinect sensor as a natural interface to browse the visual web. It's developed in C#.VNManager: VNManager or Version Number Manager is a simple Windows command line application which will update your Microsoft Visual Studio AssemblyInfo.cs files AssemblyVersion and AssemblyFileVersion attributes based on rules defined as comments on the same lines.WeddingAssistant: My site will be a ‘gift wish’ site for couples getting married. It will also be a place where people can come and look at ideas for hen and stag nights. Users log in and create a list of items they wish to receive for their wedding or look for ideas for hen and stag nights. The site will allow users to compile a list of items they have found on the internet from specific listed shops and order them in preference. The compiled list is then sent out to friends and relatives who can create a...WMS.NET: thewms is warehouse manager system! For the logistics industry! The team learning project! Built on the mvc3.0 and wcf ! Using jquery js framework as front endWorkflowRobot: Workflow based automation software.

    Read the article

  • MDI WinForm application and duplicate child form memory leak

    - by Steve
    This is a WinForm MDI application problem (.net framework 3.0). It will be described in C#. Sorry it is a bit long because I try to make things as clear as possible. I have a MDI application. At some point I find that one MDI child form is never released. There is a menu that creates the MDI child form and show it. When the MDI child form is closed, it is supposed to be destroyed and the memory taken by it should be given back to .net. But to my surprise, this is not true. All the MDI child form instances are kept in memory. This is obviously a "memory leak". Well, it is not a real leak in .net. It is just that I think the closed form should be dead but somehow there is at least one unknown reference from outside world that still connect with the closed form. I read some articles on the Web. Some says that when the MDI child form is closing, I should unwire all the event handlers, otherwise some event handlers may keep my form alive. Some says that DataBindings should be cleaned before the form is closing otherwise the DataBindings will add references to some global Hashtable and thus keep my form alive. My form contains quite a lot things. Many event handlers and many DataBindings and many BindingSources and few suspected controls containing user control and HelpProvider. I create a big method that unwires all the event handlers from all the relevant controls, clear all the DataBindings and DataSources. The HelpProvider and user controls are disposed carefully. At the end, I find that, I don't have to clear DataBindings and DataSources. Event handlers are definitely causing the problem. And MDI form structure also contributes to something. During my experiments, I find that, if you create a MDI child form, even if you close it, there will still be one instance in the memory. The reference is from PropertyStore of the main form. This means, unless the main form is closed (application ends), there will always be one instance of MDI child form in the memory. The good news is that, no matter how many times you open and close the child form, there will be only one instance, not a big "leak". When it comes to event handlers, things become more tricky. I have to address that, all the event handlers on my form are anonymous event handlers. Here is an example code: //On MDI child form's design code... Button btnSave = new Button(); btnSave.Click += new System.EventHandler(btnSave_Click); Where btnSave_Click is also a method in MDI child form. The above is always the case for various controls and various types of event. To me, this is a bi-directional circular reference. btnSave keeps a reference of MDI child form via the event handler. MDI child form keeps a reference of btnSave instance. To me again, such bi-directional circular reference should not cause any problem for .net's garbage collector. This means that I do not have to explicitly unwire the event when the form is being disposed: btnSave.Click -= btnSave_Click; But the truth is not so. For some event handlers, they are safe. Ignoring them do not cause any duplicate instance. For some other event handlers, they will cause one instance remaining in the memory (similar effect as the MDI form structure, but this time caused by the hanging event handlers). For some other event handlers, they will cause every instance opened in the memory. I am totally confused about the differences between these three types of event handlers. The controls are created in the same way and the event is attached in the same way. What is the difference? (Don't tell me it is the event handle methods that make difference.) Anyone has experience of this wired scenario and has an answer for me? Thanks a lot. So now, for safety issue, I will have to unwire all the event handlers when the form is being disposed. That will be a long list of similar code for each control. Is there a general way of removing events from controls in recursive way using reflection? What about performance issue? That's the end of my story and I am still in the middle of my problem. For any help, I thank you.

    Read the article

< Previous Page | 9 10 11 12 13 14  | Next Page >