Search Results

Search found 42264 results on 1691 pages for 'template method pattern'.

Page 131/1691 | < Previous Page | 127 128 129 130 131 132 133 134 135 136 137 138  | Next Page >

  • How can I use jQuery to match a string inside the current URL of the window I am in?

    - by Jannis
    Hi, I have used the excellent gskinner.com/RegExr/ tool to test my string matching regex but I cannot figure out how to implement this into my jQuery file to return true or false. The code I have is as follows: ^(http:)\/\/(.+\.)?(stackoverflow)\. on a url such as http://stackoverflow.com/questions/ask this would match (according to RegExr) http://stackoverflow. So this is great because I want to try matching the current window.location to that string, but the issue I am having is that this jQuery/js script does not work: var url = window.location; if ( url.match( /^(http:)\/\/(.+\.)?(stackoverflow)\./ ) ) { alert('this works'); }; Any ideas on what I am doing wrong here? Thanks for reading. Jannis

    Read the article

  • Adjust a Control Template and still respect the Theme of the OS?

    - by bitbonk
    In WPF how do I modifiy the template for a standard control in a way that it will respect the current Theme of the Operating System later on? If I just "edit a copy" of the template in blend, it will just give me the template of the currently running theme. Is this correct? So when I apply the modified template and run the app on different themes it will always look the same. For custom controls and even for data templates the problem is similar. How do I provide a template that respects all possible themes of the OS?

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • WPF HiercharchicalDataTemplate.DataType: How to react on interfaces?

    - by David Schmitt
    Problem I've got a collection of IThings and I'd like to create a HierarchicalDataTemplate for a TreeView. The straightforward DataType={x:Type local:IThing} of course doesn't work, probably because the WPF creators didn't want to handle the possible ambiguities. Since this should handle IThings from different sources at the same time, referencing the implementing class is out of question. Current solution For now I'm using a ViewModel which proxies IThing through a concrete implementation: public interface IThing { string SomeString { get; } ObservableCollection<IThing> SomeThings { get; } // many more stuff } public class IThingViewModel { public IThing Thing { get; } public IThingViewModel(IThing it) { this.Thing = it; } } <!-- is never applied --> <HierarchicalDataTemplate DataType="{x:Type local:IThing}"> <!-- is applied, but looks strange --> <HierarchicalDataTemplate DataType="{x:Type local:IThingViewModel}" ItemsSource="{Binding Thing.SomeThings}"> <TextBox Text="{Binding Thing.SomeString}"/> </HierarchicalDataTemplate> Question Is there a better (i.e. no proxy) way?

    Read the article

  • DDD: Getting aggregate roots for other aggregates

    - by Ed
    I've been studying DDD for the past 2 weeks, and one of the things that really stuck out to me was how aggregate roots can contain other aggregate roots. Aggregate roots are retrieved from the repository, but if a root contains another root, does the repository have a reference to the other repository and asks it to build the subroot?

    Read the article

  • How2 display Image from DB in datagrid?

    - by Saverio Tedeschi
    Hope it's not yet been answered, but I've googled for quite a long time, and I've not been able to get it working. In brief, I've a SL4 page with a DataGrid filled accordingly to parameters passed from the previous page, so I fill the context in code, with a "RIA" query (w/parameters as well). So far, so good. I get the XAML declared columns as expected but the Photo templated column, which holds just an image control. I think I can use the LoadingRow event, but can some1 give me some code on how to get my goal (image is in in the context from DB)? Thanks in advance

    Read the article

  • Sorting tree with a materialized path?

    - by Ovid
    I have a tree structure in a table and it uses materialized paths to allow me to find children quickly. However, I also need to sort the results depth-first, as one would expect with threaded forum replies. id | parent_id | matpath | created ----+-----------+---------+---------------------------- 2 | 1 | 1 | 2010-05-08 15:18:37.987544 3 | 1 | 1 | 2010-05-08 17:38:14.125377 4 | 1 | 1 | 2010-05-08 17:38:57.26743 5 | 1 | 1 | 2010-05-08 17:43:28.211708 7 | 1 | 1 | 2010-05-08 18:18:11.849735 6 | 2 | 1.2 | 2010-05-08 17:50:43.288759 9 | 5 | 1.5 | 2010-05-09 14:02:43.818646 8 | 6 | 1.2.6 | 2010-05-09 14:01:17.632695 So the final results should actually be sorted like this: id | parent_id | matpath | created ----+-----------+---------+---------------------------- 2 | 1 | 1 | 2010-05-08 15:18:37.987544 6 | 2 | 1.2 | 2010-05-08 17:50:43.288759 8 | 6 | 1.2.6 | 2010-05-09 14:01:17.632695 3 | 1 | 1 | 2010-05-08 17:38:14.125377 4 | 1 | 1 | 2010-05-08 17:38:57.26743 5 | 1 | 1 | 2010-05-08 17:43:28.211708 9 | 5 | 1.5 | 2010-05-09 14:02:43.818646 7 | 1 | 1 | 2010-05-08 18:18:11.849735 How would I work that out? Can I do that in straight SQL (this is PostgreSQL 8.4) or should additional information be added to this table?

    Read the article

  • Regular Expressions: Positive Lookahead and Word Border question

    - by Inf.S
    Hello again Stackoverflow people! Assume I have these words: smartphones, smartphone I want to match the substring "phone" from within them. However, in both case, I want only "phone" to be returned, not "phones" in the first case. In addition to this, I want matches only if the word "phone" is a suffix only, such that: fonephonetics (just an example) is not matched. I assumed that the regex (phone([?=s])?)\b would give me what I need, but it is currently matching "phones" and "phone", but not the "fonephonetics" one. I don't need "phones". I want "phone" for both cases. Any ideas about what is wrong, and what I can do? Thank you in advance!

    Read the article

  • PHP-REGEX: accented letters matches non-accented ones, and visceversa. How to achive it?

    - by Lightworker
    I want to do the typical higlight code. So I have something like: $valor = preg_replace("/(".$_REQUEST['txt_search'].")/iu", "<span style='background-color:yellow; font-weight:bold;'>\\1</span>", $valor); Now, the request word could be something like "josé". And with it, I want "jose" or "JOSÉ" or "José" or ... highlighted too. With this expression, if I write "josé", it matches "josé" and "JOSÉ" (and all the case variants). It always matches the accented variants only. If I search "jose", it matches "JOSE", "jose", "Jose"... but not the accented ones. So I've partially what I want, cause I have case insensitive on accented and non-accented separately. I need it fully combined, wich means accent (unicode) insensitive, so I can search "jose", and highlight "josé", "josÉ", "José", "JOSE", "JOSÉ", "JoSé", ... I don't want to do a replace of accents on the word, cause when I print it on screen I need to see the real word as it comes. Any ideas? Thanks!

    Read the article

  • Does .NET Regex support global matching?

    - by Dave
    I haven't been able to find anything online regarding this. There's RegexOptions, but it doesn't have Global as one of its options. The inline modifiers list also doesn't mention global matching. In a nutshell, I've got a regex to parse something like --arga= "arg1" --argb ="arg2" into separate argument name/value pairs using this regex: --(\\w+)\\s*=\\s*\"(\\w+)\"\\s* but the .NET Regex class doesn't do it globally (iteratively). So in order for me to get this to work, I'd have to do a match, then remove this from the argument string, and loop over and over again until I've exhausted all of the arguments. It would be nicer to run the regex once, and then loop over the match groups to get the name value pairs. Is this possible? What am I missing?

    Read the article

  • is there a way to generate pdf containing non-ascii symbols with pisa from django template?

    - by mihailt
    Hi. i'm trying to generate a pdf from template using this snippet: def write_pdf(template_src, context_dict): template = get_template(template_src) context = Context(context_dict) html = template.render(context) result = StringIO.StringIO() pdf = pisa.pisaDocument(StringIO.StringIO(html.encode("UTF-8")), result) if not pdf.err: return http.HttpResponse(result.getvalue(), mimetype='application/pdf') except Exception('PDF error') but all non-latin symbols are not showing correctly, the template and view are saved using utf-8 encoding. i've tried saving view as ANSI and then to user unicode(html,"UTF-8"), but it throws TypeError. Also i thought that maybe it's because the default fonts somehow do not support utf-8 so according to pisa documentation i tried to set fontface in template body in style section. that still gave no results. Does any one have some ideas how to solve this issue?

    Read the article

  • What software do you use for letter templating and printing?

    - by Pratik
    In our LOB application there is a very important use case of printing letters, which are then printed and posted out from a mail house (thousands per day). The current situation is that the letter templates are created in Word 97 and fields are mail merged from values in database using a VB.Net application that basically uses word automation. But depending on Word 97 is not a good idea today. We only have a couple of PCs that have Word 97 installed as rest of the company has moved to Office 2007. What software or technology (compatible with .Net) is available today that best suits this scenario. Is it better to do the same thing but move to Word 2007 or PDF or something else. Price may not be a factor. The important thing is that the letter templates must be designed by business users and data to fill placeholders come from DB. A bonus would be to import the hundreds of existing Word 97 letter templates without rewriting them from scratch.

    Read the article

  • Multi-tenant Access Control: Repository or Service layer?

    - by FreshCode
    In a multi-tenant ASP.NET MVC application based on Rob Conery's MVC Storefront, should I be filtering the tenant's data in the repository or the service layer? 1. Filter tenant's data in the repository: public interface IJobRepository { IQueryable<Job> GetJobs(short tenantId); } 2. Let the service filter the repository data by tenant: public interface IJobService { IList<Job> GetJobs(short tenantId); } My gut-feeling says to do it in the service layer (option 2), but it could be argued that each tenant should in essence have their own "virtual repository," (option 1) where this responsibility lies with the repository. Which is the most elegant approach: option 1, option 2 or is there a better way? Update: I tried the proposed idea of filtering at the repository, but the problem is that my application provides the tenant context (via sub-domain) and only interacts with the service layer. Passing the context all the way to the repository layer is a mission. So instead I have opted to filter my data at the service layer. I feel that the repository should represent all data physically available in the repository with appropriate filters for retrieving tenant-specific data, to be used by the service layer. Final Update: I ended up abandoning this approach due to the unnecessary complexities. See my answer below.

    Read the article

  • 'javadoc' look-a-like, using parser generator?

    - by wvd
    Hello all, I'm going to create a javadoc look-a-like for the language I'm mainly using, but I was wondering - is it worth to use a parser generator for this? The main idea to use a parser generator was because I could use templates for the HTML code which could be exported then. Also I could also use PDF templates if I need it. Thanks, William v. Doorn

    Read the article

  • Looking for fastest and least-programming-required path to implement a web site with user submitted

    - by Howiecamp
    I'm looking to throw up a web site that supports user submitted entries and allows voting and comments. Similar in form and function to FMyLife. Basic requirements of site: Users can submit text entries - generally 1 liners Enters can be up or down voted Comments allowed - presentation collapseable Would like the fastest path possible. Ideal solution is configurable vs requirement for programming.

    Read the article

  • Apache URL rewrite query

    - by ant-1980
    Can anyone tell me how to do this? i'm stumped! I need a modified URL in this format this55-is-a-test-id-23.html But I need the 23 as a GET. I can't rely on searching for 'id' as this may occur elsewhere in the URL. Is there any way of searching for the last occurrence of id and passing that as a get using an Apache RewriteRule in .htaccess?? Many thanks Ant

    Read the article

  • Comparing 2 columns in the same table with the "Like" function

    - by Vic
    I'm trying to come up with a way to query the values in two different columns in the same table where the result set will indicate instances where the value of columnB doesn't contain the value of columnA. For example, my "Nodes" table contains columns "NodeName" and "DNS". The values should look similar to the following: NodeName DNS Router1 Router1.mydomain.com I want to run a query to show which rows have a DNS value that does not contain (or begin with) the value of the NodeName field. I think the query should function something similar to the following, but obviously I'm missing something with regard to the use of "Like" in this situation. SELECT NodeName, DNS WHERE DNS NOT LIKE 'NodeName%' I'm using SQL Server 2005, and any suggestions would be greatly appreciated... :)

    Read the article

  • How can I extract the nth occurrence of a match in a Perl regex?

    - by Zaid
    Is it possible to extract the n'th match in a string of single-quoted words? use strict; use warnings; my $string1 = '\'I want to\' \'extract the word\' \'Perl\',\'from this string\''; my $string2 = '\'What about\',\'getting\',\'Perl\',\'from\',\'here\',\'?\''; sub extract_quoted { my ($string, $index) = @_; my ($wanted) = $string =~ /some_regex_using _$index/; return $wanted; } extract_wanted ($string1, 3); # Should return 'Perl', with quotes extract_wanted ($string2, 3); # Should return 'Perl', with quotes

    Read the article

  • beginner's ruby question: how to use erb to output file after binding

    - by john
    Hi, I got the following example: require 'erb' names = [] names.push( { 'first' => "Jack", 'last' => "Herrington" } ) names.push( { 'first' => "LoriLi", 'last' => "Herrington" } ) names.push( { 'first' => "Megan", 'last' => "Herrington" } ) myname = "John Smith" File.open( ARGV[0] ) { |fh| erb = ERB.new( fh.read ) print erb.result( binding ) accompanied by text.txt <% name = "Jack" %> Hello <%= name %> <% names.each { |name| %> Hello <%= name[ 'first' ] %> <%= name[ 'last' ] %> <% } %> hi, my name is <%= myname %> } it prints nicely to screen. what is the simplest way to output another file: "text2.txt"? thank you!!!

    Read the article

  • Display content in folder like Wordpress displays Themes

    - by Mestika
    Hi, I’ve throughout the last couple of years downloaded a lot of templates for websites and these are now starting to become chaotic in the different folders so I’m starting to get a overview of the different templates. Regarding to this I was thinking about the way that WordPress displays the different themes installed in the themes folder. It provides a small overview (thumbnail) of the theme and a possibility to preview the theme. Of cause, I don’t need or want such a advanced system as Wordpress but I’m attractive to the idea of displaying my templates in the same kind of manner and without using a Database. I’ve played around with different directory management scripts and tools for PHP but the best result I’ve got so fare is just to display the different content in the different folders but not create a preview which in each preview it will use the webpage itself and it’s stylesheets, images, etc. Does anyone have an idea how to create such a script or have a link to a already existing script. Of cause is all the main pages named index.htm / .html Sincere Mestika

    Read the article

  • How can I substitute the nth occurrence of a match in a Perl regex?

    - by Zaid
    Following up from an earlier question on extracting the n'th regex match, I now need to substitute the match, if found. I thought that I could define the extraction subroutine and call it in the substitution with the /e modifier. I was obviously wrong (admittedly, I had an XY problem). use strict; use warnings; sub extract_quoted { # à la codaddict my ($string, $index) = @_; while($string =~ /'(.*?)'/g) { $index--; return $1 if(! $index); } return; } my $string = "'How can I','use' 'PERL','to process this' 'line'"; extract_quoted ( $string, 3 ); $string =~ s/&extract_quoted($string,2)/'Perl'/e; print $string; # Prints 'How can I','use' 'PERL','to process this' 'line' There are, of course, many other issues with this technique: What if there are identical matches at different positions? What if the match isn't found? In light of this situation, I'm wondering in what ways this could be implemented.

    Read the article

  • django link to any user profile in social comunity

    - by dana
    i am trying to build a virtual comunity, and i have a profile page, and a personal page. In the profile page, one can see only the posts of one user(the user whos profile is checked), in the personal page one can see his posts, plus all the posts he has subscribed to (just like in Facebook) it's a little confusing for me how i can link to the profile of one user, i mean when anybody clicks on a username, it should link to his personal profile page. for example, if someone searches name "abc", the rsult would be "abc",and link to his profile. How can i pass to one function the username or id of a linked user? i mean, showing the profile of the logged in user who is checking his profile is quite easy.But how about another user profile, if one wants to access it? thanks a lot!

    Read the article

< Previous Page | 127 128 129 130 131 132 133 134 135 136 137 138  | Next Page >