Search Results

Search found 4625 results on 185 pages for 'split tunnel'.

Page 133/185 | < Previous Page | 129 130 131 132 133 134 135 136 137 138 139 140  | Next Page >

  • remove the spaces...

    - by tekknolagi
    !/usr/bin/python import random lower_a = ['a', 'b', 'c', 'd', 'e', 'f', 'g', 'h', 'i', 'j', 'k', 'l', 'm', 'n', 'o', 'p', 'q', 'r', 's', 't', 'u', 'v', 'w', 'x', 'y', 'z'] upper_a = ['A', 'B', 'C', 'D', 'E', 'F', 'G', 'H', 'I', 'J', 'K', 'L', 'M', 'N', 'O', 'P', 'Q', 'R', 'S', 'T', 'U', 'V', 'W', 'X', 'Y', 'Z'] num = ['0', '1', '2', '3', '4', '5', '6', '7', '8', '9'] all = [] all = " ".join("".join(lower_a) + "".join(upper_a) + "".join(num)) all = all.split() x = 0 while x < 10: for i in range(7): a = random.choice(all) print a, print x += 1 what i want to do is remove the spaces from the output what it gives now is Z 3 a A I K R G B i N 9 c E v g E r A N 8 e B 6 d v H O c a V 8 c x y b g 2 W a T T f 8 H T r 6 E p D K l 5 p u x q 8 P Z 9 T n I W X n B Q

    Read the article

  • MS Access Crashed an now all Form objects and code modules are missing

    - by owlie
    I was adding a form to our Access 07 db. I copied an existing form to use as a template, renamed it, and saved it. I opened a different form to check something and Access crashed. When I reopened the database it says: "Access has detected that this database is in an inconsistent state, and will attempt to recover the database." etc. When it reopened - all forms and reports were missing. Saved queries remain. The error message states that object recovery failures will be noted in a Recovery Errors table - but this table wasn't created. The links to the be database remained intact. The database is split - I was experimenting with a form on a front-end copy which might have something to do with it. Any ideas what would cause this (I can see loosing recent work - but nixing all form objects?!) And is there any chance of recovery?

    Read the article

  • handling matrix data in python

    - by Ovisek
    I was trying to progressively subtract values of a 3D matrix. The matrix looks like: ATOM 1223 ZX SOD A 11 2.11 -1.33 12.33 ATOM 1224 ZY SOD A 11 -2.99 -2.92 20.22 ATOM 1225 XH HEL A 12 -3.67 9.55 21.54 ATOM 1226 SS ARG A 13 -6.55 -3.09 42.11 ... here the last three columns are representing values for axes x,y,z respectively. now I what I wanted to do is, take the values of x,y,z for 1st line and subtract with 2nd,3rd,4th line in a iterative way and print the values for each axes. I was using: for line in map(str.split,inp): x = line[-3] y = line[-2] z = line[-1] for separating the values, but how to do in iterative way. should I do it by using Counter.

    Read the article

  • Problem in appending a string to a already filled string builder(at the beginning by using INSERT) a

    - by Newbie
    I have a string builder like StringBuilder sb = new StringBuilder("Value1"); sb.AppendLine("Value2"); Now I have a string say string str = "value 0"; I did sb.Insert(0,str); and then string[] strArr = sb.ToString().Trim().Replace("\r", string.Empty).Split('\n'); The result I am getting as (Array size of 2 where I should get 3) [0] value 0 Value1 [1] value2 But the desired output being [0] Value 0 [1] Value1 [2] Value2 Where I am going wrong? I am using C#3.0 Please help.. It 's urgent Thanks

    Read the article

  • How do I get artifacts from one Maven module included in the resources of another in my build?

    - by Hanno Fietz
    I have Maven modules that produce a Flex application as an SWF file. I want to include that file in a web application that is made with another Maven module from the same build. I'm wondering how and at which lifecycle phase I get Maven to grab the artifact from the other module and put it insode the appropriate folder of the webapp module. Would I use a separate assembly module? The web app is running on a Jetty server in an OSGi environment (using Pax), the server side of the web app uses Struts. The final artifact as I see it would be a WAR file including my Action etc classes, JSP templates, static contents such as CSS or JS, and the SWF movies. I might be better off with these split over some other setup, but right now, I wouldn't know which.

    Read the article

  • textarea into array javascript

    - by user281180
    myList contains the following values: value1 value2 value3 function showArray() { var txt = $("#myList").text(); var textread = txt.split('\n'); var msg = ""; for (var i = 0; i < textread .length; i++) { msg += i + ": " + textread [i] + "\n"; } alert(msg); } my alert gives me the following: 0:value1 value2 value3 It`s not what I wanted and expecting, I was expecting something like: 0: value1 1: value2 2: value3 How can I get the values as expected?

    Read the article

  • How can I optimize this code?

    - by loop0
    Hi, I'm developing a logger daemon to squid to grab the logs on a mongodb database. But I'm experiencing too much cpu utilization. How can I optimize this code? from sys import stdin from pymongo import Connection connection = Connection() db = connection.squid logs = db.logs buffer = [] a = 'timestamp' b = 'resp_time' c = 'src_ip' d = 'cache_status' e = 'reply_size' f = 'req_method' g = 'req_url' h = 'username' i = 'dst_ip' j = 'mime_type' L = 'L' while True: l = stdin.readline() if l[0] == L: l = l[1:].split() buffer.append({ a: float(l[0]), b: int(l[1]), c: l[2], d: l[3], e: int(l[4]), f: l[5], g: l[6], h: l[7], i: l[8], j: l[9] } ) if len(buffer) == 1000: logs.insert(buffer) buffer = [] if not l: break connection.disconnect()

    Read the article

  • can list be converted into string

    - by PARIJAT
    Actually i have extracted some data from the file and want to write it in the file 2 but the program says 'sequence item 1: expected string, list found', I want to know how i can convert buffer[] ie string into sequence, so that it could be saved in file 2...I am new to the python please help* file = open('/ddfs/user/data/k/ktrip_01/hmm.txt','r') file2 = open('/ddfs/user/data/k/ktrip_01/hmm_write.txt','w') buffer = [] rec = file.readlines() for line in rec : field = line.split() print '>',field[0] term = field[0] buffer.append(term) print field[1], field[2], field[6], field[12] term1 = field [1] buffer.append(term1) term2 = field[2] buffer.append[term2] term3 = field[6] buffer.append[term3] term4 = field[12] buffer.append[term4] file2.write(buffer) file.close() file2.close()

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • How to run a module

    - by Jimmy
    I have a module file containing the following functions: def replace(filename): match = re.sub(r'[^\s^\w]risk', 'risk', filename) return match def count_words(newstring): from collections import defaultdict word_dict=defaultdict(int) for line in newstring: words=line.lower().split() for word in words: word_dict[word]+=1 for word in word_dict: if'risk'==word: return word, word_dict[word] when I do this in IDLE: >>> mylist = open('C:\\Users\\ahn_133\\Desktop\\Python Project\\test10.txt').read() >>> newstrings=replace(mylist) ### This works fine. >>> newone=count_words(newstrings) ### This leads to the following error. I get the following error: Traceback (most recent call last): File "<pyshell#134>", line 1, in <module> newPH = replace(newPassage) File "C:\Users\ahn_133\Desktop\Python Project\text_modules.py", line 56, in replace match = re.sub(r'[^\s^\w]risk', 'risk', filename) File "C:\Python27\lib\re.py", line 151, in sub return _compile(pattern, flags).sub(repl, string, count) TypeError: expected string or buffer Is there anyway to run both functions without saving newstrings into a file, opening it using readlines(), and then running count_words function?

    Read the article

  • python: creating a list inside a dictionary

    - by user1871081
    I just started using python and I'm trying to create a program that will read a file that looks like this: AAA x 111 AAB x 111 AAA x 112 AAC x 123 ... the file is 50 lines long and I'm trying to make the letters into keys in a dictionary and the numbers lists that correspond with the keys. I want the output to look like this: {AAA: ['111', '112'], AAB: ['111'], AAC: [123], ...} This is what I've tried file = open("filename.txt", "r") readline = file.readline().rstrip() while readline!= "": list = [] list = readline.split(" ") j = list.index("x") k = list[0:j] v = list[p + 1:] d = {} if k in d == False d[k] = [] d[k].append(v) else d[k].append(v) readline = file.readline().rstrip() I keep getting syntax errors on my if statement and I can't figure out what I've done wrong.

    Read the article

  • Normalizing Strings using Regexes

    - by RasputinJones
    How do I match this string "1 & 2" from this string "Foo Bar 1 & 2"? How do I match this string "1, 2 & 3" from this string "Foo Baz 1, 2 & 3"? Trying to split out "Foo Bar" from the string using regexes while using the presence of "1 & 2" or "1, 2 & 3" as conditionals to normalize these strings into "Foo Bar 1" and "Foo Bar 2" or "Foo Baz 1", "Foo Baz 2" and "Foo Baz 3" respectively.

    Read the article

  • Show elipses where text will be truncated as per iTunes

    - by Burt
    I a building an application with a similar layout to iTunes i.e. it has a sidebar that doubles as a menu. Some of the text will exceed the boundary and rather that having it be truncated I would like to show ellipses (see line image below "Purchased on My iPh..."). How would I go about this in WPF? Suppose I made the boundary movable i.e. user can change the size of the panel (split panel in Windows Forms), how would I go about dynamically showing the ellipses/text? Thanks in advance, B

    Read the article

  • Strange python error

    - by Werner
    Hi, I am trying to write a python program that calculates a histogram, given a list of numbers like: 1 3 2 3 4 5 3.2 4 2 2 so the input parameters are the filename and the number of intervals. The program code is: #!/usr/bin/env python import os, sys, re, string, array, math import numpy Lista = [] db = sys.argv[1] db_file = open(db,"r") ic=0 nintervals= int(sys.argv[2]) while 1: line = db_file.readline() if not line: break ll=string.split(line) #print ll[6] Lista.insert(ic,float(ll[0])) ic=ic+1 lmin=min(Lista) print "min= ",lmin lmax=max(Lista) print "max= ",lmax width=666.666 width=(lmax-lmin)/nintervals print "width= ",width nelements=len(Lista) print "nelements= ",nelements print " " Histogram = numpy.zeros(shape=(nintervals)) for item in Lista: #print item int_number = 1 + int((item-lmin)/width) print " " print "item,lmin= ",item,lmin print "(item-lmin)/width= ",(item-lmin)," / ",width," ====== ",(float(item)-float(lmin))/float(width) print "int((item-lmin)/width)= ",int((item-lmin)/width) print item , " belongs to interval ", int_number, " which is from ", lmin+width*(int_number-1), " to ",lmin+width*int_number Histogram[int_number] = Histogram[int_number] + 1 4 but somehow I am completely lost, I get strange errors, can anybody help¿ Thanks

    Read the article

  • best practice for Jquery plugin implementation and resource locations

    - by ptutt
    This is probably a very basic question, but I seem to have issues plugging in jquery plug-ins. The issue seems to be around the location of the script, css and images and ensuring the css has the correct url to the images. The standard plug-in has the following folder structure (eg : JPicker) js css images My project is asp.net mvc so I have the default: scripts images content So, I try to split the jquery plugin to the appropriate folders (not sure if this is the best way?). Then I try to correct the references to images (background urls) in the css. I believe the url is relative to the page that is implementing the css file, not the location of the css file itself. Anyway, when I try the above, the plugins don't seem to work. I believe the issue lies with the images not being found. The jquery code runs without errors, so I assume that's not the problem. Any help/advice much appreciated

    Read the article

  • How to distribute the chance to display each SWF evenly among banner collection?

    - by Michael Mao
    Hi all: I am working on The ausdcf.org to try adding several banner ads in swf format to the top. Everything starts to work, but I've got several questions that need your help: The client chose not to go with Google AdManager, but prefer a "minimal approach" to do this task. What I am trying to do is sort of "mimicking" the way Google AdManager does for banners, that is, to split the chance of each particular swf to be shown to the visitor evenly among the banner collection. Definitely I can add some jQuery code to do this from client-side, a random number generator and if-else statement would work - just $.load() it! However, what if I'd like to make sure those disabled Javascript (is there any now btw?) still be able to see different swfs in each visit. Any suggestion on how to approach this? Many thanks in advance.

    Read the article

  • What is the best way to partition large tables in SQL Server?

    - by RyanFetz
    In a recent project the "lead" developer designed a database schema where "larger" tables would be split across two seperate databases with a view on the main database which unioned the two seperate database-tables together. The main database is what the application was driven off of so these tables looked and felt like ordinary tables (except some quirkly things around updating). This seemed like a HUGE performance problem. We do see problems with performance around these tables but nothing to make him change his mind about his design. Just wondering what is the best way to do this, or if it is even worth doing?

    Read the article

  • How to Best Setup a Website Project in VS.NET

    - by Jason
    I have very little experience with setting up a website from scratch in a .NET environment. As I am doing this now, I am wondering - what's the best way to go? Is it better to create a new Website Project, and include the various backend services and database code as part of that project, or is it better to split out the various aspects of the project? If the second, how would I go about doing that? I want to ensure that this project is easy to manage in the future (in terms of source control, deployment, etc), so I want to make sure I'm starting off on the right foot. I was unable to find any tutorials online, but if you have any, I would appreciate those as well. Thanks!

    Read the article

  • Have anyone ever create/manipulate a table application from the ground up/scratch?

    - by Darwin
    Have anyone ever create/manipulate a table application from the ground up/scratch? I want to create a table using flash AS 3. I like to have the features like to the MS Studio Web Developer option. The options are create a table, merge cells, split cell, resize columns, delete cell, delete row, delete column etc... I think this is going to be very complicated thing to do. I think the only way to do it is to build it from the ground up because I don’t think Flash has the library/component for it. I was able to create rows and columns by creating the # of rectangles listed it from the left to the right and move the next coordinate for the next row. Now the most challenging this is to manipulate it. This is the must have feature on my website and we don’t want use Javascript to create table on the server side to create the table.

    Read the article

  • GWT: how to have different styles for splitters in different SplitLayoutPanels?

    - by user26270
    I know you can change the styles of the splitters with the defaults styles listed in the docs: .gwt-SplitLayoutPanel .gwt-SplitLayoutPanel-HDragger { horizontal dragger } .gwt-SplitLayoutPanel .gwt-SplitLayoutPanel-VDragger { vertical dragger } and we've done that in earlier development. However, now I'm developing new stuff and would like to use a different style for the splitters in a new SplitLayoutPanel. Unfortunately, we haven't or can't split the app into different modules, which might make this easier. I tried creating a new style and applying it to my new SplitLayoutPanel, but it didn't appear to have any effect on the splitters. I thought there might be a method to get a handle on the splitters in order to apply the new style to only them, but I didn't find any such method.

    Read the article

  • Length of text that can just fit into one screen without scrolling

    - by KailZhang
    I find some iphone book apps have such feature: One screen one page of text without scrolling. The text can just fit into the whole screen with linebreaks and indentations. I'm curious of how to implement this. How could I decide the length of text that just fit into the screen. And also, given the whole text, I can calculate out the number of pages. If this is not possible to be done on iPhone(runtime?), then is it possible to process the text before storing it in app? I mean I calculate how many pages I need(how to split the raw text), probably how many lines per page.

    Read the article

  • problem in extracting the data from text file

    - by parijat24
    hello , i am new to python , and I want to extract the data from this format FBpp0143497 5 151 5 157 PF00339.22 Arrestin_N Domain 1 135 149 83.4 1.1e-23 1 CL0135 FBpp0143497 183 323 183 324 PF02752.15 Arrestin_C Domain 1 137 138 58.5 6e-16 1 CL0135 FBpp0131987 60 280 51 280 PF00089.19 Trypsin Domain 14 219 219 127.7 3.7e-37 1 CL0124 to this format FBpp0143497 5 151 Arrestin_N 1.1e-23 FBpp0143497 183 323 Arrestin_C 6e-16 I have written code in hope that it works but it does not work , please help! file = open('/ddfs/user/data/k/ktrip_01/hmm.txt','r') rec = file.read() for line in rec : field = line.split("\t") print field print field[:] print '>',field[0] print field[1], field[2], field[6], field[12] the hmmtext file is FBpp0143497 5 151 5 157 PF00339.22 Arrestin_N Domain 1 135 149 83.4 1.1e-23 1 CL0135 FBpp0143497 183 323 183 324 PF02752.15 Arrestin_C Domain 1 137 138 58.5 6e-16 1 CL0135 FBpp0131987 60 280 51 280 PF00089.19 Trypsin Domain 14 219 219 127.7 3.7e-37 1 CL0124

    Read the article

  • Parse items from text file

    - by chris
    I have a text file that includes data inside {[]} tags. What would be the suggested way to parse that data so I can just use the data inside the tags? Example text file would look like this: 'this is a bunch of text that is not {[really]} useful in any {[way]}. I need to {[get]} some items {[from]} it.' I would like to end up with 'really', 'way', 'get', 'from' in a list. I guess I could use split to do it.. but seems like there might be a better way out there. I have seen a ton parsing libraries, is there one that would be perfect for what I want to do?

    Read the article

  • how to query sqlite for certain rows, i.e. dividing it into pages (perl DBI)

    - by user1380641
    sorry for my noob question, I'm currently writing a perl web application with sqlite database behind it. I would like to be able to show in my app query results which might get thousands of rows - these should be split in pages - routing should be like /webapp/N - where N is the page number. what is the correct way to query the sqlite db using DBI, in order to fetch only the relavent rows. for instance, if I show 25 rows per page so I want to query the db for 1-25 rows in the first page, 26-50 in the second page etc.... Thanks in advanced!

    Read the article

  • Targeting row when responding with js rails

    - by berto77
    I have an application where a user can vote on reviews. They can vote up or down. Now when there's a listing of reviews, I have a problem targeting the review the user voted on. I'm using a respon_to block in my rails controller and responding with js. So for instance, I have a vote_up method, and a vote_up.js.erb template. in that template, I have the following: var id = $('article.comment').attr('id').split('_')[1]; alert("id: " + id); $('.votecomment_' + id).find('.score').html("<%= @review2.vote_total %>"); I'm just alerting the id. The problem is that the id always returns the value of the first review found on the page. How can I pass the context aka this, to javascript, so I can figure out which review to target?

    Read the article

< Previous Page | 129 130 131 132 133 134 135 136 137 138 139 140  | Next Page >