Search Results

Search found 13693 results on 548 pages for 'python metaprogramming'.

Page 136/548 | < Previous Page | 132 133 134 135 136 137 138 139 140 141 142 143  | Next Page >

  • Can't get MySQL source query to work using Python mysqldb module

    - by Chris
    I have the following lines of code: sql = "source C:\\My Dropbox\\workspace\\projects\\hosted_inv\\create_site_db.sql" cursor.execute (sql) When I execute my program, I get the following error: Error 1064: You have an error in your SQL syntax; check the manual that corresponds to your MySQL server version for the right syntax to use near 'source C:\My Dropbox\workspace\projects\hosted_inv\create_site_db.sql' at line 1 Now I can copy and past the following into mysql as a query: source C:\\My Dropbox\\workspace\\projects\\hosted_inv\\create_site_db.sql And it works perfect. When I check the query log for the query executed by my script, it shows that my query was the following: source C:\\My Dropbox\\workspace\\projects\\hosted_inv\\create_site_db.sql However, when I manually paste it in and execute, the entire create_site_db.sql gets expanded in the query log and it shows all the sql queries in that file. Am I missing something here on how mysqldb does queries? Am I running into a limitation. My goal is to run a sql script to create the schema structure, but I don't want to have to call mysql in a shell process to source the sql file. Any thoughts? Thanks!

    Read the article

  • Python: Split by 1 or more occurrences of a delimiter

    - by Adam Matan
    Hi, I have a formatted string from a log file, which looks like: >>> a="test result" That is, the test and the result are split by some spaces - it was probably created using formatted string which gave test some constant spacing. Simple splitting won't do the trick: >>> a.split(" ") ['test', '', '', '', ... '', '', '', '', '', '', '', '', '', '', '', 'result'] split(DELIMITER, COUNT) cleared some unnecessary values: >>> a.split(" ",1) ['test', ' result'] This helped - but of course, I really need: ['test', 'result'] I can use split() followed by map + strip(), but I wondered if there is a more Pythonic way to do it. Thanks, Adam

    Read the article

  • python parsing file json

    - by michele
    File json: {"maps":[{"id":"blabla","iscategorical":"0"},{"id":"blabla","iscategorical":"0"}], "masks":["id":"valore"], "om_points":"value", "parameters":["id":"valore"] } I write this script but it only print all the text. json_data=open(file_directory).read() data = json.loads(json_data) pprint(data) How can I parse the file and extract single values? Thanks in advance.

    Read the article

  • Help a Python newbie with a Django model inheritance problem

    - by Joshmaker
    I'm working on my first real Django project after years of PHP programming, and I am running into a problem with my models. First, I noticed that I was copying and pasting code between the models, and being a diligent OO programmer I decided to make a parent class that the other models could inherit from: class Common(model.Model): self.name = models.CharField(max_length=255) date_created = models.DateTimeField(auto_now_add=True) date_modified = models.DateTimeField(auto_now=True) def __unicode__(self): return self.name class Meta: abstract=True So far so good. Now all my other models extend "Common" and have names and dates like I want. However, I have a class for "Categories" were the name has to be unique. I assume there should be a relatively simple way for me to access the name attribute from Common and make it unique. However, the different methods I have tried to use have all failed. For example: class Category(Common): def __init__(self, *args, **kwargs): self.name.unique=True Spits up the error "Caught an exception while rendering: 'Category' object has no attribute 'name' Can someone point me in the right direction?

    Read the article

  • How to read a csv file with python

    - by john
    Hello, I'm trying to read a csv file but it doesn't work. I can read my csv file but when I see what I read, there where white space between values. Here is my code # -*- coding: iso-8859-1 -*- import sql_db, tmpl_macros, os import security, form, common import csv class windows_dialect(csv.Dialect): """Describe the usual properties of unix-generated CSV files.""" delimiter = ',' quotechar = '"' doublequote = 1 skipinitialspace = 0 lineterminator = 'n' quoting = csv.QUOTE_MINIMAL def reco(d): cars = {210:'"', 211:'"', 213:"'", 136:'à', 143:'è', 142:'é'} for c in cars: d = d.replace(chr(c),cars[c]) return d def page_process(ctx): if ctx.req_equals('catalog_send'): if 'catalog_file' in ctx.locals.__dict__: contenu = ctx.locals.catalog_file[0].file.read() #contenu.encode('') p = csv.reader(contenu, delimiter=',') inserted = 0 modified = 0 (cr,db) = sql_db.cursor_get() for line in p: if line: logfile = open('/tmp/test.log', 'a') logfile.write(line[0]) logfile.write('\n') logfile.write('-----------------------------\n') logfile.close()

    Read the article

  • Working with bytes and binary data in Python

    - by ignoramus
    Four consecutive bytes in a byte string together specify some value. However, only 7 bits in each byte are used; the most significant bit is ignored (that makes 28 bits altogether). So... b"\x00\x00\x02\x01" would be 000 0000 000 0000 000 0010 000 0001. Or, for the sake of legibility, 10 000 0001. That's the value the four bytes represent. But I want a decimal, so I do this: >>> 0b100000001 257 I can work all that out myself, but how would I incorporate it into a program?

    Read the article

  • How to Extract data asocaited with attribute of XML file using python 3.2

    - by user1460383
    I have this xml format..... <event timestamp="0.447463" bustype="LIN" channel="LIN 1"> <col name="Time"/> <col name="Start of Frame">0.440708</col> <col name="Channel">LIN 1</col> <col name="Dir">Tx</col> <col name="Event Type">LIN Frame (Diagnostic Request)</col> <col name="Frame Name">MasterReq_DB</col> <col name="Id">3C</col> <col name="Data">81 06 04 04 FF FF 50 4C</col> <col name="Publisher">TestMaster (simulated)</col> <col name="Checksum">D3 &quot;Classic&quot;</col> <col name="Header Duration">2.090 ms (40.1 bits)</col> <col name="Resp. Duration">4.688 ms (90.0 bits)</col> <col name="Time difference">0.049987</col> <empty/> </event> In above xml, i need to extract data associated with attribute 'name' Am able to get all names but am unable to fetch MasterReq_DB< field Please help me ... Thanks in advance

    Read the article

  • read a binary file (python)

    - by beratch
    Hi, I cant read a file, and I dont understand why: f = open("test/test.pdf", "r") data = list(f.read()) print data Returns : [] I would like to open a PDF, and extract every bytes, and put it in a List. What's wrong with my code ? :( Thanks,

    Read the article

  • Python metaclass for enforcing immutability of custom types

    - by Mark Lehmacher
    Having searched for a way to enforce immutability of custom types and not having found a satisfactory answer I came up with my own shot at a solution in form of a metaclass: class ImmutableTypeException( Exception ): pass class Immutable( type ): ''' Enforce some aspects of the immutability contract for new-style classes: - attributes must not be created, modified or deleted after object construction - immutable types must implement __eq__ and __hash__ ''' def __new__( meta, classname, bases, classDict ): instance = type.__new__( meta, classname, bases, classDict ) # Make sure __eq__ and __hash__ have been implemented by the immutable type. # In the case of __hash__ also make sure the object default implementation has been overridden. # TODO: the check for eq and hash functions could probably be done more directly and thus more efficiently # (hasattr does not seem to traverse the type hierarchy) if not '__eq__' in dir( instance ): raise ImmutableTypeException( 'Immutable types must implement __eq__.' ) if not '__hash__' in dir( instance ): raise ImmutableTypeException( 'Immutable types must implement __hash__.' ) if _methodFromObjectType( instance.__hash__ ): raise ImmutableTypeException( 'Immutable types must override object.__hash__.' ) instance.__setattr__ = _setattr instance.__delattr__ = _delattr return instance def __call__( self, *args, **kwargs ): obj = type.__call__( self, *args, **kwargs ) obj.__immutable__ = True return obj def _setattr( self, attr, value ): if '__immutable__' in self.__dict__ and self.__immutable__: raise AttributeError( "'%s' must not be modified because '%s' is immutable" % ( attr, self ) ) object.__setattr__( self, attr, value ) def _delattr( self, attr ): raise AttributeError( "'%s' must not be deleted because '%s' is immutable" % ( attr, self ) ) def _methodFromObjectType( method ): ''' Return True if the given method has been defined by object, False otherwise. ''' try: # TODO: Are we exploiting an implementation detail here? Find better solution! return isinstance( method.__objclass__, object ) except: return False However, while the general approach seems to be working rather well there are still some iffy implementation details (also see TODO comments in code): How do I check if a particular method has been implemented anywhere in the type hierarchy? How do I check which type is the origin of a method declaration (i.e. as part of which type a method has been defined)?

    Read the article

  • removing pairs of elements from numpy arrays that are NaN (or another value) in Python

    - by user248237
    I have an array with two columns in numpy. For example: a = array([[1, 5, nan, 6], [10, 6, 6, nan]]) a = transpose(a) I want to efficiently iterate through the two columns, a[:, 0] and a[:, 1] and remove any pairs that meet a certain condition, in this case if they are NaN. The obvious way I can think of is: new_a = [] for val1, val2 in a: if val2 == nan or val2 == nan: new_a.append([val1, val2]) But that seems clunky. What's the pythonic numpy way of doing this? thanks.

    Read the article

  • Python dealing with dates and times

    - by randombits
    I'm looking for a solution to the following: Given today's date, figure out what month was before. So 2 should return for today, since it is currently March, the third month of the year. 12 should return for January. Then based on that, I need to be able to iterate through a directory and find all files that were created that month. Bonus points would include finding the most current file created for the previous month.

    Read the article

  • Convert alphabet letters to number in python

    - by altin
    Can someone help me finish this characters = ['a''b''c''d''e''f''g''h''i''j''k''l''m''n''o''p''q''r''t''u''v''w''x''y''z'] numbers = ['1''2''3''4''5''6''7''8''9''10''11''12''13''14''15''16''17''18''19''20''21''22''23''24'] text = raw_input(' Write text: ') Ive tryed to many ways but couldnt get to the pint, I want to make exc if i type hello the output to be in numbers lined like in alphabet... example a = 1 < in alphabet Can anyone give ideas ? or help sth ?

    Read the article

  • Errno socket error in python

    - by Emma
    i wrote this code : import random import sys import urllib openfile = open(sys.argv[1]).readlines() c = random.choice(openfile) i = 0 while i < 5: i=i+1 c = random.choice(openfile) proxies = {'http': c} opener = urllib.FancyURLopener(proxies).open("http://whatismyip.com.au/").read() ::: I put 3 proxy in a txt file . : http://211.161.159.74:8080 http://119.70.40.101:8080 http://124.42.10.119:8080 but when execute it i get this error : IOError: [Errno socket error] (10054, 'Connection reset by peer') what am i going to do ? please help me .

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • use doctest and logging in python program

    - by Luke
    #!/usr/bin/python2.4 import logging import sys import doctest def foo(x): """ foo (0) 0 """ print ("%d" %(x)) _logger.debug("%d" %(x)) def _test(): doctest.testmod() _logger = logging.getLogger() _logger.setLevel(logging.DEBUG) _formatter = logging.Formatter('%(message)s') _handler = logging.StreamHandler(sys.stdout) _handler.setFormatter(_formatter) _logger.addHandler(_handler) _test() I would like to use logger module for all of my print statements. I have looked at the first 50 top google links for this, and they seem to agree that doctest uses it's own copy of the stdout. If print is used it works if logger is used it logs to the root console. Can someone please demonstrate a working example with a code snippet that will allow me to combine. Note running nose to test doctest will just append the log output at the end of the test, (assuming you set the switches) it does not treat them as a print statement.

    Read the article

  • Opening SSL URLs with Python

    - by RadiantHex
    Hi folks, I'm using mechanize to navigate pages, it works pretty well. Unfortunately I have a random error come up, by random I mean it occasionally appears. URLError at /test/ urlopen error [Errno 1] _ssl.c:1325: error:140943FC:SSL routines:SSL3_READ_BYTES:sslv3 alert bad record mac I really need help on this one :) any ideas?

    Read the article

  • Common Pitfalls in Python

    - by Anurag Uniyal
    Today I was bitten again by "Mutable default arguments" after many years. I usually don't use mutable default arguments unless needed but I think with time I forgot about that, and today in the application I added tocElements=[] in a pdf generation function's argument list and now 'Table of Content' gets longer and longer after each invocation of "generate pdf" :) My question is what other things should I add to my list of things to MUST avoid? Mutable default arguments Import modules always same way e.g. from y import x and import x are different things, they are treated as different modules. Do not use range in place of lists because range() will become an iterator anyway, the following will fail: myIndexList = [0,1,3] isListSorted = myIndexList == range(3) # will fail in 3.0 isListSorted = myIndexList == list(range(3)) # will not same thing can be mistakenly done with xrange: `myIndexList == xrange(3)`. Catching multiple exceptions try: raise KeyError("hmm bug") except KeyError,TypeError: print TypeError It prints "hmm bug", though it is not a bug, it looks like we are catching exceptions of type KeyError,TypeError but instead we are catching KeyError only as variable TypeError, use this instead: try: raise KeyError("hmm bug") except (KeyError,TypeError): print TypeError

    Read the article

  • serializing JSON files with newlines in Python

    - by user248237
    I am using json and jsonpickle sometimes to serialize objects to files, using the following function: def json_serialize(obj, filename, use_jsonpickle=True): f = open(filename, 'w') if use_jsonpickle: import jsonpickle json_obj = jsonpickle.encode(obj) f.write(json_obj) else: simplejson.dump(obj, f) f.close() The problem is that if I serialize a dictionary for example, using "json_serialize(mydict, myfilename)" then the entire serialization gets put on one line. This means that I can't grep the file for entries to be inspected by hand, like I would a CSV file. Is there a way to make it so each element of an object (e.g. each entry in a dict, or each element in a list) is placed on a separate line in the JSON output file? thanks.

    Read the article

  • python raw_input odd behavior with accents containing strings

    - by Ryan
    I'm writing a program that asks the user for input that contains accents. The user input string is tested to see if it matches a string declared in the program. As you can see below, my code is not working: code # -*- coding: utf-8 -*- testList = ['má'] myInput = raw_input('enter something here: ') print myInput, repr(myInput) print testList[0], repr(testList[0]) print myInput in testList output in eclipse with pydev enter something here: má mv° 'm\xe2\x88\x9a\xc2\xb0' má 'm\xc3\xa1' False output in IDLE enter something here: má má u'm\xe1' má 'm\xc3\xa1' Warning (from warnings module): File "/Users/ryanculkin/Desktop/delete.py", line 8 print myInput in testList UnicodeWarning: Unicode equal comparison failed to convert both arguments to Unicode - interpreting them as being unequal False How can I get my code to print True when comparing the two strings? Additionally, I note that the result of running this code on the same input is different depending on whether I use eclipse or IDLE. Why is this? My eventual goal is to put my program on the web; is there anything that I need to be aware of, since the result seems to be so volatile?

    Read the article

  • Documenting module/class/function bodies in python sphinx docs

    - by perrierism
    Is there a way with Sphinx documentation to output a function or class body (the code itself) with the autodoc feature? I'm using autodoc to much success. In addition to the docstrings getting pulled in to the documentation I want like a link to click for each function where it will show you the source... is that possible? This is about what most of my documentation looks like now: .. module:`foo.mymodule` Title =================== .. automodule:: foo.mymodule .. autoclass:: MyModulesClass :members: :undoc-members:

    Read the article

  • Python, a smarter way of string to integer conversion

    - by Hellnar
    Hello I have written this code to convert string in such format "0(532) 222 22 22" to integer such as 05322222222 . class Phone(): def __init__(self,input): self.phone = input def __str__(self): return self.phone #convert to integer. def to_int(self): return int((self.phone).replace(" ","").replace("(","").replace(")","")) test = Phone("0(532) 222 22 22") print test.to_int() It feels very clumsy to use 3 replace methods to solve this. I am curious if there is a better solution?

    Read the article

  • Listing all possible values for SOAP enumeration with Python SUDS

    - by bdk
    I'm connecting with a SUDS client to a SOAP Server whose wsdl contains manu enumerations like the following: </simpleType> <simpleType name="FOOENUMERATION"> <restriction base="xsd:string"> <enumeration value="ALPHA"><!-- enum const = 0 --> <enumeration value="BETA"/><!-- enum const = 1 --> <enumeration value="GAMMA"/><!-- enum const = 2 --> <enumeration value="DELTA"/><!-- enum const = 3 --> </restriction> </simpleType> In my client I am receiving sequences which contain elements of these various enumeration types. My need is that given a member variable, I need to know all possible enumeration values. Basically I need a function which takes an instance of one of these enums and returns a list of strings which are all the possible values. When I have an instance, running: print type(foo.enumInstance) I get: <class 'suds.sax.text.Text'> I'm not sure how to get the actual simpleType name from this, and then get the possible values from that short of parsing the WSDL myself.

    Read the article

< Previous Page | 132 133 134 135 136 137 138 139 140 141 142 143  | Next Page >