Search Results

Search found 39339 results on 1574 pages for 'batch files'.

Page 139/1574 | < Previous Page | 135 136 137 138 139 140 141 142 143 144 145 146  | Next Page >

  • How to programmatically cut/copy/get files to/from Windows clipboard in a systam standard compliand

    - by Ivan
    How to put a cut/copy reference to specific files and/or folders into Windows clipboard so that when I open standard Windows Explorer window, go to somewhere and press Ctrl+V - the files are pasted? If I copy or cut some files/folders in Windows Explorer, how do I get this info (full names and whether they were cut or copied) in my Program? I program in C#4, but other languages ways are also interesting to know.

    Read the article

  • Best Place to Store Config Files and Log Files on Windows for My Program?

    - by Dave
    I need to store log files and config files for my application. Where is the best place to store them? Right now I'm just using the current directory, which ends up putting them in the Program Files directory where my program lives. The log files will probably be accessed by the user somewhat regularly, so %APPDATA% seems a little hard to get to. Is a directory under %USERPROFILE%\My Documents the best? It needs to work for all versions of Windows from 2000 forward.

    Read the article

  • How to make NetBeans IDE 6.8 show svn commit status (especially for "dirty" files)

    - by Andrew M. Andrews III
    I just switched from Eclipse to NetBeans IDE 6.8 for my PHP/Ajax development. Eclipse always showed a little hard disk symbol over the file icon for files that were in sync with the svn repository, and an asterisk for files with changes that have not been committed. Is there a way to see the commit status in NetBeans? If not, what is your preferred way of recognizing which files to commit?

    Read the article

  • Mixing two wav music files of different size

    - by iphoneDev
    Hi, I want to mix audio files of different size into a one single .wav file. There is a sample through which we can mix files of same size [(http://www.modejong.com/iOS/#ex4 )(Example 4)]. I modified the code to get the mixed file as a .wav file. But I am not able to understand that how to modify this code for unequal sized files. If someone can help me out with some code snippet,i'll be really thankful.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Rsync fails for files that start with underscore when destination is zfs

    - by Eric
    everyone. I'm using rsync3.1.0pre1 on Mac OS X 10.8.5, and am trying to rsync one folder to another. The destination is a ZFS volume mounted via SMB. The problem I'm having is that files that start with underscore (e.g., '_filename.jpg') are not being successfully synced to the destination. I get the following error message: rsync: mkstemp "/path/to/destination/._filename.jpg.NUgYJw" failed: Permission denied (13) In this case, '_filename.jpg' does not make it to the destination. I understand that rsync creates hidden, temporary files at the destination which are preceded with '.' and have a random file extension appended on the end. But the original filename starts with '', not '.', and I haven't asked rsync to copy extended attributes / resource forks over (unless it always does it). The rsync command I'm using is: rsync -avE --exclude='.DS_Store' --exclude '.Trash' --exclude 'Thumbs.db' --exclude '._*' --delete /source/ /destination/ Has anyone found a way around this problem? Thank you!

    Read the article

  • How restore qmail backup files

    - by Maysam
    We are using qmail as our mail application on a linux server. A few weeks ago our server crashed and we had everything installed from scratch and our users started to send & receive email again. The problem is they have lost their old emails. We have a back up of the whole qmail directory. But I don't know how to restore the old emails without losing the new ones. It's worth mentioning that I don't have any problem with restoring old sent mails. When I copy email files into .sent-mail/cur directory, I have them restored in sent box of users, but restoring files in /cur directory doesn't work for inbox emails and I can't get them restored.

    Read the article

  • Compile multiple C files with make

    - by Mohit Deshpande
    (I am running Linux Ubuntu 9.10, so the extension for an executable is executablefile.out) I am just getting into modular programming (programming with multiple files) in C and I want to know how to compile multiple files in a single makefile. For example, what would be the makefile to compile these files: main.c, dbAdapter.c, dbAdapter.h? (By the way, If you haven't figured it out yet, the main function is in main.c) Also could someone post a link to the documentation of a makefile?

    Read the article

  • Making archive from files with same names in different directories

    - by Tim
    Hi, I have some files with same names but under different directories. For example, path1/filea, path1/fileb, path2/filea, path2/fileb,.... What is the best way to make the files into an archive? Under these directories, there are other files that I don't want to make into the archive. Off the top of my head, I think of using Bash, probably ar, tar and other commands, but am not sure how exactly to do it. Renaming the files seems to make the file names a little complicated. I tend to keep the directory structure inside the archive. Or I might be wrong. Other ideas are welcome! Thanks and regards!

    Read the article

  • Prevent Chrome from automatically opening downloaded PDF and Image files

    - by Phoenix
    When I download a PDF or image in Google Chrome on my Mac, is it possible to prevent Chrome from automatically opening it in my default application for that file type (e.g., Preview)? I notice that Chrome does not do this for other downloaded files such as audio and ZIP archives. I still want to be able to preview files in Chrome; I just want to prevent it from automatically launching my image/PDF viewer application after I download them. For example: I click on a link in an email to a PDF document or an image file. Chrome displays the contents in the browser. I press Cmd-S and save the file to my computer. When the download finishes, the file opens automatically in Preview.app. It's that last step that I would like to bypass.

    Read the article

  • unable to transfer files from handy cam to PC

    - by user143989
    I am using a Windows 7 PC,I am using sony dcr -sr88 handy cam . I need to transfer all my videos from handycam to my PC. when i try to connect to the PC through USB. it detects the usb drive in the Handycam on my PC and shows the used memory. But when i open the folder it shows "folder is empty". How i can copy the files? I have tried following: Changed the USB cable CHanged the USB port I can play the videos through handicam, but those files not visible in PC when connected in USB mode. Please help ..bit urgent!

    Read the article

  • Share files - Ubuntu 12.4 and Windows 7 - one network - password not accepted

    - by gotqn
    I have three machines - two with windows 7 and one with Ubuntu 12.4 version. There are in the same network connected by modem. The two machines shares file with no problem, but they can not see the machine with Ubuntu. On the other hand, I am able to see the share files of the windows machines from the Ubuntu's Network. When I select a folder, it wants the network password - I changed it several times in order to be sure that I am entering the correct one but in every case it says that the password is wrong. I have read some topics about files sharing between Linux and windows in which it is said that I should use samba, but is there a more easy way to do this, using the build it options?

    Read the article

  • Using windows CopyFile function to copy all files with certain name format

    - by Ben313
    Hello! I am updating some C code that copys files with a certain name. basically, I have a directory with a bunch of files named like so: AAAAA.1.XYZ AAAAA.2.ZYX AAAAA.3.YZX BBBBB.1.XYZ BBBBB.2.ZYX Now, In the old code, they just used a call to ShellExecute and used xcopy.exe. to get all the files starting with AAAAA, they just gave xcopy the name of the file as AAAAA.* and it knew to copy all of the files starting with AAAAA. now, im trying to get it to copy with out having to use the command line, and I am running into trouble. I was hoping CopyFile would be smart enough to handle AAAAA.* as the file to be copied, but it doesnt at all do what xcopy did. So, any Ideas on how to do this without the external call to xcopy.exe?

    Read the article

  • Add zip files from one archive to another using command line

    - by Curious2learn
    I have two zip archives. Say, set1 has 10 csv files created using Mac OS X 10.5.8 compress option, and set2 has 4 csv files similarly created. I want to take the 4 files from zipped archive set2 and add them to list of files in archive set1. Is there a way I can do that? I tried the following in Terminal: zip set1.zip set2.zip This adds the whole archive set2.zip to set1.zip, i.e., in set1.zip now I have: file1.csv, file2.csv,..., file10.csv, set2.zip What I instead want is: file1.csv, file2.csv,..., file10.csv, file11.csv, ..., file14.csv where, set2.zip is the archive containing file11.csv, ..., file14.csv. Thanks.

    Read the article

  • hosting acounts for large uploads

    - by Phil Jackson
    Hi, im wondering if anyone knows of any host providers ( uk preferably ) that deals mostly with accepting large file uploads. Most hosts only let you push something like 1.5mb ( thats taking into account the connection and the max execution time ). What i am looking for is a host specificaly for storing files on. I was going to create an upload script onto my application which posted the file to the external host and then return back ( using headers so the user doen't even know they have left ). Does anyone know of a host for this?

    Read the article

  • rsync server, uploaded files permissions incorrect

    - by fred basset
    I'm trying to setup an rsync server on my Ubuntu machine. Transfer from a local PC to the server via rsync does work, but the resultant uploaded files have no r,w or x bits set, e.g. ---------- 1 fredb fredb 0 Aug 30 20:50 sk_upgrade_20120830_033450.txt ---------- 1 fredb fredb 0 Aug 30 20:50 sk_user_20120827_184534.txt ---------- 1 fredb fredb 0 Aug 30 20:50 sk_user_20120830_033450.txt My rsyncd.conf file is: motd file = /etc/rsyncd.motd [workspace] path = /tmp comment = rsync server uid = nobody gid = nobody read only = false auth users = fredb secrets file = /etc/rsyncd.scrt How can I get the target files permissions correct? Also once I've solved this problem how can I transfer without a password? TY, Fred

    Read the article

  • Can't access my files in ASP.NET web site

    - by jumbojs
    I'm having a very difficult time. I am running windows 2008 server, I have an Able Commerce site using ASP.NET with C#. I'm writing an automated task that will ftp some xml files down into a local directory on our web server and then the program parses the xml file and saves information to our database. The problem, once I save the files to our local directory, my program has no access to the files. The NETWORK SERVICE user permissions isn't being inherited by the xml files so my program can't do anything with them. I can manually change the permissions, but this wouldn't be automated and won't work. How can I get this to work? help please, it's very frustrating.

    Read the article

  • Oracle application - files missing in the Mount point in UNix server

    - by arun_V
    My oracle application test instance is down, When I browse through the Unix server, I couldn’t find any files in the mount point,U01 U06 or U10, when I put BDF command it shows the following $ bdf Filesystem kbytes used avail %used Mounted on /dev/vg00/lvol3 204800 35571 158662 18% / /dev/vg00/lvol1 299157 38506 230735 14% /stand /dev/vg00/lvol8 1392640 1261068 123620 91% /var /dev/vg00/lvol7 1327104 825170 470631 64% /usr /dev/vg00/lvol4 716800 385891 310746 55% /tmp /dev/vg00/lvol6 872448 814943 53936 94% /opt /dev/vg00/lvolssh 32768 13243 18306 42% /opt/openssh /dev/vg00/lvol5 204800 187397 16334 92% /home /dev/vg00/lvolback 512000 472879 36704 93% /backup dg-ora04:/dgora03_u10 204800 167088 35416 83% /u10 dg-ora04:/dgora03_u06 204800 167088 35416 83% /u06 dg-ora04:/dgora03_u01 204800 167088 35416 83% /u01 Why can't I see any files inside the mount points?

    Read the article

  • Webserver sending corrupt or corrupting served files

    - by NotIan
    EDIT: Looks like the problem was a rootkit that corrupted a bunch of low level linux commands, including top, ps, ifconfig, netstat and others. The problem was resolved by taking all web files off the server and wiping it. A dedicated server we operate is having a strange issue. Files are not be sent complete or are showing up with garbage data. Example: http://sustainablefitness.com/images/banner_bootcamps.jpg To make matters more confusing this corruption does NOT happen when the files are served as https, (I would post a link, but I don't have enough rep points, just add an 's' after http in the link above.) When I throw load at the server, I get dozens of (swapd)s in top this is the only thing that really jumps out. I can't post images but ( imgur.com / ZArSq.png ) is a screenshot of top. I have tried a lot of stuff so far, I am willing to try anything that I can. A dedicated server we operate is having a strange issue. Files are not be sent complete or are showing up with garbage data. Example: http://sustainablefitness.com/images/banner_bootcamps.jpg To make matters more confusing this corruption does NOT happen when the files are served as https, (I would post a link, but I don't have enough rep points, just add an 's' after http in the link above.) When I throw load at the server, I get dozens of (swapd)s in top this is the only thing that really jumps out. I can't post images but ( imgur.com / ZArSq.png ) is a screenshot of top. I have tried a lot of stuff so far, I am willing to try anything that I can.

    Read the article

  • Considering modified files for rebuild

    - by harik
    I have a C++ project, I am using Bakefile for build process, Makefiles are generated for msvc, mingw, gnu etc for cross-platform support. Now the problem is that if I change any .h files (which are included in other .cpp files) and performing a rebuild does not recompile modified files. But changing any .cpp file gets recompiled. Based on modified time-stamp of any file which is included in the project I expect to consider that file for rebuild. Am I missing something which required to be added as a tag in .bkl files? Please help.

    Read the article

  • Sending files through ssh

    - by Frion3L
    I need to send files to a server using ssh. I have never used ssh so this is being really frustrating to me. Mention the client (me) is using windows and the server is using Ubuntu. I connected to the server using ssh2 ip, and then loging with an account I have. Now, I would like to send my files to a folder in the server, so, I moved to the folder and I used this command: scp test.txt user_name@host_direction server_folder_destination And it always return that it can't do 'stat' over test.txt, the file doesn't exist, and so. I'm assuming ssh2 can't see the file in my computer root (C:), so I tried to specifie more and added: C:\test.txt, but apear the same error. I don't know what is happening. Any hints please? Thanks

    Read the article

  • How to copy protected files when an Administrator in Vista (easily)

    - by earlz
    Hello, I have a harddrive I need to backup. In the harddrive is of course things like Documents and Settings which is set to not allow other people to see inside someone's personal folders. I am an administrator though and I can not figure out how to mark these files so that I am permitted to access them and copy them. IWhen I double click on My Documents then it pops up saying You must have permission to access this and gives me an option like ok or cancel. I click ok and then it says you do not have permission to access these files I'm an administrator on the system so I don't understand why Vista is locking me out. How can I setup vista so that it will let me copy every file, even ones I don't have permission to?

    Read the article

  • Emacs: Changing the location of auto-save files

    - by Dominic Rodger
    I've currently got: (setq backup-directory-alist `((".*" . ,temporary-file-directory))) (setq auto-save-file-name-transforms `((".*" ,temporary-file-directory t))) in my .emacs, but that doesn't seem to have changed where auto-save files get saved (it has changed where backup files get saved. M-x describe-variable shows that temporary-file-directory is set to /tmp/, but when I edit a file called testing.md and have unsaved changes, I get a file called .#testing.md in the same directory. How can I make that file go somewhere else (e.g. /tmp/)? I've had no luck with these suggestions, so any suggestions welcome! If it helps, I'm on GNU Emacs 23.3.1, running Ubuntu.

    Read the article

< Previous Page | 135 136 137 138 139 140 141 142 143 144 145 146  | Next Page >