Search Results

Search found 15520 results on 621 pages for 'block element'.

Page 139/621 | < Previous Page | 135 136 137 138 139 140 141 142 143 144 145 146  | Next Page >

  • What's wrong (or right) with this JS Object Pattern?

    - by unsane1
    Here's an example of the pattern I'm using in my javascript objects these days (this example relies on jQuery). http://pastie.org/private/ryn0m1gnjsxdos9onsyxg It works for me reasonably well, but I'm guessing there's something wrong, or at least sub-optimal about it, I'm just curious to get people's opinions. Here's a smaller, inline example of it: sample = function(attach) { // set internal reference to self var self = this; // public variable(s) self.iAmPublic = true; // private variable(s) var debug = false; var host = attach; var pane = { element: false, display: false } // public function(s) self.show = function() { if (!pane.display) { position(); $(pane.element).show('fast'); pane.display = true; } } self.hide = function() { if (pane.display) { $(pane.element).hide('fast'); pane.display = false; } } // private function(s) function init () { // do whatever stuff is needed on instantiation of this object // like perhaps positioning a hidden div pane.element = document.createElement('div'); return self; } function position() { var h = { 'h': $(host).outerHeight(), 'w': $(host).outerWidth(), 'pos': $(host).offset() }; var p = { 'w': $(pane.element).outerWidth() }; $(pane.element).css({ top: h.pos.top + (h.h-1), left: h.pos.left + ((h.w - p.w) / 2) }); } function log () { if (debug) { console.log(arguments); } } // on-instantiation let's set ourselves up return init(); } I'm really curious to get people's thoughts on this.

    Read the article

  • Outputting array contents as nested list in PHP

    - by Mamadou
    I have the array $tab[1,2,3,4,5,6,7,8,9,10] and I would like to display it like this: <ul> <li> <a href=""/>FIRST ELEMENT OF THE TAB ==> 1</a> <a href=""/>2ND ELEMENT OF THE TAB ==> 2</a> </li> <li> <a href=""/>3THIRD ELEMENT==> 3</a> <a href=""/>FORTH ELEMENT OF THE TAB ==> 4</a> </li> <li> <a href=""/>FIFTH ELEMENT==> 5</a> <a href=""/>SIXTITH ELEMENT OF THE TAB ==> 6</a> </li> </ul> How can I achieve this in PHP? I am thinking of creating a sub array with array_slice.

    Read the article

  • comparision of strings

    - by EmiLazE
    i am writing a program, that simulates game mastermind. but i am struggling on how to compare guessed pattern to key pattern. the game conditions are a little bit changed: patterns consist of letters. if an element of guessed pattern is equal to element of key pattern, and also index is equal, then print b. if an element of guessed pattern is equal to element of key pattern, but index is not, then print w. if an element of guessed pattern is not equal to element of key pattern, print dot. in feedback about guessed pattern, 'b's come first, 'w's second, '.'s last. my problem is that i cannot think of a way totally satisfies the answer. for (i=0; i<patternlength; i++) { for (x=0; x<patternlength; x++) { if (guess[i]==key[x] && i==x) printf("b"); if (guess[i]==key[x] && i!=x) printf("w"); if (guess[i]!=key[x]) printf("."); } }

    Read the article

  • Ubuntu 12.04 LTS installation problem

    - by Zxy
    I am trying to install Ubuntu 12.04 LTS on my PC using WUBI. However, I keep getting this error: An error occured: *Error executing command >>command=C:\\System32\bcdedit.exe /set {2708afc0-9ffa-11e1-bc51-d167219ffa25} device partition=E: >>retval=1 >>stderr=An error has occured setting the element data. The request is not supported. >>stdout= For more information, please see the logfile:* Logfile: 06-11 10:57 DEBUG TaskList: ## Finished choose_disk_sizes 06-11 10:57 DEBUG TaskList: ## Running expand_diskimage... 06-11 10:59 DEBUG TaskList: ## Finished expand_diskimage 06-11 10:59 DEBUG TaskList: ## Running create_swap_diskimage... 06-11 10:59 DEBUG TaskList: ## Finished create_swap_diskimage 06-11 10:59 DEBUG TaskList: ## Running modify_bootloader... 06-11 10:59 DEBUG TaskList: New task modify_bcd 06-11 10:59 DEBUG TaskList: ### Running modify_bcd... 06-11 10:59 DEBUG WindowsBackend: modify_bcd Drive(C: hd 51255.1171875 mb free ntfs) 06-11 10:59 ERROR TaskList: Error executing command >>command=C:\Windows\System32\bcdedit.exe /set {2708afc0-9ffa-11e1-bc51-d167219ffa25} device partition=E: >>retval=1 >>stderr=An error has occurred setting the element data. The request is not supported. >>stdout= Traceback (most recent call last): File "\lib\wubi\backends\common\tasklist.py", line 197, in __call__ File "\lib\wubi\backends\win32\backend.py", line 697, in modify_bcd File "\lib\wubi\backends\common\utils.py", line 66, in run_command Exception: Error executing command >>command=C:\Windows\System32\bcdedit.exe /set {2708afc0-9ffa-11e1-bc51-d167219ffa25} device partition=E: >>retval=1 >>stderr=An error has occurred setting the element data. The request is not supported. >>stdout= 06-11 10:59 DEBUG TaskList: # Cancelling tasklist 06-11 10:59 DEBUG TaskList: New task modify_bcd 06-11 10:59 ERROR root: Error executing command >>command=C:\Windows\System32\bcdedit.exe /set {2708afc0-9ffa-11e1-bc51-d167219ffa25} device partition=E: >>retval=1 >>stderr=An error has occurred setting the element data. The request is not supported. >>stdout= Traceback (most recent call last): File "\lib\wubi\application.py", line 58, in run File "\lib\wubi\application.py", line 132, in select_task File "\lib\wubi\application.py", line 158, in run_installer File "\lib\wubi\backends\common\tasklist.py", line 197, in __call__ File "\lib\wubi\backends\win32\backend.py", line 697, in modify_bcd File "\lib\wubi\backends\common\utils.py", line 66, in run_command Exception: Error executing command >>command=C:\Windows\System32\bcdedit.exe /set {2708afc0-9ffa-11e1-bc51-d167219ffa25} device partition=E: >>retval=1 >>stderr=An error has occurred setting the element data. The request is not supported. >>stdout= 06-11 10:59 DEBUG TaskList: New task modify_bcd 06-11 10:59 DEBUG TaskList: New task modify_bcd 06-11 10:59 DEBUG TaskList: ## Finished modify_bootloader 06-11 10:59 DEBUG TaskList: # Finished tasklist*

    Read the article

  • Using the jQuery UI Library in a MVC 3 Application to Build a Dialog Form

    - by ChrisD
    Using a simulated dialog window is a nice way to handle inline data editing. The jQuery UI has a UI widget for a dialog window that makes it easy to get up and running with it in your application. With the release of ASP.NET MVC 3, Microsoft included the jQuery UI scripts and files in the MVC 3 project templates for Visual Studio. With the release of the MVC 3 Tools Update, Microsoft implemented the inclusion of those with NuGet as packages. That means we can get up and running using the latest version of the jQuery UI with minimal effort. To the code! Another that might interested you about JQuery Mobile and ASP.NET MVC 3 with C#. If you are starting with a new MVC 3 application and have the Tools Update then you are a NuGet update and a <link> and <script> tag away from adding the jQuery UI to your project. If you are using an existing MVC project you can still get the jQuery UI library added to your project via NuGet and then add the link and script tags. Assuming that you have pulled down the latest version (at the time of this publish it was 1.8.13) you can add the following link and script tags to your <head> tag: < link href = "@Url.Content(" ~ / Content / themes / base / jquery . ui . all . css ")" rel = "Stylesheet" type = "text/css" /> < script src = "@Url.Content(" ~ / Scripts / jquery-ui-1 . 8 . 13 . min . js ")" type = "text/javascript" ></ script > The jQuery UI library relies upon the CSS scripts and some image files to handle rendering of its widgets (you can choose a different theme or role your own if you like). Adding these to the stock _Layout.cshtml file results in the following markup: <!DOCTYPE html> < html > < head >     < meta charset = "utf-8" />     < title > @ViewBag.Title </ title >     < link href = "@Url.Content(" ~ / Content / Site . css ")" rel = "stylesheet" type = "text/css" />     <link href="@Url.Content("~/Content/themes/base/jquery.ui.all.css")" rel="Stylesheet" type="text/css" />     <script src="@Url.Content("~/Scripts/jquery-1.5.1.min.js")" type="text/javascript"></script>     <script src="@Url.Content("~/Scripts/modernizr-1.7.min . js ")" type = "text/javascript" ></ script >     < script src = "@Url.Content(" ~ / Scripts / jquery-ui-1 . 8 . 13 . min . js ")" type = "text/javascript" ></ script > </ head > < body >     @RenderBody() </ body > </ html > Our example will involve building a list of notes with an id, title and description. Each note can be edited and new notes can be added. The user will never have to leave the single page of notes to manage the note data. The add and edit forms will be delivered in a jQuery UI dialog widget and the note list content will get reloaded via an AJAX call after each change to the list. To begin, we need to craft a model and a data management class. We will do this so we can simulate data storage and get a feel for the workflow of the user experience. The first class named Note will have properties to represent our data model. namespace Website . Models {     public class Note     {         public int Id { get ; set ; }         public string Title { get ; set ; }         public string Body { get ; set ; }     } } The second class named NoteManager will be used to set up our simulated data storage and provide methods for querying and updating the data. We will take a look at the class content as a whole and then walk through each method after. using System . Collections . ObjectModel ; using System . Linq ; using System . Web ; namespace Website . Models {     public class NoteManager     {         public Collection < Note > Notes         {             get             {                 if ( HttpRuntime . Cache [ "Notes" ] == null )                     this . loadInitialData ();                 return ( Collection < Note >) HttpRuntime . Cache [ "Notes" ];             }         }         private void loadInitialData ()         {             var notes = new Collection < Note >();             notes . Add ( new Note                           {                               Id = 1 ,                               Title = "Set DVR for Sunday" ,                               Body = "Don't forget to record Game of Thrones!"                           });             notes . Add ( new Note                           {                               Id = 2 ,                               Title = "Read MVC article" ,                               Body = "Check out the new iwantmymvc.com post"                           });             notes . Add ( new Note                           {                               Id = 3 ,                               Title = "Pick up kid" ,                               Body = "Daughter out of school at 1:30pm on Thursday. Don't forget!"                           });             notes . Add ( new Note                           {                               Id = 4 ,                               Title = "Paint" ,                               Body = "Finish the 2nd coat in the bathroom"                           });             HttpRuntime . Cache [ "Notes" ] = notes ;         }         public Collection < Note > GetAll ()         {             return Notes ;         }         public Note GetById ( int id )         {             return Notes . Where ( i => i . Id == id ). FirstOrDefault ();         }         public int Save ( Note item )         {             if ( item . Id <= 0 )                 return saveAsNew ( item );             var existingNote = Notes . Where ( i => i . Id == item . Id ). FirstOrDefault ();             existingNote . Title = item . Title ;             existingNote . Body = item . Body ;             return existingNote . Id ;         }         private int saveAsNew ( Note item )         {             item . Id = Notes . Count + 1 ;             Notes . Add ( item );             return item . Id ;         }     } } The class has a property named Notes that is read only and handles instantiating a collection of Note objects in the runtime cache if it doesn't exist, and then returns the collection from the cache. This property is there to give us a simulated storage so that we didn't have to add a full blown database (beyond the scope of this post). The private method loadInitialData handles pre-filling the collection of Note objects with some initial data and stuffs them into the cache. Both of these chunks of code would be refactored out with a move to a real means of data storage. The GetAll and GetById methods access our simulated data storage to return all of our notes or a specific note by id. The Save method takes in a Note object, checks to see if it has an Id less than or equal to zero (we assume that an Id that is not greater than zero represents a note that is new) and if so, calls the private method saveAsNew . If the Note item sent in has an Id , the code finds that Note in the simulated storage, updates the Title and Description , and returns the Id value. The saveAsNew method sets the Id , adds it to the simulated storage, and returns the Id value. The increment of the Id is simulated here by getting the current count of the note collection and adding 1 to it. The setting of the Id is the only other chunk of code that would be refactored out when moving to a different data storage approach. With our model and data manager code in place we can turn our attention to the controller and views. We can do all of our work in a single controller. If we use a HomeController , we can add an action method named Index that will return our main view. An action method named List will get all of our Note objects from our manager and return a partial view. We will use some jQuery to make an AJAX call to that action method and update our main view with the partial view content returned. Since the jQuery AJAX call will cache the call to the content in Internet Explorer by default (a setting in jQuery), we will decorate the List, Create and Edit action methods with the OutputCache attribute and a duration of 0. This will send the no-cache flag back in the header of the content to the browser and jQuery will pick that up and not cache the AJAX call. The Create action method instantiates a new Note model object and returns a partial view, specifying the NoteForm.cshtml view file and passing in the model. The NoteForm view is used for the add and edit functionality. The Edit action method takes in the Id of the note to be edited, loads the Note model object based on that Id , and does the same return of the partial view as the Create method. The Save method takes in the posted Note object and sends it to the manager to save. It is decorated with the HttpPost attribute to ensure that it will only be available via a POST. It returns a Json object with a property named Success that can be used by the UX to verify everything went well (we won't use that in our example). Both the add and edit actions in the UX will post to the Save action method, allowing us to reduce the amount of unique jQuery we need to write in our view. The contents of the HomeController.cs file: using System . Web . Mvc ; using Website . Models ; namespace Website . Controllers {     public class HomeController : Controller     {         public ActionResult Index ()         {             return View ();         }         [ OutputCache ( Duration = 0 )]         public ActionResult List ()         {             var manager = new NoteManager ();             var model = manager . GetAll ();             return PartialView ( model );         }         [ OutputCache ( Duration = 0 )]         public ActionResult Create ()         {             var model = new Note ();             return PartialView ( "NoteForm" , model );         }         [ OutputCache ( Duration = 0 )]         public ActionResult Edit ( int id )         {             var manager = new NoteManager ();             var model = manager . GetById ( id );             return PartialView ( "NoteForm" , model );         }         [ HttpPost ]         public JsonResult Save ( Note note )         {             var manager = new NoteManager ();             var noteId = manager . Save ( note );             return Json ( new { Success = noteId > 0 });         }     } } The view for the note form, NoteForm.cshtml , looks like so: @model Website . Models . Note @using ( Html . BeginForm ( "Save" , "Home" , FormMethod . Post , new { id = "NoteForm" })) { @Html . Hidden ( "Id" ) < label class = "Title" >     < span > Title < /span><br / >     @Html . TextBox ( "Title" ) < /label> <label class="Body">     <span>Body</ span >< br />     @Html . TextArea ( "Body" ) < /label> } It is a strongly typed view for our Note model class. We give the <form> element an id attribute so that we can reference it via jQuery. The <label> and <span> tags give our UX some structure that we can style with some CSS. The List.cshtml view is used to render out a <ul> element with all of our notes. @model IEnumerable < Website . Models . Note > < ul class = "NotesList" >     @foreach ( var note in Model )     {     < li >         @note . Title < br />         @note . Body < br />         < span class = "EditLink ButtonLink" noteid = "@note.Id" > Edit < /span>     </ li >     } < /ul> This view is strongly typed as well. It includes a <span> tag that we will use as an edit button. We add a custom attribute named noteid to the <span> tag that we can use in our jQuery to identify the Id of the note object we want to edit. The view, Index.cshtml , contains a bit of html block structure and all of our jQuery logic code. @ {     ViewBag . Title = "Index" ; } < h2 > Notes < /h2> <div id="NoteListBlock"></ div > < span class = "AddLink ButtonLink" > Add New Note < /span> <div id="NoteDialog" title="" class="Hidden"></ div > < script type = "text/javascript" >     $ ( function () {         $ ( "#NoteDialog" ). dialog ({             autoOpen : false , width : 400 , height : 330 , modal : true ,             buttons : {                 "Save" : function () {                     $ . post ( "/Home/Save" ,                         $ ( "#NoteForm" ). serialize (),                         function () {                             $ ( "#NoteDialog" ). dialog ( "close" );                             LoadList ();                         });                 },                 Cancel : function () { $ ( this ). dialog ( "close" ); }             }         });         $ ( ".EditLink" ). live ( "click" , function () {             var id = $ ( this ). attr ( "noteid" );             $ ( "#NoteDialog" ). html ( "" )                 . dialog ( "option" , "title" , "Edit Note" )                 . load ( "/Home/Edit/" + id , function () { $ ( "#NoteDialog" ). dialog ( "open" ); });         });         $ ( ".AddLink" ). click ( function () {             $ ( "#NoteDialog" ). html ( "" )                 . dialog ( "option" , "title" , "Add Note" )                 . load ( "/Home/Create" , function () { $ ( "#NoteDialog" ). dialog ( "open" ); });         });         LoadList ();     });     function LoadList () {         $ ( "#NoteListBlock" ). load ( "/Home/List" );     } < /script> The <div> tag with the id attribute of "NoteListBlock" is used as a container target for the load of the partial view content of our List action method. It starts out empty and will get loaded with content via jQuery once the DOM is loaded. The <div> tag with the id attribute of "NoteDialog" is the element for our dialog widget. The jQuery UI library will use the title attribute for the text in the dialog widget top header bar. We start out with it empty here and will dynamically change the text via jQuery based on the request to either add or edit a note. This <div> tag is given a CSS class named "Hidden" that will set the display:none style on the element. Since our call to the jQuery UI method to make the element a dialog widget will occur in the jQuery document ready code block, the end user will see the <div> element rendered in their browser as the page renders and then it will hide after that jQuery call. Adding the display:hidden to the <div> element via CSS will ensure that it is never rendered until the user triggers the request to open the dialog. The jQuery document load block contains the setup for the dialog node, click event bindings for the edit and add links, and a call to a JavaScript function called LoadList that handles the AJAX call to the List action method. The .dialog() method is called on the "NoteDialog" <div> element and the options are set for the dialog widget. The buttons option defines 2 buttons and their click actions. The first is the "Save" button (the text in quotations is used as the text for the button) that will do an AJAX post to our Save action method and send the serialized form data from the note form (targeted with the id attribute "NoteForm"). Upon completion it will close the dialog widget and call the LoadList to update the UX without a redirect. The "Cancel" button simply closes the dialog widget. The .live() method handles binding a function to the "click" event on all elements with the CSS class named EditLink . We use the .live() method because it will catch and bind our function to elements even as the DOM changes. Since we will be constantly changing the note list as we add and edit we want to ensure that the edit links get wired up with click events. The function for the click event on the edit links gets the noteid attribute and stores it in a local variable. Then it clears out the HTML in the dialog element (to ensure a fresh start), calls the .dialog() method and sets the "title" option (this sets the title attribute value), and then calls the .load() AJAX method to hit our Edit action method and inject the returned content into the "NoteDialog" <div> element. Once the .load() method is complete it opens the dialog widget. The click event binding for the add link is similar to the edit, only we don't need to get the id value and we load the Create action method. This binding is done via the .click() method because it will only be bound on the initial load of the page. The add button will always exist. Finally, we toss in some CSS in the Content/Site.css file to style our form and the add/edit links. . ButtonLink { color : Blue ; cursor : pointer ; } . ButtonLink : hover { text - decoration : underline ; } . Hidden { display : none ; } #NoteForm label { display:block; margin-bottom:6px; } #NoteForm label > span { font-weight:bold; } #NoteForm input[type=text] { width:350px; } #NoteForm textarea { width:350px; height:80px; } With all of our code in place we can do an F5 and see our list of notes: If we click on an edit link we will get the dialog widget with the correct note data loaded: And if we click on the add new note link we will get the dialog widget with the empty form: The end result of our solution tree for our sample:

    Read the article

  • Why doesn't Ubuntu detect my second hard drive?

    - by user93179
    I am new to Linux and to Ubuntu, I was wondering, I have two hard drives setup in SATA ports (non-raid, at least I don't think they are). I installed ubuntu unto the drives fresh without any previous versions or windows at all. However when I got the Ubuntu 12.04 LTS working, all I see is 1 x 120 gigabyte harddrive. Also, not sure if this is important or not, my hard drives are SSD. My computer specs are Asus P9Z77-V-LK Nvidia Geforce GTX 660 TI Intel i5 3570k 3.4 /proc/partitions shows: major minor #blocks name 8 0 117220824 sda 8 1 117219328 sda1 8 16 117220824 sdb 8 17 96256 sdb1 8 18 108780544 sdb2 8 19 8342528 sdb3 11 0 1048575 sr0 and ls -l /sys/block/ | grep -v /virtual/: lrwxrwxrwx 1 root root 0 Sep 27 17:26 sda - ../devices/pci0000:00/0000:00:1f.2/host0/target0:0:0/0:0:0:0/block/sda lrwxrwxrwx 1 root root 0 Sep 27 17:26 sdb - ../devices/pci0000:00/0000:00:1f.2/host1/target1:0:0/1:0:0:0/block/sdb lrwxrwxrwx 1 root root 0 Sep 27 22:26 sdc - ../devices/pci0000:00/0000:00:1a.0/usb1/1-1/1-1.1/1-1.1:1.0/host6/target6:0:0/6:0:0:0/block/sdc lrwxrwxrwx 1 root root 0 Sep 27 22:04 sr0 - ../devices/pci0000:00/0000:00:1f.2/host3/target3:0:0/3:0:0:0/block/sr0 sudo file -s /dev/sd*: /dev/sda: x86 boot sector; partition 1: ID=0x7, starthead 32, startsector 2048, 234438656 sectors, code offset 0xc0, OEM-ID " ?", Bytes/sector 190, sectors/cluster 124, reserved sectors 191, FATs 6, root entries 185, sectors 64514 (volumes 32 MB) , physical drive 0x7e, dos 32 MB) , FAT (32 bit), sectors/FAT 749, reserved3 0x800000, serial number 0x35361a2b, unlabeled /dev/sdb2: Linux rev 1.0 ext4 filesystem data, UUID=387761ac-5eba-4d0f-93ba-746a82fb541d (needs journal recovery) (extents) (large files) (huge files) /dev/sdb3: data /dev/sdc: x86 boot sector; partition 1: ID=0xc, active, starthead 0, startsector 8064, 30473088 sectors, code offset 0xc0 /dev/sdc1: x86 boot sector, code offset 0x58, OEM-ID "SYSLINUX", sectors/cluster 64, reserved sectors 944, Media descriptor 0xf8, heads 128, hidden sectors 8064, sectors 30473088 (volumes 32 MB) , FAT (32 bit), sectors/FAT 3720, Backup boot sector 8, serial number 0xf90c12e9, label: "KINGSTON " /dev/sda1: x86 boot sector, code offset 0x52, OEM-ID "NTFS ", sectors/cluster 8, reserved sectors 0, Media descriptor 0xf8, heads 255, hidden sectors 2048, dos 32 MB) , FAT (32 bit), sectors/FAT 749, reserved3 0x800000, serial number 0x35361a2b, unlabeled Any help would be greatly appreciated! Thanks Another thing I noticed is, when i use gparted to locate my drives, it seems that sda1 is my second drive that I am not detecting when I boot up and my ubuntu + FAT Boot files are installed in sdb1

    Read the article

  • jqGrid multi-checkbox custom edittype solution

    - by gsiler
    For those of you trying to understand jqGrid custom edit types ... I created a multi-checkbox form element, and thought I'd share. This was built using version 3.6.4. If anyone has a more efficient solution, please pass it on. Within the colModel, the appropriate edit fields look like this: edittype:'custom' editoptions:{ custom_element:MultiCheckElem, custom_value:MultiCheckVal, list:'Check1,Check2,Check3,Check4' } Here are the javascript functions (BTW, It also works – with some modifications – when the list of checkboxes is in a DIV block): //———————————————————— // Description: // MultiCheckElem is the "custom_element" function that builds the custom multiple check box input // element. From what I have gathered, jqGrid calls this the first time the form is launched. After // that, only the "custom_value" function is called. // // The full list of checkboxes is in the jqGrid "editoptions" section "list" tag (in the options // parameter). //———————————————————— function MultiCheckElem( value, options ) { //———- // for each checkbox in the list // build the input element // set the initial "checked" status // endfor //———- var ctl = ''; var ckboxAry = options.list.split(','); for ( var i in ckboxAry ) { var item = ckboxAry[i]; ctl += '<input type="checkbox" '; if ( value.indexOf(item + '|') != -1 ) ctl += 'checked="checked" '; ctl += 'value="' + item + '"> ' + item + '</input><br />&nbsp;'; } ctl = ctl.replace( /<br />&nbsp;$/, '' ); return ctl; } //———————————————————— // Description: // MultiCheckVal is the "custom_value" function for the custom multiple check box input element. It // appears that jqGrid invokes this function the first time the form is submitted and, the rest of // the time, when the form is launched (action = set) and when it is submitted (action = 'get'). //———————————————————— function MultiCheckVal(elem, action, val) { var items = ''; if (action == 'get') // the form has been submitted { //———- // for each input element // if it's checked, add it to the list of items // endfor //———- for (var i in elem) { if (elem[i].tagName == 'INPUT' && elem[i].checked ) items += elem[i].value + ','; } // items contains a comma delimited list that is returned as the result of the element items = items.replace(/,$/, ''); } else // the form is launched { //———- // for each input element // based on the input value, set the checked status // endfor //———- for (var i in elem) { if (elem[i].tagName == 'INPUT') { if (val.indexOf(elem[i].value + '|') == -1) elem[i].checked = false; else elem[i].checked = true; } } // endfor } return items; }

    Read the article

  • BouncyCastle GCM/CCM Exceprion in JAVA

    - by 4r1y4n
    can anyone give me an example for using GCM and/or CCM modes with AES in BouncyCastle? My code is this: SecretKeySpec key = new SecretKeySpec(keyBytes, "AES"); IvParameterSpec ivSpec = new IvParameterSpec(ivBytes); Cipher cipher = Cipher.getInstance("AES/AEAD/PKCS5Padding", "BC"); byte[] block = new byte[1048576]; int i; long st,et; cipher.init(Cipher.ENCRYPT_MODE, key, ivSpec); BufferedInputStream bIn=new BufferedInputStream(new ProgressMonitorInputStream(null,"Encrypting ...",new FileInputStream("input"))); CipherInputStream cIn = new CipherInputStream(bIn, cipher); BufferedOutputStream bOut=new BufferedOutputStream(new FileOutputStream("output.enc")); int ch; while ((i = cIn.read(block)) != -1) { bOut.write(block, 0, i); } cIn.close(); bOut.close(); Thread.sleep(5000); cipher.init(Cipher.DECRYPT_MODE, key, ivSpec); BufferedInputStream fis=new BufferedInputStream(new ProgressMonitorInputStream(null,"Decrypting ...",new FileInputStream("output.enc"))); //FileInputStream fis=new FileInputStream("output.enc"); //FileOutputStream ro=new FileOutputStream("regen.plain"); BufferedOutputStream ro=new BufferedOutputStream(new FileOutputStream("regen.plain")); CipherInputStream dcIn = new CipherInputStream(fis, cipher); while ((i = dcIn.read(block)) != -1) { ro.write(block, 0, i); } dcIn.close(); ro.close(); but it throws this exception when decrypting in GCM mode (line 70 is bOut.write(block, 0, i);): Exception in thread "main" java.lang.ArrayIndexOutOfBoundsException at java.lang.System.arraycopy(Native Method) at org.bouncycastle.crypto.modes.CCMBlockCipher.processPacket(Unknown Source) at org.bouncycastle.crypto.modes.CCMBlockCipher.doFinal(Unknown Source) at org.bouncycastle.jcajce.provider.symmetric.util.BaseBlockCipher$AEADGenericBlockCipher.doFinal(Unknown Source) at org.bouncycastle.jcajce.provider.symmetric.util.BaseBlockCipher.engineDoFinal(Unknown Source) at javax.crypto.Cipher.doFinal(DashoA13*..) at javax.crypto.CipherInputStream.a(DashoA13*..) at javax.crypto.CipherInputStream.read(DashoA13*..) at javax.crypto.CipherInputStream.read(DashoA13*..) at enctest.Main.main(Main.java:70) And this Exception when encrypting in CCM mode (line 70 is bOut.write(block, 0, i);): Exception in thread "main" java.lang.ArrayIndexOutOfBoundsException at java.lang.System.arraycopy(Native Method) at org.bouncycastle.crypto.modes.CCMBlockCipher.processPacket(Unknown Source) at org.bouncycastle.crypto.modes.CCMBlockCipher.doFinal(Unknown Source) at org.bouncycastle.jcajce.provider.symmetric.util.BaseBlockCipher$AEADGenericBlockCipher.doFinal(Unknown Source) at org.bouncycastle.jcajce.provider.symmetric.util.BaseBlockCipher.engineDoFinal(Unknown Source) at javax.crypto.Cipher.doFinal(DashoA13*..) at javax.crypto.CipherInputStream.a(DashoA13*..) at javax.crypto.CipherInputStream.read(DashoA13*..) at javax.crypto.CipherInputStream.read(DashoA13*..) at enctest.Main.main(Main.java:70)

    Read the article

  • JavaScript recursion does not work properly

    - by misha-moroshko
    Hi, Could anyone say why the following recursive function does not work for me ? It should collect recursively all radio buttons in a given element. But, it does not found any for some reason !? Thanks !! <?xml version="1.0" encoding="Windows-1255"?> <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"> <head> <script type="text/javascript"> function AllInputs(radioElement) { this.radioInputs = ((arguments.length == 1) ? [radioElement] : []); } AllInputs.prototype.toString = function() { return "[object AllInputs: radioInputs: " + this.radioInputs.length + "]"; } AllInputs.prototype.add = function(otherAllInputs) { this.radioInputs = this.radioInputs.concat(otherAllInputs.radioInputs); } function getAllInputsOfElement(element) { if (element.tagName.toLowerCase() == "input") { if (element.getAttribute("type").toLowerCase() == "radio") { return new AllInputs(element); } else { return new AllInputs(); } } else { var result = new AllInputs(); for (i = 0; i < element.children.length; i++) { result.add(getAllInputsOfElement(element.children[i])); } return result; } } function main() { alert(getAllInputsOfElement(document.getElementById("MyTable"))); } </script> </head> <body onload="main()"> <table id="MyTable"> <tr><td>Day</td></tr> <tr><td> <input type="radio" name="DayOfTheWeek" value="1" /><label>Monday</label> <input type="radio" name="DayOfTheWeek" value="2" /><label>Tuesday</label> <input type="radio" name="DayOfTheWeek" value="3" /><label>Wednesday</label> </td></tr> </table> </body> </html>

    Read the article

  • Inline-editing: onBlur prevents onClick from being triggered (jQuery)

    - by codethief
    Hello StackOverflow community! I'm currently working on my own jQuery plugin for inline-editing as those that already exist don't fit my needs. Anyway, I'd like to give the user the following (boolean) options concerning the way editing is supposed to work: submit_button reset_on_blur Let's say the user would like to have a submit button (submit_button = true) and wants the inline input element to be removed as soon as it loses focus (reset_on_blur = true). This leads to an onClick handler being registered for the button and an onBlur handler being registered for the input element. Every time the user clicks the button, however, the onBlur handler is also triggered and results in the edit mode being left, i.e. before the onClick event occurs. This makes submitting impossible. FYI, the HTML in edit mode looks like this: <td><input type="text" class="ie-input" value="Current value" /><div class="ie-content-backup" style="display: none;">Backup Value</div><input type="submit" class="ie-button-submit" value="Save" /></td> So, is there any way I could check in the onBlur handler if the focus was lost while activating the submit button, so that edit mode isn't left before the submit button's onClick event is triggered? I've also tried to register a $('body').click() handler to simulate blur and to be able to trace back which element has been clicked, but that didn't work either and resulted in rather strange bugs: $('html').click(function(e) { // body doesn't span over full page height, use html instead // Don't reset if the submit button, the input element itself or the element to be edited inline was clicked. if(!$(e.target).hasClass('ie-button-submit') && !$(e.target).hasClass('ie-input') && $(e.target).get(0) != element.get(0)) { cancel(element); } }); jEditable uses the following piece of code. I don't like this approach, though, because of the delay. Let alone I don't even understand why this works. ;) input.blur(function(e) { /* prevent canceling if submit was clicked */ t = setTimeout(function() { reset.apply(form, [settings, self]); }, 500); }); Thanks in advance!

    Read the article

  • jQuery: Sort div's according to content of different sub divs

    - by rayne
    I'm trying to create a somewhat complex sorting feature which neither uses divs nor lists. Unfortunately two hours of googling didn't help me. Here is the basic setup of my HTML: <div id="all_elements"> <!-- one element --> <div class="element"> <div class="wrapper"> <a href="/" title="links"> <img src="/img/image.jpg" border="0" alt="image" class="image" /></a> <div class="details"> <h3><a href="/" title="title">Name (Sort Argument 1)</a></h3> <div class="title"><a href="/" title="title">Title (Sort Argument 2)</a></div> <div class="year">2010 (Sort Argumentt 3)</div> <div class="country">Great Britain (Sort Argument 4)</div> </div><!-- details --> </div><!-- wrapper --> </div><!-- element --> </div> <!--all_elements--> The setup is a bit complex, but basically .element is the element that needs to be sorted alphabetically according to either the contents of h3, div.title, div.year or div.country. So the user will be able to view the contents of the site either sorted by name, by year, by country or by title. I have this jQuery snippet from a website, but all my attempts on trying to tell it to use the contents of e.g. h3 to sort have failed. Right now it sorts pretty much randomly. jQuery.fn.sort = function() { return this.pushStack([].sort.apply(this, arguments), []); }; function sortAscending(a, b) { return a.innerHTML > b.innerHTML ? 1 : -1; }; function sortDescending(a, b) { return a.innerHTML < b.innerHTML ? 1 : -1; }; $(document).ready(function() { $("#sort").toggle( function() { $('#all_elements .element').sort(sortDescending).appendTo('#all_elements'); $(this).text("Sort Asc"); }, function() { $('#all_elements .element').sort(sortAscending).appendTo('#all_elements'); $(this).text("Sort Desc"); }); }); How can I customize the function to sort the contents of my h3 or divs?

    Read the article

  • How to stream XML data using XOM?

    - by Jonik
    Say I want to output a huge set of search results, as XML, into a PrintWriter or an OutputStream, using XOM. The resulting XML would look like this: <?xml version="1.0" encoding="UTF-8"?> <resultset> <result> [child elements and data] </result> ... ... [1000s of result elements more] </resultset> Because the resulting XML document could be big (tens or hundreds of megabytes, perhaps), I want to output it in a streaming fashion (instead of creating the whole Document in memory and then writing that). The granularity of outputting one <result> at a time is fine, so I want to generate one <result> after another, and write it into the stream. Assume there's already a method that helps with iterating the results and generating Element objects: public nu.xom.Element getNextResult(); So I'd simply like to do something like this pseudocode (automatic flushing enabled, so don't worry about that) : open stream/writer write declaration write start tag for <resultset> while more results: write next <result> element write end tag for <resultset> close stream/writer I've been looking at Serializer, but the necessary methods, writeStartTag(Element), writeEndTag(Element), write(DocType) are protected, not public! Is there no other way than to subclass Serializer to be able to use those methods, or to manually write the start and end tags directly into the stream as Strings, bypassing XOM altogether? (The latter wouldn't be too bad in this simple example, but in the general case it would get quite ugly.) Am I missing something or is XOM just not made for this? With dom4j I could do this easily using XMLWriter - it has constructors that take a Writer or OutputStream, and methods writeOpen(Element), writeClose(Element), writeDocType(DocumentType) etc. Compare to XOM's Serializer where the only public write method is the one that takes a whole Document. Please refrain from answering if you're not familiar with XOM! I specifically want to know if and how you can do this kind of streaming with that library. (This is related to my question about the best dom4j replacement where XOM is a strong contender.)

    Read the article

  • XSL transformation and special XML entities escaping

    - by Tomas R
    I have an XML file which is transformed with XSL. Some elements have to be changed, some have to be left as is - specifically, text with entities &quot;, &amp;, &apos;, &lt;, &gt; should be left as is, and in my case &quot; and &apos; are changed to " and ' accordingly. Test XML: <?xml version="1.0" encoding="UTF-8" ?> <root> <element> &quot; &amp; &apos; &lt; &gt; </element> </root> transformation file: <?xml version="1.0" encoding="UTF-8"?> <xsl:stylesheet xmlns:xsl="http://www.w3.org/1999/XSL/Transform" version="1.0"> <xsl:output method="xml" encoding="UTF-8" omit-xml-declaration="no" indent="no" /> <xsl:template match="element"> <xsl:copy> <xsl:value-of disable-output-escaping="no" select="." /> </xsl:copy> </xsl:template> </xsl:stylesheet> result: <?xml version="1.0" encoding="UTF-8"?> <element> " &amp; ' &lt; &gt; </element> desired result: <?xml version="1.0" encoding="UTF-8"?> <element> &quot; &amp; &apos; &lt; &gt; </element> I have 2 questions: why does some of those entities are transformed and other not? how can I get a desired result?

    Read the article

  • Parsing Data in XML and Storing to DB in Python

    - by Rakesh
    Hi Guys i have problem parsing an xml file and entering the data to sqlite, the format is like i need to enter the chracters before the token like 111,AAA,BBB etc <DOCUMENT> <PAGE width="544.252" height="634.961" number="1" id="p1"> <MEDIABOX x1="0" y1="0" x2="544.252" y2="634.961"/> <BLOCK id="p1_b1"> <TEXT width="37.7" height="74.124" id="p1_t1" x="51.1" y="20.8652"> <TOKEN sid="p1_s11" id="p1_w1" font-name="Verdanae" bold="yes" italic="no">111</TOKEN> </TEXT> </BLOCK> <BLOCK id="p1_b3"> <TEXT width="151.267" height="10.725" id="p1_t6" x="24.099" y="572.096"> <TOKEN sid="p1_s35" id="p1_w22" font-name="Verdanae" bold="yes" italic="yes">AAA</TOKEN> <TOKEN sid="p1_s36" id="p1_w23" font-name="verdanae" bold="yes" italic="no">BBB</TOKEN> <TOKEN sid="p1_s37" id="p1_w24" font-name="verdanae" bold="yes" italic="no">CCC</TOKEN> </TEXT> </BLOCK> <BLOCK id="p1_b4"> <TEXT width="82.72" height="26" id="p1_t7" x="55.426" y="138.026"> <TOKEN sid="p1_s42" id="p1_w29" font-name="verdanae" bold="yes" italic="no">DDD</TOKEN> <TOKEN sid="p1_s43" id="p1_w30" font-name="verdanae" bold="yes" italic="no">EEE</TOKEN> </TEXT> <TEXT width="101.74" height="26" id="p1_t8" x="55.406" y="162.026"> <TOKEN sid="p1_s45" id="p1_w31" font-name="verdanae" bold="yes" italic="no">FFF</TOKEN> </TEXT> <TEXT width="152.96" height="26" id="p1_t9" x="55.406" y="186.026"> <TOKEN sid="p1_s47" id="p1_w32" font-name="verdanae" bold="yes" italic="no">GGG</TOKEN> <TOKEN sid="p1_s48" id="p1_w33" font-name="verdanae" bold="yes" italic="no">HHH</TOKEN> </TEXT> </BLOCK> </PAGE> </DOCUMENT> in .net it is done with 3 foreach loops 1. for "DOCUMENT/PAGE/BLOCK" 2."TEXT" 3. "TOKEN" and then it is entered into the DB i dont get how to do it in python and i am trying it with lxml module

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • Writing to a xml file in java

    - by user243680
    import java.io.*; import javax.xml.parsers.*; import javax.xml.transform.*; import javax.xml.transform.dom.*; import javax.xml.transform.stream.*; import org.w3c.dom.*; public class CreatXMLFile { public static void main(String[] args) throws Exception { BufferedReader bf = new BufferedReader(new InputStreamReader(System.in)); // System.out.print("Enter number to add elements in your XML file: "); // String str = bf.readLine(); int no=2; // System.out.print("Enter root: "); String root = "SMS"; DocumentBuilderFactory documentBuilderFactory =DocumentBuilderFactory.newInstance(); DocumentBuilder documentBuilder =documentBuilderFactory.newDocumentBuilder(); Document document = documentBuilder.newDocument(); Element rootElement = document.createElement(root); document.appendChild(rootElement); // for (int i = 1; i <= no; i++) // System.out.print("Enter the element: "); // String element = bf.readLine(); String element ="Number"; System.out.print("Enter the Number: "); String data = bf.readLine(); Element em = document.createElement(element); em.appendChild(document.createTextNode(data)); rootElement.appendChild(em); String element1 ="message"; System.out.print("Enter the SMS: "); String data1 = bf.readLine(); Element em1 = document.createElement(element1); em1.appendChild(document.createTextNode(data1)); rootElement.appendChild(em1); TransformerFactory transformerFactory = TransformerFactory.newInstance(); Transformer transformer = transformerFactory.newTransformer(); DOMSource source = new DOMSource(document); StreamResult result = new StreamResult(System.out); transformer.transform(source, result); } } i am working on the above code and it gives the following output run: Enter the Number: 768678 Enter the SMS: ytu <?xml version="1.0" encoding="UTF-8" standalone="no"?><SMS><Number>768678</Number><message>ytu</message></SMS>BUILD SUCCESSFUL (total time: 8 seconds) Now i want to write the output generated(<?xml version="1.0" encoding="UTF-8" standalone="no"?><SMS><Number>768678</Number><message>ytu</message></SMS>) to a XML file on the hard disk.How do i do it?

    Read the article

  • Is there a way to enforce/preserve order of XML elements in an XML Schema?

    - by MarcoS
    Let's consider the following XML Schema: <?xml version="1.0" encoding="UTF-8"?> <schema targetNamespace="http://www.example.org/library" elementFormDefault="qualified" xmlns="http://www.w3.org/2001/XMLSchema" xmlns:lib="http://www.example.org/library"> <element name="library" type="lib:libraryType"></element> <complexType name="libraryType"> <sequence> <element name="books" type="lib:booksType"></element> </sequence> </complexType> <complexType name="booksType"> <sequence> <element name="book" type="lib:bookType" maxOccurs="unbounded" minOccurs="1"></element> </sequence> </complexType> <complexType name="bookType"> <attribute name="title" type="string"></attribute> </complexType> </schema> and a corresponding XML example: <?xml version="1.0" encoding="UTF-8"?> <lib:library xmlns:lib="http://www.example.org/library" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:schemaLocation="http://www.example.org/library src/library.xsd "> <lib:books> <lib:book title="t1"/> <lib:book title="t2"/> <lib:book title="t3"/> </lib:books> </lib:library> Is there a way to guarantee that the order of <lib:book .../> elements is preserved? I want to be sure that any parser reading the XML will return books in the specified oder, that is first the book with title="t1", then the book with title="t2", and finally the book with title="t3". As far as I know XML parsers are not required to preserve order. I wonder whether one can enforce this through XML Schema? One quick solution for me would be adding an index attribute to the <lib:book .../> element, and delegate order preservation to the application reading the XML. Comments? Suggestions?

    Read the article

  • LWJGL Voxel game, glDrawArrays

    - by user22015
    I've been learning about 3D for a couple days now. I managed to create a chunk (8x8x8). Add optimization so it only renders the active and visible blocks. Then I added so it only draws the faces which don't have a neighbor. Next what I found from online research was that it is better to use glDrawArrays to increase performance. So I restarted my little project. Render an entire chunck, add optimization so it only renders active and visible blocks. But now I want to add so it only draws the visible faces while using glDrawArrays. This is giving me some trouble with calling glDrawArrays because I'm passing a wrong count parameter. > # A fatal error has been detected by the Java Runtime Environment: > # > # EXCEPTION_ACCESS_VIOLATION (0xc0000005) at pc=0x0000000006e31a03, pid=1032, tid=3184 > # Stack: [0x00000000023a0000,0x00000000024a0000], sp=0x000000000249ef70, free space=1019k Native frames: (J=compiled Java code, j=interpreted, Vv=VM code, C=native code) C [ig4icd64.dll+0xa1a03] Java frames: (J=compiled Java code, j=interpreted, Vv=VM code) j org.lwjgl.opengl.GL11.nglDrawArrays(IIIJ)V+0 j org.lwjgl.opengl.GL11.glDrawArrays(III)V+20 j com.vox.block.Chunk.render()V+410 j com.vox.ChunkManager.render()V+30 j com.vox.Game.render()V+11 j com.vox.GameHandler.render()V+12 j com.vox.GameHandler.gameLoop()V+15 j com.vox.Main.main([Ljava/lang/StringV+13 v ~StubRoutines::call_stub public class Chunk { public final static int[] DIM = { 8, 8, 8}; public final static int CHUNK_SIZE = (DIM[0] * DIM[1] * DIM[2]); Block[][][] blocks; private int index; private int vBOVertexHandle; private int vBOColorHandle; public Chunk(int index) { this.index = index; vBOColorHandle = GL15.glGenBuffers(); vBOVertexHandle = GL15.glGenBuffers(); blocks = new Block[DIM[0]][DIM[1]][DIM[2]]; for(int x = 0; x < DIM[0]; x++){ for(int y = 0; y < DIM[1]; y++){ for(int z = 0; z < DIM[2]; z++){ blocks[x][y][z] = new Block(); } } } } public void render(){ Block curr; FloatBuffer vertexPositionData2 = BufferUtils.createFloatBuffer(CHUNK_SIZE * 6 * 12); FloatBuffer vertexColorData2 = BufferUtils.createFloatBuffer(CHUNK_SIZE * 6 * 12); int counter = 0; for(int x = 0; x < DIM[0]; x++){ for(int y = 0; y < DIM[1]; y++){ for(int z = 0; z < DIM[2]; z++){ curr = blocks[x][y][z]; boolean[] neightbours = validateNeightbours(x, y, z); if(curr.isActive() && !neightbours[6]) { float[] arr = curr.createCube((index*DIM[0]*Block.BLOCK_SIZE*2) + x*2, y*2, z*2, neightbours); counter += arr.length; vertexPositionData2.put(arr); vertexColorData2.put(createCubeVertexCol(curr.getCubeColor())); } } } } vertexPositionData2.flip(); vertexPositionData2.flip(); FloatBuffer vertexPositionData = BufferUtils.createFloatBuffer(vertexColorData2.position()); FloatBuffer vertexColorData = BufferUtils.createFloatBuffer(vertexColorData2.position()); for(int i = 0; i < vertexPositionData2.position(); i++) vertexPositionData.put(vertexPositionData2.get(i)); for(int i = 0; i < vertexColorData2.position(); i++) vertexColorData.put(vertexColorData2.get(i)); vertexColorData.flip(); vertexPositionData.flip(); GL15.glBindBuffer(GL15.GL_ARRAY_BUFFER, vBOVertexHandle); GL15.glBufferData(GL15.GL_ARRAY_BUFFER, vertexPositionData, GL15.GL_STATIC_DRAW); GL15.glBindBuffer(GL15.GL_ARRAY_BUFFER, 0); GL15.glBindBuffer(GL15.GL_ARRAY_BUFFER, vBOColorHandle); GL15.glBufferData(GL15.GL_ARRAY_BUFFER, vertexColorData, GL15.GL_STATIC_DRAW); GL15.glBindBuffer(GL15.GL_ARRAY_BUFFER, 0); GL11.glPushMatrix(); GL15.glBindBuffer(GL15.GL_ARRAY_BUFFER, vBOVertexHandle); GL11.glVertexPointer(3, GL11.GL_FLOAT, 0, 0L); GL15.glBindBuffer(GL15.GL_ARRAY_BUFFER, vBOColorHandle); GL11.glColorPointer(3, GL11.GL_FLOAT, 0, 0L); System.out.println("Counter " + counter); GL11.glDrawArrays(GL11.GL_LINE_LOOP, 0, counter); GL11.glPopMatrix(); //blocks[r.nextInt(DIM[0])][2][r.nextInt(DIM[2])].setActive(false); } //Random r = new Random(); private float[] createCubeVertexCol(float[] CubeColorArray) { float[] cubeColors = new float[CubeColorArray.length * 4 * 6]; for (int i = 0; i < cubeColors.length; i++) { cubeColors[i] = CubeColorArray[i % CubeColorArray.length]; } return cubeColors; } private boolean[] validateNeightbours(int x, int y, int z) { boolean[] bools = new boolean[7]; bools[6] = true; bools[6] = bools[6] && (bools[0] = y > 0 && y < DIM[1]-1 && blocks[x][y+1][z].isActive());//top bools[6] = bools[6] && (bools[1] = y > 0 && y < DIM[1]-1 && blocks[x][y-1][z].isActive());//bottom bools[6] = bools[6] && (bools[2] = z > 0 && z < DIM[2]-1 && blocks[x][y][z+1].isActive());//front bools[6] = bools[6] && (bools[3] = z > 0 && z < DIM[2]-1 && blocks[x][y][z-1].isActive());//back bools[6] = bools[6] && (bools[4] = x > 0 && x < DIM[0]-1 && blocks[x+1][y][z].isActive());//left bools[6] = bools[6] && (bools[5] = x > 0 && x < DIM[0]-1 && blocks[x-1][y][z].isActive());//right return bools; } } public class Block { public static final float BLOCK_SIZE = 1f; public enum BlockType { Default(0), Grass(1), Dirt(2), Water(3), Stone(4), Wood(5), Sand(6), LAVA(7); int BlockID; BlockType(int i) { BlockID=i; } } private boolean active; private BlockType type; public Block() { this(BlockType.Default); } public Block(BlockType type){ active = true; this.type = type; } public float[] getCubeColor() { switch (type.BlockID) { case 1: return new float[] { 1, 1, 0 }; case 2: return new float[] { 1, 0.5f, 0 }; case 3: return new float[] { 0, 0f, 1f }; default: return new float[] {0.5f, 0.5f, 1f}; } } public float[] createCube(float x, float y, float z, boolean[] neightbours){ int counter = 0; for(boolean b : neightbours) if(!b) counter++; float[] array = new float[counter*12]; int offset = 0; if(!neightbours[0]){//top array[offset++] = x*BLOCK_SIZE + BLOCK_SIZE; array[offset++] = y*BLOCK_SIZE + BLOCK_SIZE; array[offset++] = z*BLOCK_SIZE - BLOCK_SIZE; array[offset++] = x*BLOCK_SIZE - BLOCK_SIZE; array[offset++] = y*BLOCK_SIZE + BLOCK_SIZE; array[offset++] = z*BLOCK_SIZE - BLOCK_SIZE; array[offset++] = x*BLOCK_SIZE - BLOCK_SIZE; array[offset++] = y*BLOCK_SIZE + BLOCK_SIZE; array[offset++] = z*BLOCK_SIZE + BLOCK_SIZE; array[offset++] = x*BLOCK_SIZE + BLOCK_SIZE; array[offset++] = y*BLOCK_SIZE + BLOCK_SIZE; array[offset++] = z*BLOCK_SIZE + BLOCK_SIZE; } if(!neightbours[1]){//bottom array[offset++] = x*BLOCK_SIZE + BLOCK_SIZE; array[offset++] = y*BLOCK_SIZE - BLOCK_SIZE; array[offset++] = z*BLOCK_SIZE + BLOCK_SIZE; array[offset++] = x*BLOCK_SIZE - BLOCK_SIZE; array[offset++] = y*BLOCK_SIZE - BLOCK_SIZE; array[offset++] = z*BLOCK_SIZE + BLOCK_SIZE; array[offset++] = x*BLOCK_SIZE - BLOCK_SIZE; array[offset++] = y*BLOCK_SIZE - BLOCK_SIZE; array[offset++] = z*BLOCK_SIZE - BLOCK_SIZE; array[offset++] = x*BLOCK_SIZE + BLOCK_SIZE; array[offset++] = y*BLOCK_SIZE - BLOCK_SIZE; array[offset++] = z*BLOCK_SIZE - BLOCK_SIZE; } if(!neightbours[2]){//front array[offset++] = x*BLOCK_SIZE + BLOCK_SIZE; array[offset++] = y*BLOCK_SIZE + BLOCK_SIZE; array[offset++] = z*BLOCK_SIZE + BLOCK_SIZE; array[offset++] = x*BLOCK_SIZE - BLOCK_SIZE; array[offset++] = y*BLOCK_SIZE + BLOCK_SIZE; array[offset++] = z*BLOCK_SIZE + BLOCK_SIZE; array[offset++] = x*BLOCK_SIZE - BLOCK_SIZE; array[offset++] = y*BLOCK_SIZE - BLOCK_SIZE; array[offset++] = z*BLOCK_SIZE + BLOCK_SIZE; array[offset++] = x*BLOCK_SIZE + BLOCK_SIZE; array[offset++] = y*BLOCK_SIZE - BLOCK_SIZE; array[offset++] = z*BLOCK_SIZE + BLOCK_SIZE; } if(!neightbours[3]){//back array[offset++] = x*BLOCK_SIZE + BLOCK_SIZE; array[offset++] = y*BLOCK_SIZE - BLOCK_SIZE; array[offset++] = z*BLOCK_SIZE - BLOCK_SIZE; array[offset++] = x*BLOCK_SIZE - BLOCK_SIZE; array[offset++] = y*BLOCK_SIZE - BLOCK_SIZE; array[offset++] = z*BLOCK_SIZE - BLOCK_SIZE; array[offset++] = x*BLOCK_SIZE - BLOCK_SIZE; array[offset++] = y*BLOCK_SIZE + BLOCK_SIZE; array[offset++] = z*BLOCK_SIZE - BLOCK_SIZE; array[offset++] = x*BLOCK_SIZE + BLOCK_SIZE; array[offset++] = y*BLOCK_SIZE + BLOCK_SIZE; array[offset++] = z*BLOCK_SIZE - BLOCK_SIZE; } if(!neightbours[4]){//left array[offset++] = x*BLOCK_SIZE - BLOCK_SIZE; array[offset++] = y*BLOCK_SIZE + BLOCK_SIZE; array[offset++] = z*BLOCK_SIZE + BLOCK_SIZE; array[offset++] = x*BLOCK_SIZE - BLOCK_SIZE; array[offset++] = y*BLOCK_SIZE + BLOCK_SIZE; array[offset++] = z*BLOCK_SIZE - BLOCK_SIZE; array[offset++] = x*BLOCK_SIZE - BLOCK_SIZE; array[offset++] = y*BLOCK_SIZE - BLOCK_SIZE; array[offset++] = z*BLOCK_SIZE - BLOCK_SIZE; array[offset++] = x*BLOCK_SIZE - BLOCK_SIZE; array[offset++] = y*BLOCK_SIZE - BLOCK_SIZE; array[offset++] = z*BLOCK_SIZE + BLOCK_SIZE; } if(!neightbours[5]){//right array[offset++] = x*BLOCK_SIZE + BLOCK_SIZE; array[offset++] = y*BLOCK_SIZE + BLOCK_SIZE; array[offset++] = z*BLOCK_SIZE - BLOCK_SIZE; array[offset++] = x*BLOCK_SIZE + BLOCK_SIZE; array[offset++] = y*BLOCK_SIZE + BLOCK_SIZE; array[offset++] = z*BLOCK_SIZE + BLOCK_SIZE; array[offset++] = x*BLOCK_SIZE + BLOCK_SIZE; array[offset++] = y*BLOCK_SIZE - BLOCK_SIZE; array[offset++] = z*BLOCK_SIZE + BLOCK_SIZE; array[offset++] = x*BLOCK_SIZE + BLOCK_SIZE; array[offset++] = y*BLOCK_SIZE - BLOCK_SIZE; array[offset++] = z*BLOCK_SIZE - BLOCK_SIZE; } return Arrays.copyOf(array, offset); } public boolean isActive() { return active; } public void setActive(boolean active) { this.active = active; } public BlockType getType() { return type; } public void setType(BlockType type) { this.type = type; } } I highlighted the code I'm concerned about in this following screenshot: - http://imageshack.us/a/img820/7606/18626782.png - (Not allowed to upload images yet) I know the code is a mess but I'm just testing stuff so I wasn't really thinking about it.

    Read the article

  • Handling HumanTask attachments in Oracle BPM 11g PS4FP+ (II)

    - by ccasares
    Retrieving uploaded attachments -UCM- As stated in my previous blog entry, Oracle BPM 11g 11.1.1.5.1 (aka PS4FP) introduced a new cool feature whereby you can use Oracle WebCenter Content (previously known as Oracle UCM) as the repository for the human task attached documents. For more information about how to use or enable this feature, have a look here. The attachment scope (either TASK or PROCESS) also applies to UCM-attachments. But even with this other feature, one question might arise when using UCM attachments. How can I get them from within the process? The first answer would be to use the same getTaskAttachmentContents() XPath function already explained in my previous blog entry. In fact, that's the way it should be. But in Oracle BPM 11g 11.1.1.5.1 (PS4FP) and 11.1.1.6.0 (PS5) there's a bug that prevents you to do that. If you invoke such function against a UCM-attachment, you'll get a null content response (bug#13907552). Even if the attachment was correctly uploaded. While this bug gets fixed, next I will show a workaround that lets me to retrieve the UCM-attached documents from within a BPM process. Besides, the sample will show how to interact with WCC API from within a BPM process.Aside note: I suggest you to read my previous blog entry about Human Task attachments where I briefly describe some concepts that are used next, such as the execData/attachment[] structure. Sample Process I will be using the following sample process: A dummy UserTask using "HumanTask2" Human Task, followed by an Embedded Subprocess that will retrieve the attachments payload. In this case, and here's the key point of the sample, we will retrieve such payload using WebCenter Content WebService API (IDC): and once retrieved, we will write each of them back to a file in the server using a File Adapter service: In detail:  We will use the same attachmentCollection XSD structure and same BusinessObject definition as in the previous blog entry. However we create a separate variable, named attachmentUCM, based on such BusinessObject. We will still need to keep a copy of the HumanTask output's execData structure. Therefore we need to create a new variable of type TaskExecutionData (different one than the other used for non-UCM attachments): As in the non-UCM attachments flow, in the output tab of the UserTask mapping, we'll keep a copy of the execData structure: Now we get into the embedded subprocess that will retrieve the attachments' payload. First, and using an XSLT transformation, we feed the attachmentUCM variable with the following information: The name of each attachment (from execData/attachment/name element) The WebCenter Content ID of the uploaded attachment. This info is stored in execData/attachment/URI element with the format ecm://<id>. As we just want the numeric <id>, we need to get rid of the protocol prefix ("ecm://"). We do so with some XPath functions as detailed below: with these two functions being invoked, respectively: We, again, set the target payload element with an empty string, to get the <payload></payload> tag created. The complete XSLT transformation is shown below. Remember that we're using the XSLT for-each node to create as many target structures as necessary.  Once we have fed the attachmentsUCM structure and so it now contains the name of each of the attachments along with each WCC unique id (dID), it is time to iterate through it and get the payload. Therefore we will use a new embedded subprocess of type MultiInstance, that will iterate over the attachmentsUCM/attachment[] element: In each iteration we will use a Service activity that invokes WCC API through a WebService. Follow these steps to create and configure the Partner Link needed: Login to WCC console with an administrator user (i.e. weblogic). Go to Administration menu and click on "Soap Wsdls" link. We will use the GetFile service to retrieve a file based on its dID. Thus we'll need such service WSDL definition that can be downloaded by clicking the GetFile link. Save the WSDL file in your JDev project folder. In the BPM project's composite view, drag & drop a WebService adapter to create a new External Reference, based on the just added GetFile.wsdl. Name it UCM_GetFile. WCC services are secured through basic HTTP authentication. Therefore we need to enable the just created reference for that: Right-click the reference and click on Configure WS Policies. Under the Security section, click "+" to add the "oracle/wss_username_token_client_policy" policy The last step is to set the credentials for the security policy. For the sample we will use the admin user for WCC (weblogic/welcome1). Open the composite.xml file and select the Source view. Search for the UCM_GetFile entry and add the following highlighted elements into it:   <reference name="UCM_GetFile" ui:wsdlLocation="GetFile.wsdl">     <interface.wsdl interface="http://www.stellent.com/GetFile/#wsdl.interface(GetFileSoap)"/>     <binding.ws port="http://www.stellent.com/GetFile/#wsdl.endpoint(GetFile/GetFileSoap)"                 location="GetFile.wsdl" soapVersion="1.1">       <wsp:PolicyReference URI="oracle/wss_username_token_client_policy"                            orawsp:category="security" orawsp:status="enabled"/>       <property name="weblogic.wsee.wsat.transaction.flowOption"                 type="xs:string" many="false">WSDLDriven</property>       <property name="oracle.webservices.auth.username"                 type="xs:string">weblogic</property>       <property name="oracle.webservices.auth.password"                 type="xs:string">welcome1</property>     </binding.ws>   </reference> Now the new external reference is ready: Once the reference has just been created, we should be able now to use it from our BPM process. However we find here a problem. The WCC GetFile service operation that we will use, GetFileByID, accepts as input a structure similar to this one, where all element tags are optional: <get:GetFileByID xmlns:get="http://www.stellent.com/GetFile/">    <get:dID>?</get:dID>   <get:rendition>?</get:rendition>   <get:extraProps>      <get:property>         <get:name>?</get:name>         <get:value>?</get:value>      </get:property>   </get:extraProps></get:GetFileByID> and we need to fill up just the <get:dID> tag element. Due to some kind of restriction or bug on WCC, the rest of the tag elements must NOT be sent, not even empty (i.e.: <get:rendition></get:rendition> or <get:rendition/>). A sample request that performs the query just by the dID, must be in the following format: <get:GetFileByID xmlns:get="http://www.stellent.com/GetFile/">   <get:dID>12345</get:dID></get:GetFileByID> The issue here is that the simple mapping in BPM does create empty tags being a sample result as follows: <get:GetFileByID xmlns:get="http://www.stellent.com/GetFile/"> <get:dID>12345</get:dID> <get:rendition/> <get:extraProps/> </get:GetFileByID> Although the above structure is perfectly valid, it is not accepted by WCC. Therefore, we need to bypass the problem. The workaround we use (many others are available) is to add a Mediator component between the BPM process and the Service that simply copies the input structure from BPM but getting rid of the empty tags. Follow these steps to configure the Mediator: Drag & drop a new Mediator component into the composite. Uncheck the creation of the SOAP bindings and use the Interface Definition from WSDL template and select the existing GetFile.wsdl Double click in the mediator to edit it. Add a static routing rule to the GetFileByID operation, of type Service and select References/UCM_GetFile/GetFileByID target service: Create the request and reply XSLT mappers: Make sure you map only the dID element in the request: And do an Auto-mapper for the whole response: Finally, we can now add and configure the Service activity in the BPM process. Drag & drop it to the embedded subprocess and select the NormalizedGetFile service and getFileByID operation: Map both the input: ...and the output: Once this embedded subprocess ends, we will have all attachments (name + payload) in the attachmentsUCM variable, which is the main goal of this sample. But in order to test everything runs fine, we finish the sample writing each attachment to a file. To that end we include a final embedded subprocess to concurrently iterate through each attachmentsUCM/attachment[] element: On each iteration we will use a Service activity that invokes a File Adapter write service. In here we have two important parameters to set. First, the payload itself. The file adapter awaits binary data in base64 format (string). We have to map it using XPath (Simple mapping doesn't recognize a String as a base64-binary valid target): Second, we must set the target filename using the Service Properties dialog box: Again, note how we're making use of the loopCounter index variable to get the right element within the embedded subprocess iteration. Final blog entry about attachments will handle how to inject documents to Human Tasks from the BPM process and how to share attachments between different User Tasks. Will come soon. Again, once I finish will all posts on this matter, I will upload the whole sample project to java.net.

    Read the article

  • Mod Rewrite Help - Pseudo-Subdirectories

    - by Gimpyfuzznut
    I am dealing with a frustrating problem with Joomla that is going to require some url trickery. The idea is straight-forward but after reading a bunch of guides for mod-rewrite, I still can't seem to get it work. Let's say my site is www.mysite.com. Joomla is already performing some rewriting for SEF urls so I have links like www.mysite.com/home and www.mysite.com/news and so on. I want to be able to have (4) pseudo-subdirectories like www.mysite.com/mode1/ and www.mysite.com/mode2/ and so on. These subdirectories should work as if the subdirectory isn't there, ie both www.mysite.com/mode1/home and www.mysite.com/mode2/home should pull up the same www.mysite.com/home. It should point any www.mysite.com/mode1/anypagehere to www.mysite.com/anypagehere. The reason I am asking for this is because I will be reading the url for mode1, mode2, etc, to modify the template page. There will be a landing page that will direct people to /mode1/ and /mode2/ etc and the template will change based on that. Note, that I don't want to actually pass a parameter to the url accessible by a GET or whatever because Joomla removes it (perhaps because of my current mod_rewrite settings). I've pasted the current .htaccess file. RewriteBase /joomla ##########Rewrite rules to block out some common exploits RewriteCond %{QUERY_STRING} mosConfig_[a-zA-Z_]{1,21}(=|\%3D) [OR] # Block out any script trying to base64_encode crap to send via URL RewriteCond %{QUERY_STRING} base64_encode.*\(.*\) [OR] # Block out any script that includes a <script> tag in URL RewriteCond %{QUERY_STRING} (\<|%3C).*script.*(\>|%3E) [NC,OR] # Block out any script trying to set a PHP GLOBALS variable via URL RewriteCond %{QUERY_STRING} GLOBALS(=|\[|\%[0-9A-Z]{0,2}) [OR] # Block out any script trying to modify a _REQUEST variable via URL RewriteCond %{QUERY_STRING} _REQUEST(=|\[|\%[0-9A-Z]{0,2}) # Send all blocked request to homepage with 403 Forbidden error! RewriteRule ^(.*)$ index.php [F,L] ########## Begin - Joomla! core SEF Section RewriteCond %{REQUEST_FILENAME} !-f RewriteCond %{REQUEST_FILENAME} !-d RewriteCond %{REQUEST_URI} !^/index.php RewriteCond %{REQUEST_URI} (/|\.php|\.html|\.htm|\.feed|\.pdf|\.raw|/[^.]*)$ [NC] RewriteRule (.*) index.php #RewriteRule .* - [E=HTTP_AUTHORIZATION:%{HTTP:Authorization},L] ########## End - Joomla! core SEF Section

    Read the article

  • Benchmarking hosting providers IO with Bonnie

    - by Derek Organ
    Ok, because of a bunch of projects I'm working on I've access to dedicated Servers on a 3 hosting providers. As an experiment and for educational purposes I decided to see if I could benchmark how good the IO is with each. Bit of research lead me to Bonnie++ So I installed it on the server and ran this simple command /usr/sbin/bonnie -d /tmp/foo The 3 machines in different hosting providers are all dedicated machines, one is a VPS, other two are on some cloud platform e.g. VMWare / Xen using some kind of clustered SAN for storage This might be a naive thing to do but here are the results I found. HOST A Version 1.03c ------Sequential Output------ --Sequential Input- --Random- -Per Chr- --Block-- -Rewrite- -Per Chr- --Block-- --Seeks-- Machine Size K/sec %CP K/sec %CP K/sec %CP K/sec %CP K/sec %CP /sec %CP xxxxxxxxxxxxxxxx 1G 45081 88 56244 14 19167 4 20965 40 67110 6 67.2 0 ------Sequential Create------ --------Random Create-------- -Create-- --Read--- -Delete-- -Create-- --Read--- -Delete-- files /sec %CP /sec %CP /sec %CP /sec %CP /sec %CP /sec %CP 16 15264 28 +++++ +++ +++++ +++ +++++ +++ +++++ +++ +++++ +++ xxxxxxxx,1G,45081,88,56244,14,19167,4,20965,40,67110,6,67.2,0,16,15264,28,+++++,+++,+++++,+++,+++++,+++,+++++,+++,+++++,+++ HOST B Version 1.03d ------Sequential Output------ --Sequential Input- --Random- -Per Chr- --Block-- -Rewrite- -Per Chr- --Block-- --Seeks-- Machine Size K/sec %CP K/sec %CP K/sec %CP K/sec %CP K/sec %CP /sec %CP xxxxxxxxxxxx 4G 43070 91 64510 15 19092 0 29276 47 39169 0 448.2 0 ------Sequential Create------ --------Random Create-------- -Create-- --Read--- -Delete-- -Create-- --Read--- -Delete-- files /sec %CP /sec %CP /sec %CP /sec %CP /sec %CP /sec %CP 16 24799 52 +++++ +++ +++++ +++ 25443 54 +++++ +++ +++++ +++ xxxxxxx,4G,43070,91,64510,15,19092,0,29276,47,39169,0,448.2,0,16,24799,52,+++++,+++,+++++,+++,25443,54,+++++,+++,+++++,+++ HOST C Version 1.03c ------Sequential Output------ --Sequential Input- --Random- -Per Chr- --Block-- -Rewrite- -Per Chr- --Block-- --Seeks-- Machine Size K/sec %CP K/sec %CP K/sec %CP K/sec %CP K/sec %CP /sec %CP xxxxxxxxxxxxx 1536M 15598 22 85698 13 258969 20 16194 22 723655 21 +++++ +++ ------Sequential Create------ --------Random Create-------- -Create-- --Read--- -Delete-- -Create-- --Read--- -Delete-- files /sec %CP /sec %CP /sec %CP /sec %CP /sec %CP /sec %CP 16 14142 22 +++++ +++ 18621 22 13544 22 +++++ +++ 17363 21 xxxxxxxx,1536M,15598,22,85698,13,258969,20,16194,22,723655,21,+++++,+++,16,14142,22,+++++,+++,18621,22,13544,22,+++++,+++,17363,21 Ok, so first off what is the best way to read the figures and are there any issues with really comparing these numbers? Is this in any way a true representation of IO Speed? If not is there any way for me to test that? Note: these 3 machines are using either Ubuntu or Debian (I presume that doesn't really matter)

    Read the article

  • Sudoers file permissions

    - by twigg
    I'm trying to run the following command without the need for sudo: echo 1 | sudo tee -a /sys/block/$hd/device/delete The $hd variable changes dynamically from sdb - sdi for each one of my HDD's in my drive bay. I added the following line to the sudoers file: operator ALL=/sys/block/sdb/device/delete But this didn't make a difference its still asking for sudo password even if I run: echo 1 | sudo tee -a /sys/block/sdb/device/delete

    Read the article

  • Installation Error on Windows Vista: "Side-by-Side configuration is incorrect"

    - by Maxim Z.
    NOTE: This is not a dupe of this other question. That question refers to a similar problem with 2 programs, while I'm only having it with 1, so the solution there doesn't apply to my situation. My relative asked me to install H&R Block 2009 on his Windows Vista 32-bit computer. I ran the installation program, which succeeded, but when I try to open the application itself, it gives me the following error: The application failed to start because its side-by-side configuration is incorrect. Please see the application event log for more detail. Here are the steps I've done so far to try and remedy this problem: In elevated command prompt, run the command: sfc /scannow Uninstall H&R Block 2009 Uninstall Microsoft Visual C++ 2005 Redistributable Reinstall Microsoft Visual C++ 2005 Redistributable by downloading from MSFT website Reinstall H&R Block 2009 This didn't fix it. I've searched for a long time and haven't found anything that works. The H&R Block site itself states that the way to fix this problem is to uninstall and reinstall H&R Block 2009. Has anyone run into this issue before? If so, how can I fix it? Thanks in advance.

    Read the article

  • VNC error: "Could not connect to session bus: Failed to connect to socket"

    - by GJ
    I started a vncserver on display :1 on an ubuntu machine. When I connect to it, I get a grey X window with an error message Could not connect to session bus: Failed to connect to socket. The vnc log is: Xvnc Free Edition 4.1.1 - built Apr 9 2010 15:59:33 Copyright (C) 2002-2005 RealVNC Ltd. See http://www.realvnc.com for information on VNC. Underlying X server release 40300000, The XFree86 Project, Inc Sun Mar 20 15:33:59 2011 vncext: VNC extension running! vncext: Listening for VNC connections on port 5901 vncext: created VNC server for screen 0 error opening security policy file /etc/X11/xserver/SecurityPolicy Could not init font path element /usr/X11R6/lib/X11/fonts/Type1/, removing from list! Could not init font path element /usr/X11R6/lib/X11/fonts/Speedo/, removing from list! Could not init font path element /usr/X11R6/lib/X11/fonts/misc/, removing from list! Could not init font path element /usr/X11R6/lib/X11/fonts/75dpi/, removing from list! Could not init font path element /usr/X11R6/lib/X11/fonts/100dpi/, removing from list! cat: /var/run/gdm/auth-for-link2-eGnVvf/database: No such file or directory gnome-session[24880]: WARNING: Could not make bus activated clients aware of DISPLAY=:1.0 environment variable: Failed to connect to socket /tmp/dbus-FhdHHIq8jt: Connection refused gnome-session[24880]: WARNING: Could not make bus activated clients aware of GNOME_DESKTOP_SESSION_ID=this-is-deprecated environment variable: Failed to connect to socket /tmp/dbus-FhdHHIq8jt: Connection refused gnome-session[24880]: WARNING: Could not make bus activated clients aware of SESSION_MANAGER=local/dell:@/tmp/.ICE-unix/24880,unix/dell:/tmp/.ICE-unix/24880 environment variable: Failed to connect to socket /tmp/dbus-FhdHHIq8jt: Connection refused Sun Mar 20 15:34:10 2011 Connections: accepted: 0.0.0.0::51620 SConnection: Client needs protocol version 3.8 SConnection: Client requests security type VncAuth(2) VNCSConnST: Server default pixel format depth 16 (16bpp) little-endian rgb565 VNCSConnST: Client pixel format depth 16 (16bpp) little-endian rgb565 gnome-session[24880]: Gtk-CRITICAL: gtk_main_quit: assertion `main_loops != NULL' failed gnome-session[24880]: CRITICAL: dbus_g_proxy_new_for_name: assertion `connection != NULL' failed Any ideas how to fix it?

    Read the article

  • Blocking the Apple OS X App Store

    - by Jon Rhoades
    Being the evil corporate IT overlords we need to block the new OS X App Store. As you may be aware the 10.6.6 update installs the App Store App which allows users to download and install apps without admin privileges. Some Suggestions: Don't update to 10.6.6+ Use parental controls Presumably some OD policy (if you have an OD server which we don't) Block the App store by DNS or Proxy Not updating to 10.6.6+ isn't really a long term solution as it contains security fixes and new Macs will come with it anyway. Blocking the App store at a network level doesn't solve laptop users. Ideally a simple system preference or editing of a plist that can be pushed out by ARD would be the best solution. Please note the question isn't should we block the App store, it's how we can block the App store.

    Read the article

< Previous Page | 135 136 137 138 139 140 141 142 143 144 145 146  | Next Page >